Heat-resistant embryo culture solution and application thereof

Abstract

The invention discloses a heat-resistant embryo culture solution and application thereof, and belongs to the technical field of embryo culture. The embryo culture solution comprises the pregnancy serum exosome, and the RNA (Ribonucleic Acid) sequence of the pregnancy serum exosome comprises a sequence as shown in SEQ ID No. 1 and a sequence as shown in SEQ ID No. 2. The method is applied to embryo culture, solves the problems of high extraction cost, low efficiency and time consumption of exosomes added into an embryo culture medium at present, and has the characteristics of convenience in extraction and capability of remarkably improving the developmental capacity and quality of embryos cultured in vitro.

Description

Technical Field

[0001] The present invention belongs to the technical field of embryo culture, and particularly relates to a heat-resistant embryo culture solution and its application. Background Art

[0002] According to the latest report of the World Health Organization (WHO), approximately 17.5% of the adult population globally, that is, about one-sixth of adults, are affected by infertility. Infertility has become the third major disease threatening human health after cardiovascular diseases and tumors. In recent years, assisted reproductive technology (ART) has become an important means for treating infertility. A key step in assisted reproduction is the in vitro culture of pre-implantation embryos. During the pre-implantation development of embryos, from the fertilization of mature oocytes to the blastocyst stage, three key biological events occur: zygotic genome activation, compaction, and the first cell fate determination of totipotent fertilized eggs. These key events jointly promote the normal development of embryos and lay the foundation for subsequent implantation and further development.

[0003] Exosomes are small extracellular vesicles released by cells, with a diameter usually between 30 and 150 nm, having a typical lipid bilayer structure, and being able to transmit various biomolecules between cells, including proteins, lipids, RNA, and DNA, playing a crucial role in mediating cell communication. Currently, there have been studies on the effects of exosomes from various sources on early embryonic development in vitro, including fallopian tube fluid, follicular fluid, uterine fluid, seminal plasma, embryos, fallopian tube epithelial cells, endometrial epithelial cells, amniotic cells, and endometrial mesenchymal stem cells, etc. The diversity of exosome sources highlights the extensive and potential applications of exosomes in the embryo culture system. These studies have shown that supplementing exosomes from physiologically normal body fluids and cells in the embryo culture medium system has a positive effect on embryo development. On the contrary, exosomes from cells under pathological conditions show negative effects. This finding emphasizes the importance of the source and condition of exosomes used in the culture medium.

[0004] However, the exosomes currently added to the embryo culture medium all have disadvantages such as high extraction cost and low efficiency. Summary of the Invention

[0005] Aiming at the deficiencies existing in the prior art, the technical problem to be solved by the present invention is the problem that the exosomes currently added to the embryo culture medium have the disadvantages of high extraction cost, low efficiency, and time-consuming. The present invention proposes a heat-resistant embryo culture solution that is convenient to extract and can significantly improve the development ability and quality of embryos cultured in vitro and its application.

[0006] To solve the above technical problem, the technical solution adopted by the present invention is as follows:

[0007] On the one hand, the present invention provides a heat-resistant embryo culture medium, which includes pregnancy serum exosomes. The RNA sequence of the pregnancy serum exosomes includes the sequence shown in SEQ ID No.1 and the sequence shown in SEQ ID No.2.

[0008] Preferably, the concentration of the pregnancy serum exosomes in the embryo culture medium is 0.5 - 1×10 8 particles / 45 μL KSOM.

[0009] Preferably, the embryo culture medium further includes the embryo medium KSOM.

[0010] Preferably, the volume ratio of the pregnancy serum exosomes to the embryo medium KSOM in the embryo culture medium is 1:45.

[0011] On the other hand, the present invention provides the application of the heat-resistant embryo culture medium described in any of the above technical solutions in embryo culture, which is used for the in vitro culture of 2-cell embryos.

[0012] Preferably, it includes: transferring the 2-cell embryos to the pre-equilibrated microdroplets of the embryo culture medium and culturing them in a CO2 incubator.

[0013] Preferably, the number of 2-cell embryos in the microdroplets of the embryo culture medium is 25 - 30 embryos / drop.

[0014] Preferably, the culture conditions are: 37°C, 5% CO2, 100% RH.

[0015] Preferably, it further includes: aspirating the 2-cell embryos with a glass embryo aspiration needle into a clean M2 droplet, washing them, and then transferring them to the pre-equilibrated embryo culture medium.

[0016] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0017] The present invention provides a heat-resistant embryo culture medium, which includes pregnancy serum exosomes. The extraction of serum exosomes is convenient and the pregnancy animal serum exosomes are abundant, facilitating the preparation of an embryo culture medium containing pregnancy serum exosomes. The embryo culture medium added with pregnancy serum exosomes can significantly improve the development ability and quality of in vitro cultured 2-cell embryos and enhance the heat resistance of the embryos. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 It is a transmission electron microscope detection schematic diagram of serum-derived exosomes of mice in three different physiological states according to the present invention;

[0019] Figure 2 It is a nano-particle size detection schematic diagram of the purity and size of serum-derived exosomes of mice in three different physiological states according to the present invention;

[0020] Figure 3 Schematic diagram of the results of Western blotting identification of the marker proteins of exosomes derived from the sera of mice in three different physiological states of the present invention;

[0021] Figure 4 Schematic diagram of representative images of different developmental stages of mouse 2-cell embryos cultured in vitro in KSOM medium supplemented with exosomes derived from the sera of mice in different physiological states of the present invention;

[0022] Figure 5 Blastocyst rate of mouse 2-cell embryos cultured in vitro in KSOM medium supplemented with exosomes derived from the sera of mice in different physiological states of the present invention;

[0023] Figure 6 Blastocyst diameter of mouse 2-cell embryos cultured in vitro in KSOM medium supplemented with exosomes derived from the sera of mice in different physiological states of the present invention;

[0024] Figure 7 Laser confocal image of immunofluorescence of CDX2, a marker of trophoblast cells of the blastocysts of the present invention

[0025] Figure 8 Schematic diagram of the number of trophoblast cells of the blastocysts of the present invention;

[0026] Figure 9 Laser confocal image of immunofluorescence of Cleaved Caspase-3 (CC3), a marker of apoptosis of blastocysts of the present invention;

[0027] Figure 10 Schematic diagram of the number of apoptotic cells of the blastocysts of the present invention;

[0028] Figure 11 Schematic diagram of the expression of lineage differentiation genes (trophoblast cell marker gene Cdx2) and proliferation genes of the blastocysts of the present invention;

[0029] Figure 12 Schematic diagram of the expression of lineage differentiation genes (inner cell mass cell marker gene Oct4) and proliferation genes of the blastocysts of the present invention;

[0030] Figure 13 Schematic diagram of the expression of lineage differentiation genes (inner cell mass cell marker gene Nanog) and proliferation genes of the blastocysts of the present invention;

[0031] Figure 14 Schematic diagram of the expression of lineage differentiation genes (proliferation marker gene Pcna) and proliferation genes of the blastocysts of the present invention;

[0032] Figure 15Schematic representation of representative images of mouse 2-cells cultured in KSOM medium supplemented with exosomes from sera of mice in different physiological states and developed to the morula stage, and then continued to develop to the expanded blastocyst and hatched blastocyst stages after heat stress treatment;

[0033] Figure 16 Development rate of mouse blastocyst stage embryos cultured in KSOM medium supplemented with exosomes from sera of mice in different physiological states in vitro;

[0034] Figure 17 Relative diameter of mouse blastocysts cultured in KSOM medium supplemented with exosomes from sera of mice in different physiological states in vitro;

[0035] Figure 18 Blastocyst rate of mice cultured in KSOM medium supplemented with exosomes from sera of mice in different physiological states in vitro;

[0036] Figure 19 Hatching rate of mice cultured in KSOM medium supplemented with exosomes from sera of mice in different physiological states in vitro;

[0037] Figure 20 ROS fluorescence images of morulae after heat stress treatment, which were obtained by detecting the ROS content immediately after heat stress treatment of mouse 2-cells developed to the morula stage and cultured in KSOM medium supplemented with exosomes from sera of mice in different physiological states;

[0038] Figure 21 Examination of the ROS content of mouse 2-cells developed to the morula stage and cultured in KSOM medium supplemented with exosomes from sera of mice in different physiological states, and then continued to develop to the expanded blastocyst stage after heat stress treatment. ROS fluorescence images of morulae developed to the expanded blastocyst stage after heat stress treatment;

[0039] Figure 22 Examination of the ROS content immediately after heat stress treatment of mouse 2-cells developed to the morula stage and cultured in KSOM medium supplemented with exosomes from sera of mice in different physiological states. Relative fluorescence intensity of ROS in morulae after heat stress treatment;

[0040] Figure 23 Examination of the ROS content of mouse 2-cells developed to the morula stage and cultured in KSOM medium supplemented with exosomes from sera of mice in different physiological states, and then continued to develop to the expanded blastocyst stage after heat stress treatment. Relative fluorescence intensity of ROS in expanded blastocysts;

[0041] Figure 24Detection of the CAT content in mouse 2-cells cultured in KSOM medium supplemented with exosomes from sera of mice in different physiological states and developed to the morula stage, and then continued to develop to the expanded blastocyst stage after heat stress treatment, and confocal laser images of CAT immunofluorescence of expanded blastocysts in each group;

[0042] Figure 25 Detection of the CAT content in mouse 2-cells cultured in KSOM medium supplemented with exosomes from sera of mice in different physiological states and developed to the morula stage, and then continued to develop to the expanded blastocyst stage after heat stress treatment, and relative fluorescence intensity of CAT immunofluorescence of expanded blastocysts in each group;

[0043] Figure 26 Schematic diagram of the effect of adding different concentrations of P-Exos on the development of embryos cultured in vitro in the present invention. Detailed implementation manners

[0044] The technical solutions in the specific embodiments of the present invention will be described in detail and completely below. Obviously, the described embodiments are only partial specific implementation manners of the general technical solution of the present invention, rather than all implementation manners. Based on the general concept of the present invention, all other embodiments obtained by those of ordinary skill in the art fall within the protection scope of the present invention.

[0045] On the one hand, the present invention provides a heat-resistant embryo culture medium, which includes pregnancy serum exosomes. The RNA sequence of the pregnancy serum exosomes includes the sequence shown in SEQ ID No.1 and the sequence shown in SEQ ID No.2. The SEQ ID No.1 sequence is TCCTGTACTGAGCTGCCCCGAG, and the SEQ ID No.2 sequence is CGGGGCCGTAGCACTGTCTGA. The RNA of the pregnancy serum exosomes includes mmu-miR-486b-5p and mmu-miR-128-1-5p, wherein the sequence of mmu-miR-486b-5p is TCCTGTACTGAGCTGCCCCGAG, and the sequence of mmu-miR-128-1-5p is CGGGGCCGTAGCACTGTCTGA.

[0046] Currently, the exosomes added to embryo culture media mainly come from oviduct fluid, follicular fluid, uterine fluid, seminal plasma, embryos, oviduct epithelial cells, endometrial epithelial cells, amniotic cells and endometrial mesenchymal stem cells. However, there is no application of serum exosomes in embryo culture, and the existing exosomes from oviduct fluid, follicular fluid, uterine fluid, seminal plasma, embryos, oviduct epithelial cells, endometrial epithelial cells, amniotic cells and endometrial mesenchymal stem cells all have the disadvantages of high extraction cost, low efficiency and time-consuming.

[0047] Serum exosomes are convenient to extract. In particular, exosomes in the circulation of pregnant mothers are more abundant than in the non-pregnant state, and have the characteristic of being easy to extract. However, not all serum exosomes in physiological states can effectively improve the developmental ability and quality of embryos. In the present invention, three kinds of exosomes were isolated, extracted and identified from the sera of mice in three different physiological states: non-pregnant (NP-Exos), pregnant (P-Exos) and heat-stressed pregnant (HS-P-Exos), and the effects of these exosomes on the development of embryos cultured in vitro were explored. Further, these exosomes were added to the mouse embryo culture medium KSOM, and 2-cell stage embryos collected from the oviducts of superovulated Kunming mice were cultured in vitro using them, and the developmental ability and quality of the embryos were evaluated. The results showed that the pregnancy serum exosomes with the defined composition of the present invention could significantly improve the developmental ability and quality of 2-cell embryos cultured in vitro.

[0048] The present invention also specifically defines the RNA sequence of pregnancy serum exosomes. The reason is that MicroRNAs (miRNAs) are a class of genes that are evolutionarily conserved, their expression is tissue-specific and stage-specific, and they play an important role in regulating a variety of biological processes, including cell development, differentiation, cell growth, proliferation, apoptosis and metabolism. The pregnancy day 3.5 (E3.5) serum-derived exosomes (P-Exos) obtained in the present invention are rich in miR-486b-5p and specifically express miR-128-1-5p. The in vitro embryo culture environment cannot fully simulate the in vivo environment. Therefore, there is ROS-induced oxidative stress during in vitro culture, which can lead to retarded or even blocked in vitro embryo development. The cytoskeleton is the main factor maintaining the embryo and morphology, and is also the only structure connecting the cell surface and the nucleus, playing an important role in early embryo development and being an important indicator determining embryo quality. miR-486b-5p can reduce the production of reactive oxygen species (ROS), inhibit apoptosis, and improve the function of slow cell proliferation. miR-128-1-5p can mediate the stability of the cytoskeleton. Therefore, P-Exos rich in miR-486b-5p and specifically expressing miR-128-1-5p can improve the developmental ability and quality of embryos by inhibiting embryo oxidative stress during in vitro culture, reducing apoptosis and stabilizing the cytoskeleton.

[0049] In a preferred embodiment, the concentration of the pregnancy serum exosomes in the embryo culture solution is 0.5 - 1×10 8 particles / 45 μL KSOM. This technical solution specifically defines the concentration of pregnancy serum exosomes in the embryo culture solution. The reason is that, as Figure 26As shown in Table 1, the concentration of pregnancy serum exosomes is too low and the miRNA content it contains is too small to achieve the effect of promoting embryo development. On the one hand, when the concentration is too high, there is no better promotion effect on embryo development. At the same time, it may also lead to too high a concentration of contents that are not conducive to embryo development, causing an impact on embryo development.

[0050] Table 1 Effects of different concentrations of P-Exos on the development of mouse embryos cultured in vitro

[0051]

[0052] In a preferred embodiment, the embryo culture medium further includes the embryo medium KSOM.

[0053] In a preferred embodiment, the volume ratio of the pregnancy serum exosomes to the embryo medium KSOM in the embryo culture medium is 1:45. This technical solution specifically defines the volume ratio of pregnancy serum exosomes to the embryo medium KSOM in the embryo culture medium. The reason is that in this solution, the microdrop method is used to culture embryos in vitro. Each microdrop contains 45 μL of KSOM, and the number of embryos cultured is 30 - 35. The added concentration is 0.5 - 1×10 8 particles / μL of 1 μL of P-Exos. At this ratio, it is beneficial to the development of embryos.

[0054] On the other hand, the present invention provides the application of the heat-resistant embryo culture medium described in any of the above technical solutions in embryo culture, for the in vitro culture of 2-cell embryos. This technical solution specifically defines the addition time of the embryo culture medium as 2-cell embryos. The reason is that there is a 2-cell block in the in vitro culture process of mouse fertilized eggs. Defining the addition time of the embryo culture medium as 2-cell embryos is beneficial to eliminating the influence in this regard.

[0055] In a preferred embodiment, it includes: transferring the 2-cell embryos to the pre-equilibrated microdrops of the embryo culture medium and culturing them in a CO2 incubator; the number of 2-cell embryos in each microdrop of the embryo culture medium is 25 - 30 per drop; the culture conditions are: 37 °C, 5% CO2, 100% RH.

[0056] The above technical solution specifically defines the quantitative relationship between the microdrops of the embryo culture medium and the 2-cell embryos during in vitro culture. The reason is that in the microdrop culture method, the volume of KSOM in each microdrop is 46 μL. Defining the number of embryos is to provide the same nutrients except exosomes for each group during in vitro culture.

[0057] In a preferred embodiment, it further includes: aspirating the 2-cell embryos with a glass embryo suction needle into a clean M2 droplet, washing them and then transferring them to the pre-equilibrated embryo culture medium.

[0058] The present invention uses a commercial serum exosome extraction kit, which is simple and convenient to use, and can obtain exosomes with large yield and high purity, which is beneficial to reducing costs, improving efficiency and shortening time.

[0059] In order to introduce the heat-resistant embryo culture medium and its application provided by the embodiments of the present invention more clearly and in detail, the following will be described in conjunction with specific embodiments.

[0060] Examples

[0061] 1. Obtaining serum exosomes

[0062] By collecting blood from the eyeballs, the blood of non-pregnant, pregnant (E3.5) and heat-stressed pregnant mice was collected respectively, the serum was separated, and exosomes were extracted, separated and identified from the serum, so as to obtain serum exosomes in three different physiological states: non-pregnant (NP-Exos), pregnant (P-Exos) and heat-stressed pregnant (HS-P-Exos). The identification of exosomes is shown in the appendix Figures 1-3 as shown.

[0063] It can be Figures 1-3 found that the morphologies of the three exosomes are all round or oval, and the morphology conforms to the standard of exosomes; the particle size of NP-Exos is 97.8 nm, the particle size of P-Exos is 119.8 nm, and the particle size of HS-P-Exos is 121.1 nm. The particle sizes are all between 30 and 150 nm, which meets the size of exosome particle size; the results of WB identification of exosome marker proteins show that the positive markers HSC70, TSG101 and CD9 are all expressed in the three exosomes, and the negative marker Calnexin is not expressed, which meets the identification standard of WB.

[0064] 2. Superovulation of mice

[0065] Female mice at 6-7 weeks of age were intraperitoneally injected with PMSG hormone at 15:30-16:00 in the afternoon, and each mouse was injected with 10 IU. After 48 h, the same dose of hCG was injected, and at 18:00 on the same day, they were caged with sexually mature healthy male mice at a ratio of 1:1. This time was recorded as the starting point of embryo development (0 h). The mice with plugs were examined at 8:00 the next morning, and the mice with plugs were used for embryo collection.

[0066] 3. Preparation of serum exosome embryo culture medium

[0067] The exosomes were added to the embryo medium KSOM to obtain an embryo culture medium containing serum exosomes. The method for adding exosomes to the embryo culture medium was: 45 μL KSOM / microdrop + 1 μL exosome, and the concentration of exosomes was 1×10 8 / μL.

[0068] 4. Collection and culture of 2-cell embryos

[0069] Before embryo collection, make 4 microdrops (45 μL / drop) of KSOM culture medium in a 35-mm petri dish, then add 1 μL of diluted exosomes to each microdrop, and then cover the surface of the culture medium microdrops with 3 mL of embryo-grade mineral oil for embryo culture. Make 6 microdrops (80 μL / drop) of M2 culture medium in a 90-mm petri dish for washing embryos. The prepared petri dishes with microdrops are placed in a CO2 incubator (37 °C, 5% CO2, 100% RH) for pre-equilibration 4 h before embryo collection.

[0070] After 40 h of embryo development, the mice with vaginal plugs are sacrificed by cervical dislocation. The abdomen is disinfected with alcohol and then the abdominal cavity is opened. Locate the ovaries and oviducts, cut off both oviducts and place them in the pre-equilibrated M2 microdrops (one oviduct per microdrop). Subsequently, place the petri dish under a stereomicroscope, use a 1-mL syringe needle to cut the ampulla of the oviduct, and quickly flush out the 2-cell stage embryos from the oviduct. The flushed 2-cell embryos are aspirated into a clean M2 droplet with a glass embryo aspiration needle, washed 5 times, and then transferred to the pre-equilibrated KSOM culture medium microdrops, 25 - 30 embryos per drop, and cultured in a CO2 incubator (37 °C, 5% CO2, 100% RH).

[0071] 5. Result recording and analysis

[0072] Take pictures and record the morphology of in vitro cultured embryos in each group at the 2-cell, 4-cell, morula, and expanded blastocyst stages at 48 h, 64 h, 88 h, and 112 h after hCG injection respectively. Calculate the blastocyst rate at 112 h and perform statistical analysis using the chi-square test. Fix the blastocysts with paraformaldehyde fixative at 4 °C for more than 4 h, perform immunofluorescent staining with trophoblast cell marker CDX2 antibody or apoptosis marker Cleaved Caspase-3 (CC3) antibody, and then observe and take pictures under a laser confocal microscope. Count the number of trophoblast cells (see Figure 7 、 8 ) or apoptotic cells (see Figure 9 、 10 ), and perform statistical analysis using a one-way analysis method. Take 5 blastocysts from each group, extract total RNA respectively, reverse transcribe it into cDNA, and then detect the mRNA levels of lineage differentiation genes Cdx2, Oct4, and Nanog, and proliferation marker gene Pcna gene by qRT-PCR (see Figure 11 、 12, 13, 14), a single-factor method was used for statistical analysis. The blastocyst rate and the number of trophoblast cells in the group supplemented with pregnancy serum exosomes were significantly increased, while the number of apoptotic cells was significantly decreased. The results showed that supplementing pregnancy serum exosomes could significantly improve the developmental ability and quality of 2-cell embryos cultured in vitro.

[0073] Performance test

[0074] As shown in the figure Figures 1-3 It can be found that exosomes can be extracted from the sera of mice in three different physiological states.

[0075] Shown in Figures 4-6 It can be found that P-Exos increased the blastocyst rate and blastocyst diameter, indicating that it can promote the growth and development of mouse 2-Cell embryos cultured in vitro.

[0076] Shown in Figures 7-10 It can be found that P-Exos increased the number of blastocyst cells and decreased the number of apoptotic blastocyst cells, indicating that it can promote the quality of mouse 2-Cell embryos developed to blastocysts cultured in vitro.

[0077] Shown in Figures 11-14 It can be found that P-Exos increased the mRNA transcription levels of the blastocyst proliferation marker gene PCNA, the cell lineage differentiation genes Cdx2, Oct4, and Nanog, indicating that it can promote cell proliferation and differentiation during the development of mouse 2-Cell embryos cultured in vitro.

[0078] Shown in Figures 15-19 It can be found that the developmental rate, expanded blastocyst rate, expanded blastocyst diameter, and hatching rate of mouse 2-Cell embryos developed to morulae after heat stress treatment were higher than those of embryos cultured with the other two exosomes, indicating that it improved the ability of morulae to resist heat stress damage and increased their heat tolerance.

[0079] Shown in Figures 21-25 , the content of ROS in blastocysts of mouse 2-Cell embryos developed to morulae after heat stress treatment and at the blastocyst stage cultured with P-Exos was lower than that of embryos cultured with the other two exosomes, and the content of CAT in blastocysts was higher than that of embryos cultured with the other two exosomes, indicating that it improved the antioxidant ability of embryos, reduced the production of ROS, and had a protective effect on heat stress damage to embryos.

Claims

1. A heat-resistant embryo culture medium, characterized in that, Comprising pregnancy serum exosomes, the RNA sequences of the pregnancy serum exosomes include the sequence shown in SEQ ID No.1 and the sequence shown in SEQ ID No.

2.

2. The heat-resistant embryo culture medium according to claim 1, characterized in that, The concentration of the pregnancy serum exosomes in the embryo culture medium is 0.5 - 1×10 8 particles / 45 μL KSOM.

3. The heat-resistant embryo culture medium according to claim 1, characterized in that, The embryo culture medium further comprises embryo medium KSOM.

4. The heat-resistant embryo culture medium according to claim 3, characterized in that, In the embryo culture medium, the volume ratio of the pregnancy serum exosomes to the embryo medium KSOM is 1:

45.

5. Use of the heat-resistant embryo culture medium according to any one of claims 1-4 in embryo culture, characterized in that, For in vitro culture of 2-cell embryos.

6. Use of the heat-resistant embryo culture medium according to claim 5 in embryo culture, characterized in that, Comprising: Transfer the 2-cell embryos to the pre-equilibrated microdroplets of the embryo culture medium and place them in a CO2 incubator for culture.

7. Use of the heat-resistant embryo culture medium according to claim 6 in embryo culture, characterized in that, The number of 2-cell embryos in the microdroplets of the embryo culture medium is 25-30 embryos / drop.

8. Use of the heat-resistant embryo culture medium according to claim 6 in embryo culture, characterized in that, The culture conditions are: 37°C, 5% CO2, 100% RH.

9. Use of the heat-resistant embryo culture medium according to claim 6 in embryo culture, characterized in that, Further comprising: Aspirate the 2-cell embryos with a glass embryo aspiration needle into a clean M2 droplet, wash them and then transfer them to the pre-equilibrated embryo culture medium.

Images