Soybean root specific promoter Pgj4 and application thereof

By developing the soybean root-specific promoter Pgj4, the recombinant vector is cloned and constructed to achieve specific expression of soybean roots, solving the risks and effects of existing promoters in crop genetic improvement, and achieving precise regulation of root gene function and novel genetic operations for molecular breeding.

CN120330193AActive Publication Date: 2025-07-18JILIN ACAD OF AGRI SCI
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
CN202510566262.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-30
Publication Date
2025-07-18
Estimated Expiration
2045-04-30

AI Technical Summary

Technical Problem

The existing constitutive promoters have the risk of gene transfer and gene silencing effects in crop genetic improvement, making it difficult to achieve four-dimensional precise control of gene transcriptional activity. The existing endogenous constitutive promoters are prone to induce metabolic flow overload and reproductive developmental block.

Method used

The soybean root-specific promoter Pgj4 was developed, the promoter was cloned from the soybean genome by designing specific primers, and the recombinant vector was constructed with the fluorescent reporter DsRed, and the root tissue-specific expression was achieved in soybean using genetic transformation technology.

Benefits of technology

The specific expression of soybean roots has been achieved, the current lack of existing promoters in soybeans has been overcome, and a new genetic operating element is provided for targeted regulation of root gene function analysis and precise molecular breeding, avoiding gene-level transfer and gene silencing effects.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120330193A_ABST
    Figure CN120330193A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of plant genetic engineering. The invention provides a root specific promoter Pgj4 of soybean. The nucleotide sequence of the root specific promoter Pgj4 is as shown in SEQ ID NO. 1. The invention also provides a primer group for the root specific promoter Pgj4, and a recombinant vector and a recombinant bacterium containing the root specific promoter Pgj4. The root specific promoter Pgj4 disclosed by the invention is obviously and specifically expressed in a transgenic soybean plant root tissue. The invention provides a precise molecular tool for root development mechanism analysis, rhizosphere interaction research and stress resistance gene engineering, and has important application value.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of plant genetic engineering, and particularly relates to a root-specific promoter Pgj4 of soybean and its application. Background Art

[0002] As the core hub of plant material-energy exchange and the primary responder to stress signal perception, the innovative development of tissue-specific regulatory elements in roots has become a frontier hotspot in precise design breeding of crops. Based on the engineering element system for root-targeted expression, researchers can target and optimize crop root architecture, enhance nutrient capture efficiency, improve abiotic stress resistance, and simultaneously construct a defense barrier against root pests and diseases, providing an important technical path to break through the bottleneck of traditional breeding. Research in this field will promote the deep integration of root biology theory and the needs of modern agriculture, and lay a molecular regulation foundation for cultivating environment-intelligent crops.

[0003] The promoter upstream of a gene, as the "intelligent switch" of the plant genetic regulatory network, realizes the four-dimensional precise control of gene transcriptional activity (time, space, intensity, environmental interaction) by integrating the spatio-temporal dynamic regulatory network and the environmental response mechanism. In the crop genetic improvement project, the creation of breakthrough promoter elements has been listed as the strategic high point of modern agricultural biotechnology. Although the currently mainstream constitutive strong promoter systems (such as CaMV 35S and maize Ubi) show universal advantages in basic research, their technical limitations are becoming increasingly prominent with the upgrading of the demand for precise breeding: firstly, heterologous virus-derived promoters have the risk of gene horizontal transfer, and the possibility of their cross-border recombination has been proven to induce niche imbalance; secondly, although endogenous constitutive promoters avoid biosafety problems, their global activation mode is prone to gene silencing effects, and the metabolic flux overload caused by continuous overexpression can lead to the attenuation of plant photosynthetic efficiency and reproductive development arrest.

[0004] Based on this, constructing a trinity intelligent promoter system of "environment perception-signal transduction-targeted activation", especially exploring new regulatory elements with characteristics of root-specific response, vascular bundle dynamic regulation or stress pulse activation, has become the core research direction for realizing modular design of crop traits and constructing a biosafety barrier. Summary of the Invention

[0005] The purpose of the present invention is to provide a root-specific promoter Pgj4 of soybean.

[0006] In order to achieve the above-mentioned invention purpose, the present invention provides the following technical solutions:

[0007] The present invention provides a root-specific promoter Pgj4 of soybean, and the nucleotide sequence of the root-specific promoter Pgj4 is shown in SEQ ID NO.1.

[0008] The present invention provides a primer set for cloning the above-mentioned root-specific promoter Pgj4, which includes Pgj4-F1 and Pgj4-R1. The sequence of Pgj4-F1 is shown as SEQ ID NO.2, and the sequence of Pgj4-R1 is shown as SEQ ID NO.3.

[0009] The present invention provides a kit containing the above-mentioned primer set.

[0010] The present invention provides a construction method for the root-specific promoter Pgj4, including the following steps: using the promoter sequence of the soybean Glyma.15G218900.1 gene as a template, and performing PCR amplification with the above-mentioned primer set to obtain a sequence fragment of the root-specific promoter Pgj4.

[0011] The present invention provides a recombinant vector containing the above-mentioned root-specific promoter Pgj4.

[0012] The present invention provides a construction method for the recombinant vector, including the following steps: ligating the digested pCAMBIA3300 vector with the above-mentioned root-specific promoter Pgj4 to obtain the recombinant vector.

[0013] The present invention provides a recombinant bacterium containing the above-mentioned recombinant vector.

[0014] The present invention provides the application of the root-specific promoter Pgj4, or the kit, or the recombinant vector, or the recombinant bacterium in the specific expression of plant root tissues.

[0015] The present invention also provides a construction method for a transgenic soybean plant, including the following steps:

[0016] (1) Infecting a target soybean plant with the above-mentioned recombinant bacterium, and then inducing adventitious buds;

[0017] (2) Inoculating the adventitious buds into a bud elongation medium and culturing until the bud length reaches 3-5 cm, and then inoculating them into a rooting medium and continuing the culture to obtain a transgenic soybean plant with specific expression in root tissues.

[0018] Preferably, step (1) is carried out in an induction medium. The induction medium uses water as a solvent and consists of components with the following mass concentrations: B5 salts 3.1-3.4 g / L, sucrose 28-32 g / L, MES 0.4-0.65 g / L, BAP 1.5-1.8 mg / L, cefamycin 240-260 mg / L, Timentin 90-110 mg / L, glufosinate 5-6 mg / L, and agar powder 6-10 g / L.

[0019] Preferably, the shoot elongation medium uses water as a solvent and consists of components with the following mass concentrations: MS salts 4.2 - 4.6 g / L, sucrose 28 - 32 g / L, MES 0.4 - 0.65 g / L, asparagine 48 - 52 mg / L, L-glutamic acid 48 - 52 mg / L, IAA 0.08 - 0.12 mg / L, GA3 0.4 - 0.6 mg / L, zeatin riboside 0.9 - 1.1 mg / L, cefamycin 240 - 260 mg / L, Timentin 90 - 110 mg / L, glufosinate 5 - 6 mg / L, and agar powder 6 - 10 g / L.

[0020] Preferably, the rooting medium uses water as a solvent and consists of components with the following mass concentrations: MS salts 4.2 - 4.6 g / L, sucrose 18 - 22 g / L, MES 0.4 - 0.65 g / L, asparagine 48 - 52 mg / L, L-glutamic acid 48 - 52 mg / L, IBA 0.8 - 1.2 mg / L, and phytagel 2 - 4 g / L.

[0021] By adopting the above technical solutions, the present invention has the following beneficial effects:

[0022] In the present invention, the root-specifically expressed gene Glyma.15G218900.1 was screened based on the soybean transcriptome database, specific primers were designed through genomic sequence analysis, and the root-specific promoter Pgj4 fragment of this gene was successfully cloned from the genomic DNA of soybean variety Williams 82. The obtained Pgj4 promoter sequence was constructed into a fusion expression vector pCAMBIA3300 - Pgj4 - DsRed with the red fluorescent protein reporter gene DsRed, and transgenic soybean plants were obtained by genetic transformation technology and introduced into the target plant soybean.

[0023] Experiments showed that the Glyma.15G218900.1 gene had the highest expression abundance in soybean roots, and the DsRed fluorescence signal was specifically confined to the roots of transgenic soybean plants. Compared with the prior art, the identified Pgj4 promoter in the present invention has significant root tissue specificity advantages, overcomes the current shortage of endogenous specific promoters in soybeans, and provides a new genetic manipulation element for targeted regulation of root gene function analysis and precision molecular breeding. Description of the Drawings

[0024] Figure 1 It is a diagram of the RT-qPCR detection results of the Glyma.15G218900.1 gene in different tissue parts;

[0025] Figure 2 It is a diagram of the PCR gel electrophoresis results for cloning the promoter Pgj4;

[0026] Figure 3 Prediction result diagram of cis - acting elements of root - specific promoter Pgj4

[0027] Figure 4 Composition diagram of pCAMBIA3300 - Pgj4 - DsRed recombinant vector

[0028] Figure 5 Red fluorescence result diagram of different parts of pCAMBIA3300 - Pgj4 - DsRed transgenic soybean plants Specific implementation mode

[0029] The present invention provides a root - specific promoter Pgj4 of soybean. The nucleotide sequence of the root - specific promoter Pgj4 is shown as SEQ ID NO.1, and the specific sequence is

[0030] TCGGTACTACCTTTAACTCCAGAATACTTTTTTATTCTAATTTATTATTGT

[0031] TTTAACTTTTTAGATTTCATTATTTATCTTTTTTAATGGATTAAATTTATTT

[0032] TTTATCCCAGTAATTTTATGAATATGCAAATTTTGGTCCCTACAATTAATT

[0033] TAATGGCATATTTTGGTTCCCAAGTTTTCCAAAATTAAGAAATGATAGTC

[0034] TCCCATTAATATGTCTTCCAATTGTTAATAGAAAACGTTGATATGTCCGT

[0035] AAGTGATAACACATGCTAGTTACTATCCATGCATGGGAGATATACTATGG

[0036] TTGGGAAAGAGTGAAGAAGGACGAGAAGGAAGAGAGATATAGTATGT

[0037] TGGAATCCCTCAAGATATTTTAATAAAATTAATAAATTAATATTTGTTGAT

[0038] TAAAAAAATCAATTCATGCTAGTGTTTAAATCCCAATACACGTGGATTA

[0039] ACTTTATTCTATATTTTTTTCACGGTTAATATGGAAACATTATATTTTCAG

[0040] GGTTTTAAAACTTTGATTTGGCCGGGAGTAGTAGGGGCCTAGGGGGTA

[0041] AGGTAACTCGTTCGAGAATTGCTTTGCAGTGCGTTCTTCCCTGAAGTTA

[0042] CGAAGAACAAGAGATAACGTGCTAGTTCCAATGATTAATGGTGGTAAT

[0043] GGGTAACGTGTTTTGCTCCACTAATTTACTAAGGATTAACTTTGAATCCT

[0044] TGTCGGTTATACCTAGCAATAGAAATTTCCTCAGTATTTATGCACAAGCG

[0045] AGCTTTGCTGAGATAATACATGAATTAAAAATCTCCAAGCCACCTTTGC

[0046] TAAATCGCATAAGCTAAGCCAACGAACGGAATTAGTCCATGTACAAATC

[0047] AACAATCACAATTTAACTTTACTAAACATCGCTTACAATTCTTTTATATAT

[0048] TTCAATTTTTTTAAAGCTACTATCACATTTGAATTTTTATTTTAAATATTTT

[0049] ATACTACGTGGATAAATAACTGACACCTATTTTCACTAACGGACATGTC

[0050] AGTGTTTTCCATTAACAATTGGATGGCATATTAACAATGGACAAAAATG

[0051] ATTAATTTTAGAAAACTAAAGGACTAAAGTGTGATTCAATTTTCATAAG

[0052] GATCAAAATTATATAATTACTAAATGAAAAGGGAATTGACGCTTATTATT

[0053] TTTTATAAGAATACAATTGAAAAAAAATTATCAAGAAGTTTTACAATAAT

[0054] AGATAAGCATAGAAATAACATTTTTCTATAAAAGTAACAAAACAAAAG

[0055] AAACGCAGATAATATTAAAATTTCAAATTAAGTAATAAAATTTATTAATT

[0056] AAATTGTAAAACTTATTACTAAAAAAACTCATACTAAAAATATAAAAAC

[0057] TACAAATTTAGTAACAACAAACTTTTATTTTTTGGCCTGGAATATATGTC

[0058] TATTACTAAATTTGGAATATTTAAAATAAAATGATTGGGTACTTTTTTTTC

[0059] CTTGTAGGGTATTGAATATGGACCCCACACTTTAATTATTTAGTTGTTAG

[0060] GAGTGGGTAAATTATGGTCTTTTTAAGTCACATTTGTTCGCAATATTCAT

[0061] CCCCATCTCCCATCTTTGTTTGTTCCATCTCTTGCTTCTTGCTTCTATTACTTGCTTCTTTCTTCACC。

[0062] The present invention also provides a primer set for cloning the above root-specific promoter Pgj4. The primer set includes Pgj4-F1 and Pgj4-R1. The sequence of Pgj4-F1 is as shown in SEQ ID NO.2, and the specific sequence is 5’-TCGGTACTACCTTTAACTCCAG-3’; the sequence of Pgj4-R1 is as shown in SEQ ID NO.3, and the specific sequence is 5’-GGTGAAGAAAGAAGCAAGTA-3’.

[0063] The present invention also provides a kit containing the above primer set.

[0064] The present invention also provides a construction method of the root-specific promoter Pgj4, comprising the following steps: using the promoter sequence of the soybean Glyma.15G218900.1 gene as a template, and performing PCR amplification with the above primer set to obtain a sequence fragment of the root-specific promoter Pgj4.

[0065] In the present invention, the sequence of the soybean Glyma.15G218900.1 gene is as shown in SEQ ID NO.6, and the specific sequence is ATGTCACTTGCTGGGAAAATCACCACTGAAATTGGGGTTCATGCAACCGCTGCAAAGTGGTTCAACCTCTTTGCAACACAACTTCATCATGTTCAAAACCTTACTGATAGAGTACATGGAACCAAGCTGCATCAAGGTGAAGACTGGCATCACAACGAGACAGTCAAACACTGGACTTATACCATAGATGGTAAGGCTACAACATGTCTGGAGAGTATTGAATCCATTGATGAACAGAACAAAACAATCACCTACAAGCTCTTCAGTGGAGACATTGATCATAAGTATAAGAAATTTAAGTTCACCTTTCAAGCCATTGATAAGGATCAAGGCGGTGCTTTTATTAAATGGACGGTTGAATATGAAAGGCTTGCTGAGGAGGTTGATCCTCCATATGGATACATCGAATACCTGCACAAATGCACTAAAGATATTGATGTTCATCTTCTCAAAGCATAG.

[0066] In the present invention, the system for the PCR amplification includes 25 μL of high-fidelity enzyme mix, 2 μL of template, 1 μL of primer Pgj4-F1, 1 μL of primer Pgj4-R1, and ddH2O is added to make up to 50 μL.

[0067] In the present invention, the procedure for the PCR amplification is 95°C for 3 min; (95°C for 30 sec; 60°C for 30 sec; 72°C for 2 min;) 30 cycles; 72°C for 10 min.

[0068] The present invention provides a recombinant vector containing the above root-specific promoter Pgj4.

[0069] The present invention provides a method for constructing the recombinant vector, which comprises the following steps: ligating the digested pCAMBIA3300 vector with the above-mentioned root-specific promoter Pgj4, and thus obtaining the recombinant vector.

[0070] The present invention provides a recombinant bacterium containing the above-mentioned recombinant vector.

[0071] The present invention provides the application of the root-specific promoter Pgj4, or the kit, or the recombinant vector, or the recombinant bacterium in the specific expression of plant root tissues.

[0072] The present invention also provides a method for constructing a transgenic soybean plant, which comprises the following steps:

[0073] (1) Infecting the target soybean plant with the recombinant bacterium, and then inducing adventitious buds;

[0074] (2) Inoculating the adventitious buds onto a bud elongation medium and culturing until the buds grow to 3-5 cm in length, and then inoculating them onto a rooting medium and continuing the culture, thereby obtaining a transgenic soybean plant with specific expression in root tissues.

[0075] In the present invention, step (1) is carried out in an induction medium, which uses water as a solvent and preferably consists of components with the following mass concentrations: B5 salts 3.1-3.4 g / L, sucrose 28-32 g / L, MES 0.4-0.65 g / L, BAP 1.5-1.8 mg / L, cefotaxime 240-260 mg / L, Timentin 90-110 mg / L, glufosinate 5-6 mg / L, and agar powder 6-10 g / L; more preferably, it is B5 salts 3.21 g / L, sucrose 30 g / L, MES 0.59 g / L, BAP 1.67 mg / L, cefotaxime 250 mg / L, Timentin 100 mg / L, glufosinate 5-6 mg / L, and agar powder 8 g / L.

[0076] In the present invention, the bud elongation medium uses water as a solvent and is preferably composed of components with the following mass concentrations: MS salts 4.2 - 4.6 g / L, sucrose 28 - 32 g / L, MES 0.4 - 0.65 g / L, aspartic acid 48 - 52 mg / L, L - glutamic acid 48 - 52 mg / L, IAA 0.08 - 0.12 mg / L, GA3 0.4 - 0.6 mg / L, zeatin riboside 0.9 - 1.1 mg / L, cefamycin 240 - 260 mg / L, Timentin 90 - 110 mg / L, glufosinate 5 - 6 mg / L, and agar powder 6 - 10 g / L; more preferably, it is MS salts 4.43 g / L, sucrose 30 g / L, MES 0.59 g / L, aspartic acid 50 mg / L, L - glutamic acid 50 mg / L, IAA 0.1 mg / L, GA3 0.5 mg / L, zeatin riboside 1.0 mg / L, cefamycin 250 mg / L, Timentin 100 mg / L, glufosinate 5 - 6 mg / L, and agar powder 8 g / L.

[0077] In the present invention, the rooting medium uses water as a solvent and is preferably composed of components with the following mass concentrations: MS salts 4.2 - 4.6 g / L, sucrose 18 - 22 g / L, MES 0.4 - 0.65 g / L, aspartic acid 48 - 52 mg / L, L - glutamic acid 48 - 52 mg / L, IBA 0.8 - 1.2 mg / L, and phytagel 2 - 4 g / L; more preferably, it is MS salts 4.43 g / L, sucrose 20 g / L, MES 0.59 g / L, aspartic acid 50 mg / L, L - glutamic acid 50 mg / L, IBA 1.0 mg / L, and phytagel 3 g / L.

[0078] The technical solutions provided by the present invention will be described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0079] The soybean variety Williams 82 described in the present invention can be obtained from the National Crop Germplasm Resources Platform (website: http: / / www.cgris.net / home).

[0080] Example 1 Transcription levels of the Glyma.15G218900.1 gene in different tissues

[0081] Total RNA was separately extracted from root, leaf, stem, pod, seed and other tissue samples of soybean plants at the mature stage, reverse transcribed into cDNA, and specific primers Glyma.15G218900.1-F1 and Glyma.15G218900.1-R1 were designed. Then, real-time quantitative PCR was performed using the specific primers to verify the expression levels of Glyma.15G218900.1 in different tissues and organs of soybean. The detection instrument was ABI PRISM 7500Fast Real-Time PCR System (Applied Biosystems, CA, USA), and the internal reference gene was GmACT6 (GenBank No. NM_001289231). The relative expression levels of the genes were detected by the 2 –ΔΔCT (Livak) method.

[0082] The sequence of the soybean Glyma.15G218900.1 gene of the present invention is shown in SEQ ID NO.6. The sequence of Glyma.15G218900.1-F1 is shown in SEQ ID NO.4, and the specific sequence is 5’-AGACTGGCATCACAACGAGAC-3’; the sequence of Glyma.15G218900.1-R1 is shown in SEQ ID NO.5, and the specific sequence is 5’-GCACCGCCTTGATCCTTATCA-3’.

[0083] The RT-qPCR procedure was as follows: 94°C, 10 min; (94°C, 45 s; 60°C, 45 s; 72°C, 30 s) for 35 cycles; 72°C, 10 min.

[0084] The RT-qPCR system consisted of 10 μL of SYBR Green PCR MasterMix, 2 μL of cDNA template, 0.2 μL of primer Glyma.15G218900.1-F1, 0.2 μL of primer Glyma.15G218900.1-R1, and ddH2O was added to make up to 20 μL.

[0085] The results showed that the expression level of the Glyma.15G218900.1 gene was the highest in roots, and almost no expression was detected in other tissues such as leaves and stems (as Figure 1 ), which was consistent with the transcriptome data, confirming the root-specific expression characteristics of the Glyma.15G218900.1 gene.

[0086] Example 2 Cloning of the promoter Pgj4 of the Glyma.15G218900.1 gene

[0087] Specific primers were designed according to the promoter sequence of Glyma.15G218900.1 genome of soybean, and then PCR amplification was carried out. The amplified products were electrophoretically separated on 1% agarose gel (the electrophoresis results are as Figure 2 shown). The agarose gel containing the target fragment was cut and collected into a centrifuge tube, recovered using the Omega Gel Extraction Kit, and cloned onto the pEASY-Blunt vector (purchased from TransGen Biotech Co., Ltd., Beijing), transformed into competent cells DH5α, and positive clones were obtained through antibiotic screening. After verification by colony PCR, the inserted DNA fragment was confirmed to be 1611 bp by sequencing. After the sequence comparison was correct, the inventor named this sequence fragment the root-specific promoter Pgj4.

[0088] The primer set designed in the present invention includes Pgj4-F1 and Pgj4-R1. The sequence of Pgj4-F1 is shown in SEQ ID NO.2, and the specific sequence is 5’-TCGGTACTACCTTTAACTCCAG-3’; the sequence of Pgj4-R1 is shown in SEQ ID NO.3, and the specific sequence is 5’-GGTGAAGAAAGAAGCAAGTA-3’.

[0089] The PCR amplification system of the present invention is as follows: 25 μL of high-fidelity enzyme mix, 2 μL of template, 1 μL of primer Pgj4-F1, 1 μL of primer Pgj4-R1, and ddH2O was added to make up to 50 μL. The PCR amplification procedure of the present invention is as follows: 95°C, 3 min; (95°C, 30 sec; 60°C, 30 sec; 72°C, 2 min;) 30 cycles; 72°C, 10 min.

[0090] The system of colony PCR amplification of the present invention includes 10 μL of 2X PCR MasterMix, 1 μL of template, 1 μL of forward primer, 1 μL of reverse primer, and ddH2O was added to make up to 20 μL. The procedure of colony PCR amplification is 95°C, 3 min; (95°C, 30 sec; 60°C, 30 sec; 72°C, 2 min;) 30 cycles; 72°C, 10 min. The forward primer used is the same as the sequence of Pgj4-F1, and the reverse primer is the same as the sequence of Pgj4-R1.

[0091] Example 3 Analysis of cis-acting elements of promoter Pgj4

[0092] The PlantPAN 4.0 online software was used to analyze the cis-acting elements of the promoter Pgj4 sequence obtained in Example 2.

[0093] The results showed that the Pgj4 promoter sequence contains cis - acting elements such as AuxRR - core, CAAT - box, ABRE, TC - rich repeats, ARE, and WUN - motif (as Figure 3 shown).

[0094] The sequence of the AuxRR - core is as shown in SEQ ID NO.7, and the specific sequence is GGTCCAT; the sequence of the CAAT - box is as shown in SEQ ID NO.8, and the specific sequence is CCAAT; the sequence of the ABRE is as shown in SEQ ID NO.9, and the specific sequence is ACGTGGC; the sequence of the TC - rich repeats is as shown in SEQ ID NO.10, and the specific sequence is ATTTCTCTTCT; the sequence of the ARE is as shown in SEQ ID NO.11, and the specific sequence is GGTTT; the sequence of the WUN - motif is as shown in SEQ ID NO.12, and the specific sequence is AAATTTCCT.

[0095] Example 4 Obtaining of transgenic soybeans containing the pCAMBIA3300 - Pgj4 - DsRed recombinant vector

[0096] After double - digesting the pCAMBIA3300 vector (purchased from Beijing Quanshijin Biotechnology Co., Ltd.) with EcoRⅠ and HindⅢ, it was ligated with the red fluorescent protein reporter gene DsRed, and pCAMBIA3300 - DsRed was obtained through optimization.

[0097] The Pgj4 fragment of the Glyma.15G218900.1 promoter cloned on the pEASY - Blunt vector was seamlessly ligated and inserted into the pCAMBIA3300 - DsRed expression vector to obtain the pCAMBIA3300 - Pgj4 - DsRed recombinant vector (as Figure 4 shown).

[0098] Agrobacterium - mediated transformation was used. The pCAMBIA3300 - Pgj4 - DsRed recombinant vector was introduced into Agrobacterium tumefaciens EHA105 (purchased from Beijing Quanshijin Biotechnology Co., Ltd.) to obtain recombinant Agrobacterium. The specific transformation process is as follows:

[0099] (1) Pick a single colony of Agrobacterium tumefaciens EHA105 and inoculate it into 5 mL of YEP liquid medium (50 - 100 mg / L spectinomycin, 25 mg / L rifampicin), and culture it overnight at 28°C. The next day, expand the culture in 50 mL of YEP medium until OD 600nmwas 0.6 - 0.8. The cells were centrifuged at 3000 rpm for 10 min and then resuspended in a liquid co-culture medium (components: 0.321 g / L of B5 salts, 30 g / L of sucrose, 3.9 g / L of MES, 1.67 mg / L of BAP, 0.25 mg / L of GA3, 400 mg / L of cysteine, 154.2 mg / L of DTT, and 200 μmol / L of AS, pH 5.4), and the OD 600nm was adjusted to 0.5 for standby.

[0100] (2) Agrobacterium infection

[0101] Use a scalpel to cut open the Jiyu 86 soybean seeds along the hilum part, remove the skin, make a slight scratch at the cotyledon node position, and then place the prepared explants in the resuspended Agrobacterium for infection for 30 min. Transfer the infected explants to a co-culture medium (components: 0.321 g / L of B5 salts, 30 g / L of sucrose, 3.9 g / L of MES, 1.67 mg / L of BAP, 0.25 mg / L of GA3, 400 mg / L of cysteine, 154.2 mg / L of DTT, 200 μmol / L of AS, and 5 g / L of agar powder, pH 5.4), and incubate in the dark at 23 °C for 4 d.

[0102] (3) Adventitious bud induction

[0103] After the explants were co-cultured for 4 d, transfer the explants to an induction medium (components: 3.21 g / L of B5 salts, 30 g / L of sucrose, 0.59 g / L of MES, 1.67 mg / L of BAP, 250 mg / L of cefotaxime, 100 mg / L of Timentin, 5 - 6 mg / L of glufosinate, and 8 g / L of agar powder, pH 5.7). The adaxial surface of the cotyledon node and hypocotyl parts of the explants should be inserted into the medium upwards and at a 45° angle to the horizontal plane, and cultured under a 16 / 8 h light / dark cycle at 25 °C for about 2 weeks. Take out the explants, cut off the excess hypocotyl part, leaving only 5 mm, and then transfer the explants to fresh induction medium for continued culture for 2 weeks under the same conditions.

[0104] (4) Bud elongation

[0105] Transfer the induced clustered buds (removing the cotyledon part of the tissue) to a bud elongation medium (components: 4.43 g / L of MS salts, 30 g / L of sucrose, 0.59 g / L of MES, 50 mg / L of asparagine, 50 mg / L of L-glutamic acid, 0.1 mg / L of IAA, 0.5 mg / L of GA3, 1.0 mg / L of zeatin riboside, 250 mg / L of cefotaxime, 100 mg / L of Timentin, 5 - 6 mg / L of glufosinate, and 8 g / L of agar powder, pH 5.7) for culture. The culture conditions are 25 °C and a 16 / 8 h light / dark cycle. Subculture once every 2 weeks,

[0106] (5) Rooting

[0107] When the resistant buds grow to 3 - 5 cm, cut them off, soak them in IBA (1 mg / L) for 30 s, and then transfer them to the rooting medium (the components are MS salts 4.43 g / L, sucrose 20 g / L, MES 0.59 g / L, asparagine 50 mg / L, L - glutamic acid 50 mg / L, IBA 1.0 mg / L, and plant gel 3 g / L, pH 5.6) for continuous culture. When strong roots grow, transplant them to the greenhouse to grow and set seeds.

[0108] Using the specific primers of promoter Pgj4, perform PCR detection on the T1 generation transgenic soybeans. Combining with herbicide screening, after obtaining the transgenic soybeans containing pCAMBIA3300 - Pgj4 - DsRed, observe the red fluorescence.

[0109] Example 5

[0110] Adopt the LUYOR - 3415RG dual - wavelength fluorescence imaging system to perform tissue - specific expression analysis on the T1 generation transgenic soybeans of pCAMBIA3300 - Pgj4 - DsRed, and observe the red fluorescence in different parts of the pCAMBIA3300 - Pgj4 - DsRed transgenic soybean plants.

[0111] The results show that there is only red fluorescence in the roots of the transgenic soybean plants (as Figure 5 shown), indicating that the promoter Pgj4 is specifically expressed in the root tissue.

[0112] In summary, it can be seen that the technical solution of the present invention successfully cloned the root - specific promoter Pgj4 fragment from the genomic DNA of soybean variety Williams 82, and further obtained the transgenic soybean plants containing the expression vector pCAMBIA3300 - Pgj4 - DsRed. In the present invention, it is verified that the Glyma.15G218900.1 gene has the highest expression abundance in the roots of soybeans, and the DsRed fluorescence signal is specifically limited to the roots of the transgenic soybean plants, that is, the Pgj4 promoter has significant root - tissue - specific advantages.

[0113] The above - mentioned are only the preferred embodiments of the present invention. It should be pointed out that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and refinements can still be made, and these improvements and refinements should also be regarded as the protection scope of the present invention.

Claims

1. A root-specific promoter Pgj4 of soybean, characterized in that, The nucleotide sequence of the root-specific promoter Pgj4 is shown in SEQ ID NO.

1.

2. A primer set for cloning the root-specific promoter Pgj4 described in claim 1, characterized in that, The primer set includes Pgj4-F1 and Pgj4-R1. The sequence of Pgj4-F1 is shown in SEQ ID NO.2, and the sequence of Pgj4-R1 is shown in SEQ ID NO.

3.

3. A kit containing the primer set according to claim 2.

4. A method for constructing the root-specific promoter Pgj4 according to claim 1, characterized in that, It includes the following steps: Using the promoter sequence of soybean Glyma.15G218900.1 gene as a template, performing PCR amplification with the primer set according to claim 2 to obtain a sequence fragment of the root-specific promoter Pgj4.

5. A recombinant vector containing the root-specific promoter Pgj4 according to claim 1.

6. The construction method of the recombinant vector according to claim 5, characterized in that, It includes the following steps: Connecting the digested pCAMBIA3300 vector with the root-specific promoter Pgj4 according to claim 1 to obtain it.

7. A recombinant bacterium containing the recombinant vector according to claim 5.

8. The application of the root-specific promoter Pgj4 according to claim 1, or the kit according to claim 3, or the recombinant vector according to claim 5, or the recombinant bacterium according to claim 7 in plant root tissue-specific expression.

9. A method for constructing a transgenic soybean plant, characterized in that, It includes the following steps: (1) Infecting the target soybean plants with the recombinant bacterium according to claim 7, and then inducing adventitious buds; (2) Inoculating the adventitious buds into a bud elongation medium and culturing until the bud length reaches 3 - 5 cm, and then inoculating them into a rooting medium and continuing to culture to obtain transgenic soybean plants with root tissue-specific expression.

10. The construction method according to claim 9, characterized in that, Step (1) is carried out in an induction medium. The induction medium uses water as a solvent and consists of components with the following mass concentrations: B5 salts 3.1 - 3.4 g / L, sucrose 28 - 32 g / L, MES 0.4 - 0.65 g / L, BAP 1.5 - 1.8 mg / L, cefotaxime 240 - 260 mg / L, Timentin 90 - 110 mg / L, glufosinate 5 - 6 mg / L, and agar powder 6 - 10 g / L; The bud elongation medium uses water as a solvent and consists of components with the following mass concentrations: MS salts 4.2 - 4.6 g / L, sucrose 28 - 32 g / L, MES 0.4 - 0.65 g / L, asparagine 48 - 52 mg / L, L-glutamic acid 48 - 52 mg / L, IAA 0.08 - 0.12 mg / L, GA3 0.4 - 0.6 mg / L, zeatin riboside 0.9 - 1.1 mg / L, cefotaxime 240 - 260 mg / L, Timentin 90 - 110 mg / L, glufosinate 5 - 6 mg / L, and agar powder 6 - 10 g / L; The rooting medium uses water as a solvent and consists of components with the following mass concentrations: MS salts 4.2 - 4.6 g / L, sucrose 18 - 22 g / L, MES 0.4 - 0.65 g / L, asparagine 48 - 52 mg / L, L-glutamic acid 48 - 52 mg / L, IBA 0.8 - 1.2 mg / L, and phytagel 2 - 4 g / L.

Citation Information

Patent Citations

  • Specific promoter Glyma12g02240 of soybean root tissue and application of specific promoter Glyma12g02240

    CN112813068A

  • Soybean-derived root specific promoter pro-GmPRlike and application thereof

    CN114507666A

  • Application of soybean GmMLP34 gene in regulation and control of high temperature resistance of plants

    CN116536349A

  • Soybean genetic transformation method

    CN118147157A