Skin hypoxia injury organ-like model and construction method
By cultivating skin organoids differentiated by mouse embryonic stem cells in a hypoxic environment, a high bionicity-based organoid model of skin hypoxia damage was constructed, which solved the problems of low bionicity and poor controllability in the existing technology, and realized an effective tool for researching the mechanism of skin hypoxia damage and drug screening.
Patent Information
- Application Number
- CN202510330325.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-20
- Publication Date
- 2025-07-18
AI Technical Summary
The existing technology lacks a high bionic organoid model for skin hypoxia damage. The in vitro model cannot truly reduce the skin damage under hypoxia conditions. The in vivo model is difficult to accurately control the degree of skin hypoxia and has ethical problems.
The skin organoids obtained by differentiating mouse embryonic stem cells are cultured in a hypoxic environment. The specific steps include subculture, differentiation culture and hypoxia treatment. The culture conditions are 1 to 3% O2, 3 to 8% CO2, and the culture time is 45 to 50 hours to form a skin hypoxia-damaged organoid model with increased expression of the hypoxia-induced factor HIF-1α.
The constructed organoid model of skin hypoxia damage has high bionicity, showing typical characteristics such as decreased activity, increased expression of hypoxia-induced factor, and response to signal pathways related to hypoxia damage. It is suitable for skin hypoxia damage mechanism research and drug screening.
Smart Images

Figure CN120330125A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of tissue engineering, and more specifically, to an organoid model of skin hypoxia injury, a construction method thereof, and an application thereof. Background Art
[0002] The skin is an important physiological barrier for the body to resist external environmental damage. Hypoxia factors in high-altitude areas and special environments can cause various pathological stress responses in the skin. Acute short-term hypoxia can cause changes in the metabolic capacity of skin cells, leading to an increase in the secretion and release of inflammatory mediators, resulting in local immune responses. Long-term chronic hypoxia, on the other hand, can affect the migration of skin cells, melanin production, sensitivity to temperature stimuli, and skin barrier function. In addition, hypoxic conditions also have an important adverse impact on wound healing. Therefore, it is necessary to establish a pathological model of skin injury caused by hypoxia to further study the mechanism of tissue injury and better cope with the challenges of extreme hypoxic environments, so as to ensure long-term skin health.
[0003] Currently, the research models for skin injury caused by hypoxic environments include in vitro models and in vivo models. The in vitro models mainly include two-dimensional monolayer cell culture models and multicellular co-culture models. By reducing the oxygen concentration in the cell culture environment, hypoxic injury responses are induced. However, due to the lack of three-dimensional tissue structure and complex cell-cell interactions, in vitro models cannot truly reproduce skin injury under hypoxic conditions. In vivo models mainly use animal models, but it is very difficult to achieve hypoxia in a single skin tissue, and whole-body hypoxia models often cannot accurately control the degree of skin hypoxia and there are potential ethical issues. Therefore, how to establish an accurate and stable skin hypoxia model has become the key to solving the problem.
[0004] With the continuous development of biotechnology, organoids, as a new type of biological model, have shown great potential in the fields of biomedical research, drug screening, etc. The skin organoids constructed by Lee et al. through the differentiation of induced pluripotent stem cells can present an almost complete in vitro self-organized skin structure, and include appendages such as hair follicles and neural networks, which are ideal tools for in vitro modeling.
[0005] However, there is no report on an organoid model with high biomimetic degree and applied to the study of skin injury caused by hypoxic environments in the prior art, and this will provide new ideas for the development of the organoid construction technology field. Summary of the Invention
[0006] The present invention provides a skin hypoxia injury organoid model, a construction method and an application thereof. The model is obtained by culturing skin organoids differentiated from mouse embryonic stem cells in a hypoxic environment, and has typical characteristics of decreased activity, increased expression of hypoxia-inducible factor, and response of hypoxia injury-related signaling pathways, with high biomimicry, aiming to solve the problems of lack of three-dimensional in vitro models, low biomimicry of models, and low controllability in existing skin hypoxia injury research.
[0007] To achieve the above object, in the first aspect, the present invention provides a skin hypoxia injury organoid model, which is obtained by culturing skin organoids directionally differentiated from mouse embryonic stem cells of the 15th to 30th passages after subculture in a hypoxic environment of 1-3% O2 and 3-8% CO2 for 45-50 h. The expression level of hypoxia-inducible factor HIF-1α in the skin hypoxia injury organoid model increases to 1.2-2.8 times within 1-48 hours.
[0008] In the second aspect, a construction method of the skin hypoxia injury organoid model is provided, including the following steps:
[0009] Preparation steps before inducing differentiation of embryonic stem cells:
[0010] The mouse embryonic stem cells are subcultured with LIF-2i medium, and the cell subculture rate is maintained at 70-80%.
[0011] Steps of inducing differentiation of stem cells:
[0012] The mouse embryonic stem cells of the 10th to 30th passages after subculture are digested;
[0013] The digested mouse embryonic stem cells are differentiated and cultured with a basic ectoderm differentiation medium or an ectoderm differentiation medium to obtain cell aggregates; the ectoderm differentiation medium includes a basic ectoderm differentiation medium, and one or more of Matrigel, BMP-4, SB431542, LDN, and FGF-2;
[0014] The cell aggregates are matured and cultured with a maturation medium or a maturation medium containing Matrigel to obtain the skin organoids;
[0015] Steps of treating skin organoids in a hypoxic environment: The mature skin organoids are cultured in a culture environment of 1-3% O2 and 3-8% CO2 for 45 h-50 h to obtain a skin hypoxia injury organoid model.
[0016] In the third aspect, the application of the skin hypoxia injury organoid model in the first or second aspect in the research of skin hypoxia injury mechanism and drug screening is provided.
[0017] The fourth aspect provides a skin hypoxia injury organoid, which is obtained based on the construction method of the skin hypoxia injury organoid model in part of the second aspect.
[0018] The above technical solutions of the present invention have the following beneficial effects: The skin hypoxia injury organoid model of the present invention has typical characteristics such as decreased activity, increased expression of hypoxia-inducible factor, and response of hypoxia injury-related signaling pathways, with high biomimetic degree. BRIEF DESCRIPTION OF THE DRAWINGS
[0019] Figure 1 : Morphology of the skin organoid constructed in the present invention and immunofluorescence staining of key markers; a, general view of the organoid, b, HE staining, c, immunofluorescence staining of the hair follicle marker CK17;
[0020] Figure 2 : PCR results of hypoxia-inducible factor (HIF-1α) in the skin hypoxia injury organoid of the present invention;
[0021] Figure 3 : Analysis of gene expression differences before and after injury in the skin hypoxia injury organoid model constructed in the present invention; where Organoid is the normal skin organoid, and Organoid+HP (Hypoxia) is the skin organoid model under hypoxia treatment; a, PCA diagram, b, heat map of up-regulated and down-regulated differentially expressed genes, c, bar chart of the number of differentially expressed genes;
[0022] Figure 4 : GO analysis diagram of up-regulated genes among differentially expressed genes before and after injury in the skin hypoxia injury organoid model constructed in the present invention;
[0023] Figure 5 : GO analysis diagram of down-regulated genes among differentially expressed genes before and after injury in the skin hypoxia injury organoid model constructed in the present invention;
[0024] Figure 6 : Heat map of gene expression of the HIF1-α signaling pathway before and after injury in the skin hypoxia injury organoid model constructed in the present invention;
[0025] Figure 7 : To clarify the key mechanism of skin hypoxia injury by protein-protein interaction network analysis (PPI) using the skin hypoxia injury organoid model constructed in the present invention;
[0026] Figure 8 : To screen prevention and treatment targets by protein-protein interaction network analysis (PPI) using the skin hypoxia injury organoid model constructed in the present invention. DETAILED DESCRIPTION OF THE INVENTION
[0027] The following examples further illustrate the content of the present invention, but should not be construed as limiting the present invention. Without departing from the spirit and essence of the present invention, modifications or substitutions made to the methods, steps or conditions of the present invention all fall within the scope of the present invention.
[0028] Sources of reagents, culture media, kits, instruments or consumables, etc.:
[0029] R1 mouse embryonic stem cells (mESCs) (Cyagen Biosciences, MUAES-01001); TrypLE cell digestive enzyme (TrypLE Express Enzyme (1X), no phenol red, Thermo Fisher); Matrigel (matrix gel -20 °C, 2446 cell culture differentiation, Biofroxx biological reagent, Germany); bone morphogenetic protein 4 (BMP-4) (PeproTech); SB-431542 is a TGF-β receptor kinase inhibitor (TRKI), with the molecular formula C 22 H 16N4O3 (Stemgent); Low-dose Naltrexone (LDN) (Stemgent); Fibroblast Growth Factor-2 (FGF-2) (PeproTech); TRIzol (Thermo Fisher, 15596018); NanoDrop ND-1000 Microvolume Nucleic Acid and Protein Quantimeter (NanoDrop, Wilmington, DE, USA); Agilent Bioanalyzer 2100 (Agilent, CA, USA); oligo(dT) magnetic beads (Dynabeads Oligo(dT), cat. 25-61005, Thermo Fisher, USA); Magnesium RNA Fragmentation Module (NEBNext Magnesium RNA Fragmentation Module, cat. E6150S, USA); InvitrogenTM SuperScript II Reverse Transcriptase (InvitrogenTM SuperScript II Reverse Transcriptase, cat. 1896649, CA, USA); E. coli DNA polymerase I (NEB, cat. m0209, USA); RNase H (Ribonuclease H) (NEB, cat. m0297, USA); dUTP Solution (Thermo Fisher, cat. R0133, CA, USA); UDG enzyme (Uracil-DNA Glycosylase) (NEB, cat. m0280, MA, US); illumina NovaseqTM 6000 gene sequencer (Hangzhou Lianchuan Biotechnology Co., Ltd.)
[0030] DMEM / F12 (Gibco); Neurobasal Medium (Gibco); B-27 Supplement (Gibco); GlutaMAX Supplement (Gibco); Leukemia Inhibitory Factor (PeproTech); PD0325901 (Stemgent); CHIR99021 (Stemgent); GMEM Medium (Gibco); Knockout Serum Replacement (Gibco); MEM Non-Essential Amino Acids Solution 11140050 (Gibco); Sodium Pyruvate (Gibco); 2-Mercaptoethanol (Gibco); Normocin Antimicrobial Reagent (Invivogen); Advanced DMEM / F12 Medium (Gibco); N2 Supplement (Gibco); GlutaMAX TM Supplement (Gibco);
[0031] 6-well transparent plate (6-well cell culture plate) (Nunclon Sphera); 96-well low cell adhesion U-bottom plate (Nunclon Sphera, Thermo Scientific); 24-well low cell adhesion bottom plate (24-well cell culture plate) (Nunclon Sphera).
[0032] Glossary:
[0033] Cutadapt refers to a software tool for processing various sequencing data; HISAT2 refers to a genomic alignment software tool; StringTie refers to software for RNA-Seq data analysis; RIN value (RNA integrity number) is an index developed by Agilent for evaluating the integrity of RNA, with a range of 1 - 10, where 1 represents the most severely degraded RNA and 10 represents the most intact RNA. The RIN value is calculated when detecting total eukaryotic RNA using an Agilent 2100 bioanalyzer. "1×" represents the standard concentration, that is, prepared according to the standard ratio in the instruction manual or formula. If the standard concentration of a certain supplement is 1000 ug / ml, then 1× supplement means the concentration of this supplement in the culture medium is 1000 ug / ml. "Final concentration" refers to the final concentration of the solute in the culture medium.
[0034] The following will describe the embodiments of the present invention in detail with reference to the accompanying drawings and examples.
[0035] In some embodiments, the skin hypoxia injury organoid model of the present invention is obtained by culturing skin organoids differentiated from mouse embryonic stem cells in a hypoxic environment. The "hypoxic environment" includes, but is not limited to, culturing the skin organoids in a hypoxic maturation medium with high glucose.
[0036] In some embodiments, the skin hypoxia injury organoid model of the present invention exhibits typical characteristics of skin hypoxia injury lesions such as increased expression of hypoxia-inducible factors and responses of hypoxia injury-related signaling pathways. "Typical characteristics" refer to that the content of hypoxia-inducible factor HIF-1α is higher than the normal value, and the hypoxia injury-related genes: α-enolase (Eno1), α-enolase 1b (Eno1b), eukaryotic translation initiation factor 2α kinase 3 (Egln1), vascular endothelial growth factor A (Vegfa), and erythropoietin (Epo) are higher than the normal expression levels, and the expression levels of hypoxia injury-related genes are up-regulated or down-regulated.
[0037] In some embodiments, the method for constructing a skin hypoxia injury organoid model includes the following steps:
[0038] Direct the differentiation of mouse embryonic stem cells into skin organoids,
[0039] The method for constructing skin organoids for a skin hypoxia injury organoid model comprises the following steps:
[0040] Mouse embryonic stem cells are subcultured using LIF-2i medium, and the cell passage rate is maintained at 70-80%. The 10th, 15th, 20th, 25th, and 30th passages of mouse embryonic stem cells after subculture are digested;
[0041] The digested mouse embryonic stem cells are differentiated and cultured using a basal ectoderm differentiation medium or an ectoderm differentiation medium to obtain cell aggregates; the ectoderm differentiation medium includes a basal ectoderm differentiation medium and one or more of Matrigel, BMP-4, SB431542, LDN, and FGF-2;
[0042] The cell aggregates are matured and cultured using a maturation medium or a maturation medium containing Matrigel to obtain the skin organoids.
[0043] In constructing a skin hypoxia injury organoid model, the skin organoids are cultured in a hypoxic environment of 1-3% O2 and 3-8% CO2 for 45-50 h, and the expression level of hypoxia-inducible factor HIF-1α in the skin hypoxia injury organoid model of the skin hypoxia injury organoid model increases to 1.2-2.8 times within 1-48 hours.
[0044] In some further embodiments, regarding a skin hypoxia injury organoid model, differentiating mouse embryonic stem cells into skin organoids comprises the following steps:
[0045] Mouse embryonic stem cells (mESCs) are cultured using LIF-2i medium under conditions without feeder cells. The cells are cultured on a gelatin-coated transparent culture plate, and the medium is changed every other day. During the culture of mESCs, the cell passage rate is maintained at 70-80%, and mESCs of 30 generations or lower are used for subsequent experiments. The cells are cultured under conditions of 37 °C, 5% CO2, and 100% humidity throughout the process. In these technical solutions, "LIF-2i medium" is not specifically defined, and known basal media are within the scope of selection of the present invention.
[0046] In some technical solutions, the steps for gelatin-coated culture plates are as follows: dissolve 0.5 g of gelatin in 500 ml of calcium- and magnesium-free PBS (in a water bath at 50 - 65 °C for 15 - 30 minutes) to prepare 500 ml of 0.1% gelatin solution. Without cooling the solution, filter it using a 0.22 μm filter membrane, and then store it at 4 °C for later use. Add sufficient gelatin solution to the culture plate to completely cover its surface. After leaving it at room temperature for 30 minutes, remove the excess gelatin solution, and then store the culture plate at room temperature in a packaging bag.
[0047] The LIF-2i medium for mESCs culture is composed of DMEM / F12 and Neurobasal Medium mixed in a volume ratio of (1 - 5):(1 - 5), and simultaneously supplemented with 0.1 - 1.0×N2 supplement, 0.1 - 1.0×B-27 supplement, 0.5 - 2×GlutaMAX supplement, 500 - 2000 U / ml leukemia inhibitory factor, 0.5 - 2 μM PD0325901, 1 - 5 μM CHIR99021, and 50 - 200 μg / ml Normocin. In a further technical solution, the "LIF-2i medium" is composed of DMEM / F12 and Neurobasal Medium mixed in a volume ratio of (1, 2, 3, 4, or 5):(1, 2, 3, 4, or 5), and simultaneously supplemented with 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, or 1.0×N2 supplement, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, or 1.0×B-27 supplement, 0.5, 1.0, 1.5, or 2×GlutaMAX supplement, 500, 1000, or 2000 U / ml leukemia inhibitory factor, 0.5, 1.0, 1.5, or 2 μM PD0325901, 1, 2, 3, 4, or 5 μM CHIR99021, and 50, 100, 150, or 200 μg / ml Normocin.
[0048] Differentiate and culture the subcultured mouse embryonic stem cells using the basal ectoderm differentiation medium or the ectoderm differentiation medium to obtain cell aggregates; the ectoderm differentiation medium includes the basal ectoderm differentiation medium, and one or more of Matrigel, BMP-4, SB431542, LDN, and FGF-2; in these technical solutions, the "basal ectoderm differentiation medium (sometimes simply referred to as the 'ectoderm differentiation medium')" is not specifically defined, and known basal media are within the scope of selection of the present invention. In a further technical solution, the components of the "basal ectoderm differentiation medium" include: GMEM medium, and 1 - 3% (v / v) Knockout
[0049] Serum substitute (where "v / v" represents the volume ratio of the Knockout TM serum substitute to GMEM medium, the same below), 1 - 3×MEM non-essential amino acid solution, sodium pyruvate with a final concentration of 1 - 3 mM, 2-mercaptoethanol with a final concentration of 0.05 - 0.25 mM, and Normocin with a final concentration of 50 - 200 μg / ml. In a further technical solution, the components of the "basic ectoderm differentiation medium" include: GMEM medium, and 1, 2 or 3% (v / v) Knockout
[0050] serum substitute, 1, 2 or 3×MEM non-essential amino acid solution, sodium pyruvate with a final concentration of 1, 2 or 3 mM, 2-mercaptoethanol with a final concentration of 0.05, 0.1, 0.15, 0.20 or 0.25 mM, and Normocin with a final concentration of 50, 100, 150 or 200 μg / ml. In a further technical solution, there is also a "Matrigel-containing ectoderm differentiation medium", which, on the basis of the "basic ectoderm differentiation medium", further contains 2 - 6% (v / v) Matrigel (where "v / v" represents the volume ratio of Matrigel to the "mature medium", the same below). In a further technical solution, the "Matrigel-containing ectoderm differentiation medium" contains 2, 3, 4, 5 or 6% (v / v) Matrigel.
[0051] In a further technical solution, there is also a "Matrigel-containing ectoderm differentiation medium supplemented with BMP-4 and 5 μM SB431542", which, on the basis of the "basic ectoderm differentiation medium", further contains 25 - 75 ng / mL of BMP-4 and 1 - 10 μM of SB431542. In a further technical solution, the "Matrigel-containing ectoderm differentiation medium supplemented with BMP-4 and 5 μM SB431542" contains 25, 30, 35, 40, 45, 50, 55, 60, 65, 70 or 75 ng / mL of BMP-4 and 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 μM of SB431542.
[0052] In a further technical solution, there is also a "Matrigel-containing ectoderm differentiation medium supplemented with BMP-4 and 5 μM SB431542", which, on the basis of the "Matrigel-containing ectoderm differentiation medium", further contains a final concentration of 5 - 20 ng / mL of BMP-4 and a final concentration of 0.5 - 2 μM of SB431542. In a further technical solution, the "Matrigel-containing ectoderm differentiation medium supplemented with BMP-4 and 5 μM SB431542" contains a final concentration of 5, 10, 15 or 20 ng / mL of BMP-4 and a final concentration of 0.5, 1, 1.5 or 2 μM of SB431542.
[0053] In a further technical solution, it also includes an "ectoderm differentiation medium containing BMP-4 and 5 μM SB431542", which, on the basis of the "basic ectoderm differentiation medium", further contains 2-10 μM of LDN and 50-300 ng / mL of FGF-2. In a further technical solution, in the "ectoderm differentiation medium containing BMP-4 and 5 μM SB431542", it contains 2, 3, 4, 5, 6, 7, 8, 9 or 10 μM of LDN and 50, 100, 150, 200, 250 or 300 ng / mL of FGF-2.
[0054] In a further technical solution, it also includes an "ectoderm differentiation medium containing LDN and FGF-2", which, on the basis of the "ectoderm differentiation medium containing BMP-4 and 5 μM SB431542", further contains LDN with a final concentration of 0.5-2 μM and FGF-2 with a final concentration of 10-40 ng / mL. In a further technical solution, in the "ectoderm differentiation medium containing LDN and FGF-2", it contains LDN with a final concentration of 0.5, 1, 1.5 or 2 μM and FGF-2 with a final concentration of 10, 15, 20, 25, 30, 35 or 40 ng / mL.
[0055] The cell aggregates are matured using a maturation medium or a maturation medium containing Matrigel to obtain the skin organoids. In these technical solutions, the "maturation medium" is not specifically defined, and known basal media are within the scope of selection of the present invention. In a further technical solution, the components of the "maturation medium" include: Advanced DMEM / F12 medium, and 1-3×N2 supplement, 1-3×GlutaMAX TM supplement and Normocin with a final concentration of 50-200 g / ml. In a further technical solution, the components of the "maturation medium" include: Advanced DMEM / F12 medium, and 1, 2 or 3×N2 supplement, 1, 2 or 3×GlutaMAX TM supplement and Normocin with a final concentration of 50, 100, 150 or 200 g / ml. In a further technical solution, the "maturation medium containing Matrigel" contains 2-6% (v / v) of Matrigel (where "v / v" represents the volume ratio of Matrigel to the "maturation medium", the same below). In a further technical solution, the "maturation medium containing Matrigel" contains 2, 3, 4, 5 or 6% (v / v) of Matrigel.
[0056] In some further embodiments, it relates to a skin hypoxic injury organoid model, and the hypoxic culture method includes the following steps:
[0057] The mature skin organoids are cultured in a culture environment of 1-3% O2 and 3-8% CO2 for 45 h to 50 h.
[0058] In some further embodiments, it relates to a skin hypoxia injury organoid model. The hypoxia injury-related genes of the skin hypoxia injury organoid model include alpha-enolase (Eno1), alpha-enolase 1b (Eno1b), eukaryotic translation initiation factor 2 alpha kinase 3 (Egln1), vascular endothelial growth factor A (Vegfa), and erythropoietin (Epo). The expression of the hypoxia injury-related genes is upregulated by at least 2-fold.
[0059] The present invention will be described below in conjunction with some further embodiments.
[0060] Example 1 Construction of skin hypoxia injury organoids
[0061] (1) Maintenance culture of embryonic stem cells (ESCs): Using the commercially purchased mouse R1 cell line, mESCs are cultured in LIF-2i medium without feeder cells. The cells are cultured on a 6-well transparent plate coated with 0.1% (w / v) gelatin, and the medium is changed every other day. The cell passage rate is maintained at 75%. The 30th passage of mESCs is used for subsequent experiments.
[0062] (2) Inductive differentiation of skin organoids: On day 0, mESCs are separated with 1×TrypLE digestive enzyme, resuspended in ectoderm differentiation medium, and seeded on a 96-well low-cell adhesion U-bottom plate (Nunclon Sphera, Thermo Scientific) at a final concentration of 3×10 3 / 100 μL cells per well.
[0063] On day 1, 50 μL of the medium is removed from each well, and 50 μL of fresh ectoderm differentiation medium containing 4% (v / v) Matrigel (final concentration 2%) is supplemented.
[0064] On day 3, 25 μL of ectoderm differentiation medium (without Matrigel) containing 50 ng / mL BMP-4 and 5 μM SB431542 is added to each well, so that the final volume is 125 μL / well. The final concentrations of BMP-4 and SB431542 are 10 ng / mL and 1 μM, respectively.
[0065] On the 4th day, 25 μL of ectoderm differentiation medium (without Matrigel), which contains 6 μM LDN and 150 ng / mL FGF-2, was added to each well, bringing the final volume to 150 μL / well, and the final concentrations of LDN and FGF-2 were 1 μM and 25 ng / mL, respectively.
[0066] On the 8th day, each cell aggregate was transferred to a well on a 24-well low-cell adhesion bottom plate (Nunclon Sphera) in 500 μL of maturation medium containing 1% (v / v) Matrigel.
[0067] Starting from the 10th day, half of the medium (250 μL) was removed every other day and supplemented with 250 μL of maturation medium without Matrigel until skin organoids were obtained on the 30th day.
[0068] LIF-2i medium is composed of a 1:1 mixture of DMEM / F12 and Neurobasal Medium, supplemented with 0.5× N2 supplement, 0.5× B-27 supplement, 1× GlutaMAX supplement, 10 3 U / ml leukemia inhibitory factor, 1 M PD0325901, 3 M CHIR99021, and 100 μg / ml Normocin.
[0069] The ectoderm differentiation medium uses GMEM medium and is supplemented with 1.5% (v / v) Knockout Serum Replacement, 1× MEM non-essential amino acid solution, 1 mM sodium pyruvate, 0.1 mM 2-mercaptoethanol, and 100 μg / ml Normocin.
[0070] The maturation medium uses Advanced DMEM / F12 medium and is supplemented with 1× N2 supplement, 1× GlutaMAX supplement, and 100 μg / ml Normocin.
[0071] For the construction and structural identification of skin organoids, see Figure 1 , the constructed skin organoids were white ellipsoids, approximately 1 mm in size, and pigmented hairs were visible on the surface (a); HE section showed that the skin organoids had an internally keratinized epidermal part and a substantial dermal part, and scattered hair follicles were visible (b); immunofluorescence staining of the skin organoid sections for the hair follicle key marker keratin 17 (CK17) showed high expression of CK17 at the hair follicle section, confirming the presence of hair follicles (c). Therefore, the organoid construction protocol used in this experiment can cultivate skin organoids with the basic structure of the skin and hairs in vitro, and the experimental method is reliable.
[0072] Example 2 Construction of a Skin Hypoxia Injury Organoid Model
[0073] Based on the method for constructing skin organoids in Example 1,
[0074] Hypoxic treatment of skin organoids: On the 30th day, the mature skin organoids were placed in a culture environment of 37 °C, 5% CO2, and 1% O2 for culture until the 32nd day to obtain a skin hypoxic injury organoid model.
[0075] Control Example 1 constructs a skin hypoxic injury-free organoid model
[0076] Different from Example 2, the skin organoids were cultured in a maturation medium.
[0077] Starting from the 30th day of Example 1, half of the maturation medium (250 μL) was removed every other day and supplemented with 250 μL of the maturation medium until the 32nd day of Example 1 to obtain a skin hypoxic injury-free organoid model.
[0078] Experimental Example 1 Hypoxia-inducible factor expression assay
[0079] Experimental method: Based on the principle of molecular biology, the skin hypoxic injury organoid models of Example 2 and Control Example 1 were used to analyze the expression of hypoxia-inducible factor HIF-1α by PCR to detect the degree of hypoxia.
[0080] Test method: Total RNA was isolated from the organoids using TRizol reagent (Invitrogen, USA). The RNA concentration was measured using a NanoPhotometer (Implen GmbH, P-330-31, Germany). Reverse transcription was performed using a complementary DNA synthesis kit (Takara, China). Gene expression was quantitatively analyzed using SYBR Green and a 7500 real-time PCR system (Takara, China). PCR and probes for the gene were designed based on the published gene sequences (National Center for Biotechnology Information and PubMed). The 2 -△△ -CT method was used to calculate the gene expression level, and normalization was performed against glyceraldehyde 3-phosphate dehydrogenase (GAPDH). Each sample was evaluated in triplicate. Sequence of Hif-1α: Forward Primer ACCTTCATCGGAAACTCCAAAG; Reverse Primer CTGTTAGGCTGGGAAAAGTTAGG.
[0081] See the test results in Figure 2, compared with Control Example 1, HIF-1α in the experimental group began to increase immediately after hypoxia treatment, reaching 1.4 times that of the control group at 2 h, 2.1 times at 6 h, reaching the peak at 12 h, 2.6 times that of the control group, and then the expression level gradually decreased, being 1.5 times that of the control group at 48 h. The present invention successfully induced the expression of key effector molecules in the hypoxia response of organoids, and the model construction scheme is effective.
[0082] Experimental Example 3 Transcriptome Sequencing Analysis of Skin Hypoxia Injury Organoid Model - Experiment on Changes in the Levels of Hypoxia Injury-Related Signaling Pathways
[0083] Experimental group: Using the skin hypoxia injury organoid model of Example 2, with 3 samples in each group;
[0084] Control group: The organoid model without skin hypoxia injury of Control Example 1, with 3 samples in each group;
[0085] Experimental method: Collect the experimental group and the control group, and use TRIzol (Thermo Fisher, 15596018) to isolate and purify the RNA of the total samples according to the operation protocol provided by the manufacturer. Then use NanoDrop ND-1000 (NanoDrop, Wilmington, DE, USA) to quality control the quantity and purity of the total RNA and detect the integrity of the RNA through Bioanalyzer 2100 (Agilent, CA, USA); a concentration > 50 ng / μL, RIN value > 7.0, and total RNA > 1 μg meet the requirements of downstream experiments.
[0086] Use oligo(dT) magnetic beads (Dynabeads Oligo(dT), cat. 25-61005, Thermo Fisher, USA) to specifically capture the mRNA with PolyA (polyadenylic acid) among them through two rounds of purification. Fragment the captured mRNA under high-temperature conditions using a magnesium ion fragmentation kit (NEBNext® Magnesium RNA Fragmentation Module, cat. E6150S, USA), at 94 °C for 5 - 7 minutes. Synthesize cDNA from the fragmented RNA under the action of reverse transcriptase (Invitrogen SuperScript™ II Reverse Transcriptase, cat. 1896649, CA, USA).
[0087] Then, E.coli DNA polymerase I (NEB, cat. m0209, USA) and RNase H (NEB, cat. m0297, USA) were used for second-strand synthesis to convert the double-stranded DNA-RNA hybrids into double-stranded DNA. Meanwhile, dUTP Solution (Thermo Fisher, cat. R0133, CA, USA) was incorporated into the second strand to fill in the ends of the double-stranded DNA to make them blunt ends, and then an A base was added to each end to enable ligation with adapters with T bases at the ends. Magnetic beads were used to screen and purify the fragments according to their sizes.
[0088] The second strand was digested with UDG enzyme (NEB, cat. m0280, MA, US), and then PCR was performed - pre-denaturation at 95°C for 3 minutes, denaturation at 98°C for a total of 8 cycles with 15 seconds each, annealing at 60°C for 15 seconds, extension at 72°C for 30 seconds, and finally extension at 72°C for 5 minutes to form a library (strand-specific library) with a fragment size of 300bp ± 50bp.
[0089] Finally, paired-end sequencing was performed on it using illumina NovaseqTM 6000 (LC Bio Technology CO., Ltd. Hangzhou, China) according to the standard operation, and the sequencing mode was PE150. After using Cutadapt to filter out the unqualified sequences (sequencing adapters, low-quality sequences, etc.) in the raw data to obtain the valid data (Clean Data), Hisat2 was used for alignment with the reference genome. According to the alignment results of Hisat2, StringTie was used to reconstruct the transcripts and calculate the expression levels of all genes in each sample.
[0090] The analysis of gene expression levels mainly targeted the protein-coding genes (mRNA) annotated in the genome, counted the gene expression levels, and used this to evaluate the correlation of gene expression characteristics within and between groups of samples and the differentially expressed genes.
[0091] When measuring the gene expression level, the FPKM value (Fragments Per Kilobase Million, normalized from the raw reads count of the gene) was used as the measurement index of gene expression level, and the gene expression levels in different samples were counted. Taking the fold change >= 2 (i.e., the absolute value of log2FC >= 1) and q value < 0.05 (the q value is the corrected value of the p value) as the threshold criteria for screening differentially expressed genes (|log2FC| >= 1 & q < 0.05), differentially expressed genes were obtained in the set comparison groups and enrichment analysis was performed;
[0092] By performing transcriptomic sequencing analysis, the pathological characteristics of hypoxic damaged skin organoids were studied. Specifically, skin organoid aggregates treated under pathological conditions were collected and immediately added with TRIzol for preservation. RNA of the samples was extracted and subjected to sequencing experiments, including RNA extraction, RNA quality assessment, and library construction on the machine. After sequencing, the data was downloaded and filtered to obtain valid data, and finally gene quantitative analysis was performed. The data was annotated and differentially expressed genes were selected. The threshold criteria for screening differentially expressed genes were fold change (foldchange) >= 2 (i.e., the absolute value of log2FC >= 1) and q value < 0.05 (the q value is the corrected value of the p value) (|log2FC| >= 1 & q < 0.05). In the set comparison groups, differentially expressed genes were obtained and enrichment analysis was performed, with a focus on changes in the levels of signal pathways related to hypoxic damage.
[0093] The experimental results are shown in Figure 3 . Principal component analysis showed that the within-group differences between the control group and the experimental group were small, demonstrating the stability and repeatability of the model. At the same time, there were obvious differences between the groups (a); The heatmap of differentially expressed genes showed that the gene expression patterns between the two groups were significantly different, proving that hypoxia successfully caused changes in the gene expression of skin organoids, and the method for constructing this model was effective (b); Compared with the control group, there were 625 upregulated genes and 1029 downregulated genes in the experimental group (c).
[0094] See Figures 4 - 6 As shown in, GO analysis was performed on the upregulated genes in the experimental group. The results found that in terms of biological processes, the pathways related to hypoxia response were significantly enriched, further demonstrating the stability and effectiveness of the model ( Figure 4 ); GO analysis was performed on the downregulated genes, and multiple pathways related to mitosis and cell proliferation were enriched, proving the mechanism of skin damage caused by hypoxia ( Figure 5 ); Heatmap analysis was performed on the genes related to the HIF-1α signaling pathway. The results found that related genes such as enolase alpha (Eno1), enolase 1b (Eno1b), eukaryotic translation initiation factor 2 alpha kinase 3 (Egln1), vascular endothelial growth factor A (Vegfa), and erythropoietin (Epo) were upregulated by 2 times or more in the experimental group, indicating the key effector molecules of skin hypoxia response ( Figure 6 ).
[0095] Based on the experimental results of Test Examples 1 to 3 above, the skin hypoxia damaged organoid model of the present invention has typical characteristics of skin hypoxia damaged lesions such as increased expression of hypoxia-inducible factor HIF-1α and response of hypoxia damage related signal pathways, and has a high degree of biomimesis.
[0096] Example 4 Screening of Key Effector Targets for Hypoxic Damage
[0097] Statistical analysis was performed on genes involved in hypoxia-related pathways and genes and pathways related to cell mitosis respectively. Genes enriched 2 times or more in hypoxia or cell mitosis-related entries were subjected to protein-protein interaction network analysis (PPI). The results (see Figure 7 and Figure 8 ) showed that for the hypoxia response, vascular endothelial growth factor A (Vegfa), which regulates angiogenesis, and EGL-9 homolog 1 (Egln1), which regulates the stability of HIF-1α, played important roles and were key molecules in the hypoxia response mechanism of skin organoids ( Figure 7 ); for the mitotic inhibition caused by hypoxia, the expression of cell cycle-related genes such as cyclin B1 (Ccnb1), cyclin-dependent kinase 20 (Cdc20), and cyclin-dependent kinase activator 1 (Cdca8) was significantly inhibited. Stabilizing these genes helps ensure the smooth progress of the cell cycle and the stability of cell activity, and they are potential targets for preventing and treating skin hypoxia injury ( Figure 8 ).
[0098] The embodiments of the present invention also have the following beneficial effects:
[0099] (1) The skin hypoxia injury organoid model of the present invention is small in volume, simple in construction method, and good in repeatability, and can meet the requirements of high-throughput and uniform model construction;
[0100] (2) The skin hypoxia injury organoid model of the present invention fills the gap in the construction of in vitro models of skin hypoxia and avoids the defects of difficult control of hypoxia degree and potential ethical issues in in vivo animal experiments.
[0101] (3) The skin hypoxia injury organoid model of the present invention can be used for research on the mechanism of skin hypoxia injury and drug efficacy testing, etc., and has broad application prospects.
[0102] The above-described embodiments are merely described as the preferred embodiments of the present invention and do not limit the scope of the present invention. Without departing from the design spirit of the present invention, various deformations and improvements made by those of ordinary skill in the art to the technical solutions of the present invention shall fall within the protection scope determined by the claims of the present invention.
Claims
1. A skin hypoxia injury organoid model, characterized in that: The skin organoids obtained by the directed differentiation of mouse embryonic stem cells at passages 15-30 are cultured in a hypoxic environment of 1-3% O2 and 3-8% CO2 for 45-50 h. The expression level of hypoxia-inducible factor HIF-1α in the skin organoid model of hypoxic injury increases to 1.2-2.8 times within 1-48 hours.
2. The skin hypoxia injury organoid model according to claim 1, wherein: The skin organoid model of hypoxic injury has differentially expressed genes, and the differentially expressed genes include hypoxia injury-related genes.
3. The skin hypoxia injury organoid model according to claim 2, wherein: The hypoxia injury-related genes of the skin organoid model of hypoxic injury include α-enolase (Eno1), α-enolase 1b (Eno1b), eukaryotic translation initiation factor 2α kinase 3 (Egln1), vascular endothelial growth factor A (Vegfa), and erythropoietin (Epo). The expression of the hypoxia injury-related genes is upregulated by at least 2 times.
4. The skin hypoxia injury organoid model according to any one of claims 1 to 3, characterized in that, It includes the following construction steps: Preparation steps before the induction and differentiation of embryonic stem cells: The mouse embryonic stem cells are passaged using LIF-2i medium, and the cell passage rate is maintained at 70-80%. Stem cell induction and differentiation steps: The mouse embryonic stem cells at passages 10-30 after passage are digested. The digested mouse embryonic stem cells are differentiated and cultured using a basal ectoderm differentiation medium or an ectoderm differentiation medium to obtain cell aggregates. The ectoderm differentiation medium includes a basal ectoderm differentiation medium and one or more of Matrigel, BMP-4, SB431542, LDN, and FGF-2. The cell aggregates are matured and cultured using a maturation medium or a maturation medium containing Matrigel to obtain the skin organoids.
5. The skin organoid model of hypoxic injury according to claim 4, wherein The LIF-2i medium is prepared by mixing DMEM / F12 and Neurobasal Medium at a volume ratio of 1-5:1-5, and simultaneously adding 0.3-1.0×N2 supplement, 0.1-1.0×B-27 supplement, 0.5-2×GlutaMAX supplement, 500-2000 U / ml leukemia inhibitory factor, 0.5-2 μM PD0325901, 1-5 μM CHIR99021, and 80-200 μg / ml Normocin. The components of the basic ectoderm differentiation medium include: GMEM medium, and 1, 1.5 or 2% (v / v) Knockout TM serum substitute, 1, 2 or 3×MEM non-essential amino acid solution, sodium pyruvate with a final concentration of 1, 2 or 3 mM, 2-mercaptoethanol with a final concentration of 0.05, 0.1, 0.15, 0.20 or 0.25 mM, and Normocin with a final concentration of 50, 100, 150 or 200 μg / ml; The components of the maturation medium include: Advanced DMEM / F12 medium, and 1 - 3×N2 supplement, 1 - 3×GlutaMAX supplement, and Normocin with a final concentration of 50 - 200 μg / ml. TM supplement, and Normocin at a final concentration of 50 - 200 μg / ml.
6. The skin hypoxia injury organoid model according to claim 4, characterized in that: It further includes the step of treating the skin organoids in a hypoxic environment: The mature skin organoids are cultured in a culture environment of 1-3% O2 and 3-8% CO2 for 45 h-50 h to obtain the skin organoid model of hypoxic injury.
7. The skin hypoxia injury organoid model according to claim 6, wherein: Culturing is carried out in a hypoxic culture environment of 1% O2 and 5% CO2 for 48 h.
8. The skin hypoxia injury organoid model according to claim 6, wherein: It further includes the step of treating the skin organoids in a hypoxic environment: When detecting the expression of hypoxia-inducible factor HIF-1α by PCR, the hypoxia-inducible factor HIF-1α starts to rise immediately after hypoxia treatment, reaches 1.3-1.5 times at 2 h, 2-2.3 times at 6 h, 2.4-2.8 times at 12 h, and 1.3-1.8 times at 48 h.
9. Use of the skin hypoxia injury organoid model according to any one of claims 1-8 in the study of skin hypoxia injury mechanism and drug screening; preferably: typical features of skin lesions with hypoxia injury include a high content of HIF-1α.
10. A skin hypoxia injury organoid, characterized in that, Obtained by the construction method according to claim 4 or 5.