Gene CsDOG1 for controlling preharvest germination traits of cucumber seeds as well as InDel marker and application of gene CsDOG1

Abstract

The invention provides a gene CsDOG1 for controlling preharvest germination traits of cucumber seeds as well as an InDel marker and application of the gene CsDOG1, an InDel site is located on a second exon of the CsDOG1 gene on a No.4 chromosome of a cucumber reference genome Chin ese Long v3Genome, insertion / deletion of 3bp exists, and the deleted 3bp nucleotide sequence is CAA. By applying the InDel marker disclosed by the invention, genotype information can be quickly and accurately identified in a high-throughput manner, and the pre-harvest germination-resistant breeding process of the cucumbers is accelerated.

Description

Technical Field

[0001] The present invention belongs to the technical field of cucumber molecular genetics, and in particular relates to a gene CsDOG1 controlling the pre-harvest germination trait of cucumber seeds, its InDel marker and application. Background Art

[0002] Cucumber (Cucumis sativus L.) is crisp, refreshing and nutritious, and is one of the fruit and vegetable crops deeply loved by consumers. China is the country with the largest cucumber cultivation area and the highest total output in the world. "Agriculture starts with seeds", and high-quality cucumber seeds are an important guarantee for the development of China's cucumber industry. However, during the cucumber breeding and seed production process, pre-harvest germination occurs in some cucumber varieties. This trait seriously harms the quality of cucumber seeds, causing the nutrients stored in the seeds to be hydrolyzed and consumed; after harvesting, the seeds lose their germination ability, and the germination rate is significantly reduced, seriously reducing the seed use value and restricting the effective utilization of cucumber germplasm resources and the promotion of new varieties.

[0003] The pre-harvest germination trait of cucumber seeds is determined by genetic genes and is easily affected by environmental temperature. Generally, cucumber seeds prone to pre-harvest germination begin to germinate 35 days after pollination, and the pre-harvest germination rate increases with the increase of fruit age. Pre-harvest germination is closely related to seed dormancy. The stronger the dormancy of cucumber varieties, the stronger the resistance to pre-harvest germination; on the contrary, cucumber varieties with insufficient seed dormancy are extremely prone to pre-harvest germination. At present, there are few research reports on the functional genes related to pre-harvest germination of cucumber seeds. Discovering and cloning functional genes related to pre-harvest germination of cucumber seeds and developing molecular markers can provide gene resources and molecular tools for cucumber breeding against pre-harvest germination, and can effectively accelerate the process of cucumber breeding against pre-harvest germination. Summary of the Invention

[0004] In view of this, the present invention aims to overcome the defects in the prior art and proposes a gene CsDOG1 controlling the pre-harvest germination trait of cucumber seeds, its InDel marker and application.

[0005] To achieve the above object, the technical solution of the present invention is realized as follows:

[0006] In a first aspect, the present invention provides a gene CsDOG1 controlling the pre-harvest germination trait of cucumber seeds, and the nucleotide sequence of the gene CsDOG1 is as shown in SEQ ID NO.1 or SEQ ID NO.2.

[0007] The present invention provides a gene CsDOG1 for controlling pre-harvest germination of cucumber seeds. The CsDOG1 gene plays a role in the resistance of cucumber seeds to pre-harvest germination. Mutation or loss of function of the gene will cause pre-harvest germination of cucumber seeds. The nucleotide sequence of the mutated gene is shown in SEQ ID NO.2. The nucleotide sequence of the CsDOG1 gene of cucumber seeds without mutation is shown in SEQ ID NO.1.

[0008] The CsDOG1 gene of the present invention is located on chromosome 4 of cucumber, and the gene number is CsaV3_4G032930 (Chinese Long v3 Genome). There are 2 exons and 1 intron in the gene structure. The full length of the gene CDS is 699bp, and it is named CsDOG1.

[0009] In a second aspect, the present invention also provides an InDel marker for identifying the CsDOG1 gene of cucumber resistant to pre-harvest germination. The InDel locus is located on the second exon of the CsDOG1 gene on chromosome 4 of the cucumber reference genome Chinese Long v3 Genome, and there is an insertion / deletion of 3bp. The deleted 3bp nucleotide sequence is CAA.

[0010] In a third aspect, the present invention provides a primer pair for amplifying the InDel molecular marker. The sequences of the primer pair are shown in SEQ ID NO.3 and SEQ ID NO.4.

[0011] Forward primer DOG-InDel F: 5’TCTTGGGAACTAGAACGGAGG3’ (SEQ ID NO.3);

[0012] Reverse primer DOG-InDel R: 5’CTAAGGCGGAGTGCGTCAG 3’ (SEQ ID NO.4).

[0013] In a fourth aspect, the present invention provides a kit for identifying the resistance of cucumber seeds to pre-harvest germination, which contains the primer pair as described above. In one embodiment, the kit further contains other components contained in a conventional PCR kit in the art, such as polymerase, buffer, etc.

[0014] In a fifth aspect, the present invention provides the application of the InDel marker or the primer pair as described above in identifying the resistance of cucumber seeds to pre-harvest germination.

[0015] In a sixth aspect, the present invention provides a method for identifying the resistance of cucumber seeds to pre-harvest germination, including detecting the insertion / deletion situation of the InDel marker on chromosome 4 of cucumber.

[0016] In one embodiment, corresponding InDel primers are designed for the InDel molecular marker detection. When there is a 3bp insertion at the InDel locus, it can be identified as a cucumber variety resistant to pre-harvest sprouting; when the InDel locus is of the 3bp deletion type, the cucumber variety to be tested is of the type prone to pre-harvest sprouting.

[0017] In one embodiment, the method includes:

[0018] (1) Extract the genomic DNA of the cucumber sample to be tested;

[0019] (2) Using the genomic DNA of the cucumber sample to be tested as a template, add the primer pair SEQ ID NO.3 and SEQ ID NO.4 to the PCR reaction system, and perform PCR amplification on the genomic DNA of the cucumber sample to be tested to amplify the corresponding DNA fragment;

[0020] (3) Identify the pre-harvest sprouting resistance phenotype of cucumber seeds according to the gel electrophoresis results.

[0021] In one embodiment, in the step (3), if the gel electrophoresis result shows a single 82bp band pattern, the cucumber sample to be tested is of the genotype resistant to pre-harvest sprouting; if the gel electrophoresis result shows a single 79bp band pattern, the cucumber sample to be tested is of the genotype prone to pre-harvest sprouting; when there are two band patterns, it is a heterozygous genotype.

[0022] In one embodiment, in the step (3), the PCR amplification product is separated by 8% (mass percentage) non-denaturing polyacrylamide gel electrophoresis and developed with silver nitrate.

[0023] In one embodiment, the PCR amplification reaction system in the step (2) is 8 μL, specifically as follows: 2×T5Super PCR Mix 4 μL, 10 μM·μL -1 SEQ ID NO.3 forward primer 0.32 μL, 10 μM·μL -1 SEQ ID NO.4 reverse primer 0.32 μL, 100 ng·μL -1 Template DNA 1 μL, ddH2O 2.36 μL to make up.

[0024] In one embodiment, the PCR reaction program in the step (2) is: pre-denaturation at 98°C for 2 min; then denaturation at 98°C for 10 s, annealing at 58°C for 10 s, extension at 72°C for 15 s, for 35 cycles; finally extension at 72°C for 3 min, and preservation at 4°C.

[0025] Compared with the prior art, the present invention has the following advantages:

[0026] (1) The cucumber CsDOG1 gene provided by the present invention can improve the pre-harvest germination resistance of cucumber seeds.

[0027] (2) The present invention provides InDel markers for the cucumber CsDOG1 gene. Applying the InDel markers may enable rapid, accurate, and high-throughput identification of genotype information, accelerating the breeding process for cucumber pre-harvest germination resistance. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 Fine mapping of the cucumber pre-harvest germination resistance gene CsDOG1 in Example 1 of the present invention;

[0029] Among them: a: The qPHS4.1 interval was mapped to the range between InDel-18 and SNP-6; b: The physical distance between InDel-18 and SNP-6 is 69.34 Kb; c: The candidate gene within the interval was determined to be CsaV3_4G032930 and named CsDOG1. There is an InDel variation in the second exon of this gene;

[0030] Figure 2 Relative expression levels of the CsDOG1 gene in different tissues in Example 1 of the present invention;

[0031] Figure 3 Subcellular localization of the CsDOG1 gene in Example 1 of the present invention;

[0032] Figure 4 Alignment of the full-length DNA sequences of the CsDOG1 gene of the parents Q12 and P60 in Example 2 of the present invention;

[0033] Figure 5 Detection of 40 cucumber germplasm resources using the InDel co-dominant molecular marker in Example 2 of the present invention, where M is 50bp DNA Ladder, Q12 and P60 are the parents, and 1-40 are the germplasm resources. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0034] The embodiments of the present invention are described in detail below. The embodiments described below are exemplary and are only used to explain the present invention and should not be construed as a limitation of the present invention.

[0035] In this article, unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the technical field to which this application belongs.

[0036] In this article, when values are described as ranges, it should be understood that such disclosure includes the disclosure of all possible sub-ranges within the range, as well as specific numerical values falling within the range, regardless of whether the specific numerical values or specific sub-ranges are explicitly indicated.

[0037] In this text, when referring to "multiple", etc., unless otherwise specified, it means greater than 2 or equal to 2 in number. For example, "one or more" means one or greater than or equal to two.

[0038] In this text, the terms "preferred" and "more preferred" are only used to describe embodiments or examples with better effects. It should be understood that they do not constitute a limitation on the protection scope of the present invention.

[0039] In this text, the term "further", etc., is used for descriptive purposes, indicating differences in content, but should not be construed as a limitation on the protection scope of the present invention.

[0040] In this text, the term "and / or" is a description of the associative relationship of objects, indicating that there can be three relationships. For example, A and / or B means: A or B, or the three relationships of A and B.

[0041] In this text, the term "about" means + / - 10% of the specified value, preferably + / - 5%, and more preferably + / - 1%.

[0042] In this text, the terms "comprising", "including", "having", "containing", etc., are all open-ended terms, that is, they are intended to include but not be limited to.

[0043] Unless otherwise specified, all technical and scientific terms used in this text have the same meaning as commonly understood by those of ordinary skill in the art to which the present invention pertains. Although the present invention only describes preferred methods and materials, any methods and materials similar or equivalent to those described in this text can also be used in the implementation or testing of the present invention.

[0044] The present invention will be described in detail below in conjunction with embodiments.

[0045] Example 1 Identification of the Pre-harvest Sprouting Resistance Gene CsDOG1 in Cucumber Seeds

[0046] 1. Map-based cloning of the CsDOG1 gene

[0047] To avoid interference from the genetic background, the cucumber advanced inbred line Q12 (resistant to pre-harvest sprouting) was used as the recurrent parent, and P60 (extremely prone to pre-harvest sprouting) was used as the donor parent. For the major QTL locus qPHS4.1 for pre-harvest sprouting in cucumber seeds, a backcross population BC4F2 carrying this target segment was constructed to finely map the gene for resistance to pre-harvest sprouting. From 3190 individual plants in the BC4F2 population, 187 exchange and recombination individual plants within the qPHS4.1 interval were screened out. The phenotypic identification of the recombinant individual plants was carried out, and QTL analysis was performed in combination with the genotyping data of the densified molecular markers within the qPHS4.1 interval. The results are as Figure 1As shown in the figure, the major pre-harvest sprouting locus qPHS4.1 was finely mapped within the range from InDel-18 to SNP-6, with an interval distance of 69.34 Kb. According to the re-sequencing data between the parents P60 and Q12, there is a 3-bp InDel in the coding region of the CsDOG1 gene (CsaV3_4G032930) within this interval. The gene encodes a protein with the DOG1 (Delay of Germination 1) domain and has high homology with the Arabidopsis DOG1 gene. The DOG1 gene can maintain seed dormancy in Arabidopsis and inhibit pre-harvest sprouting. The cucumber CsDOG1 gene contains two exons, and the 3-bp InDel occurs in exon 2 (as Figure 1 shown in c), and the deletion of 3 bp will cause the loss of one asparagine (-N) in the encoded amino acid sequence, which may cause protein dysfunction and induce premature seed germination.

[0048] 2. Tissue differential expression analysis of the CsDOG1 gene

[0049] To study the tissue expression differences of the CsDOG1 gene, samples were taken from seedlings, roots, stems, leaves, tendrils, young ovaries and male flowers at the adult stage, as well as the pulp and seeds of melons at 25, 32 and 38 days after pollination with both parents, and the relative expression levels of the CsDOG1 gene were analyzed by qRT-PCR. Pre-harvest sprouting occurred in P60 melons at 38 days after pollination, and germinated seeds and non-germinated seeds were sampled and analyzed respectively. The results showed that the expression level of the CsDOG1 gene was extremely low or almost not expressed in seedlings, roots, stems, leaves, tendrils, young ovaries and male flowers at the adult stage, and in the pulp at different melon ages; the CsDOG1 gene was highly expressed in non-germinated seeds (as Figure 2 shown), while the expression level in germinated seeds was significantly reduced, indicating that CsDOG1 is a seed-specifically expressed gene.

[0050] 3. Subcellular localization analysis of the CsDOG1 gene

[0051] To determine the subcellular localization of the cucumber CsDOG1 protein, a 35S::CsDOG1::GFP fusion vector was constructed and co-transformed with the marker plasmid 35S::NLS::mKate into tobacco protoplasts. Through fluorescence signal detection, it was observed that the GFP fluorescence signal completely overlapped with the red signal in the nuclear region, indicating that the CsDOG1-GFP protein was mainly localized in the nucleus. In addition, a small amount of fluorescence signal was also observed in the cytoplasm, indicating that the protein was also slightly expressed in the cytoplasm (as Figure 3 shown).

[0052] Example 2 Development and application of InDel markers for the cucumber CsDOG1 gene

[0053] 1. Development of InDel markers

[0054] The full-length nucleotide sequences of CsDOG1 genes for Q12 and P60 were obtained by amplification. After sequencing and sequence alignment, the results are as Figure 4 shown. At 1016 bp downstream of the start codon ATG, there is an InDel of three bases, CAA. Primers were designed across the InDel, and the primer sequences are shown in SEQ ID NO.3 and SEQ ID NO.4.

[0055] SEQ ID NO.3: DOG-InDel F: 5’TCTTGGGAACTAGAACGGAGG 3’;

[0056] SEQ ID NO.4: DOG-InDel R: 5’CTAAGGCGGAGTGCGTCAG 3’.

[0057] The product amplified by this primer pair for the cucumber pre-harvest sprouting-resistant type is 82 bp, and the nucleotide sequence is shown in SEQ ID NO.5. For the cucumber prone to pre-harvest sprouting, a 79-bp product can be amplified, and the nucleotide sequence is shown in SEQ ID NO.6. The amplified products can be separated by non-denaturing polyacrylamide gel electrophoresis, and the genotyping results can be obtained by silver nitrate development.

[0058] SEQ ID NO.5: TCTTGGGAACTAGAACGGAGGTCACCGGAAGGGTTGAAGGTCTCGTCAACATTATAAAAAAAGCTGACGCACTCCGCCTTAG;

[0059] SEQ ID NO.6: TCTTGGGAACTAGAACGGAGGTCACCGGAAGGGTTGAAGGTCTCGTCATTATAAAAAAAGCTGACGCACTCCGCCTTAG.

[0060] 2. Application of InDel markers

[0061] The primers designed above were applied to the identification of 40 cucumber germplasm resources (inbred lines), and the pre-harvest sprouting phenotype data of each resource were investigated to verify the coincidence rate of the markers.

[0062] The specific implementation steps are as follows:

[0063] (1) Extract cucumber genomic DNA using the Tiangen Quick Plant Genomic DNA Extraction System.

[0064] (2) PCR amplification

[0065] Take the DNA solution of the cucumber sample prepared above for PCR amplification. The nucleotide sequence of the upstream primer is as shown in SEQ ID NO.2, and the nucleotide sequence of the downstream primer is as shown in SEQ ID NO.3. The PCR amplification reaction system is 8 μL, specifically as follows: 4 μL of 2×T5Super PCRMix, 0.32 μL of primer SEQ ID NO.3 at 10 μM·μL -1 0.32 μL of primer SEQ ID NO.4 at 10 μM·μL -1 1 μL of template DNA, and make up to volume with 2.36 μL of ddH2O. The PCR reaction program is as follows: pre-denaturation at 98 °C for 2 min; then denaturation at 98 °C for 10 s, annealing at 58 °C for 10 s, extension at 72 °C for 15 s, for 35 cycles; finally, extension at 72 °C for 3 min, and store at 4 °C. -1

[0066] (3) Electrophoresis detection of PCR products

[0067] Separate the target bands using 8% non-denaturing polyacrylamide gel electrophoresis. After electrophoresis, rinse with pure water for 2 minutes, stain with 1 g·L -1 AgNO3 solution for 5 - 7 minutes. Develop with the developer solution (15 g·L -1 NaOH + 5 mL·L -1 formaldehyde) until the bands are clear. Wash with water to terminate the developing reaction, fix and take pictures, and save the electrophoresis results. Determine the genotype of the cucumber variety to be tested according to the band pattern.

[0068] (4) The electrophoresis results are as Figure 5 shown. Among them, 11 lines were identified as the 82 bp band pattern, which is consistent with that of the parent Q12, and is denoted as the "AA" type; 4 lines were identified as the heterozygous band pattern, denoted as the "HH" type; 25 lines were identified as the 79 bp band pattern, and is consistent with the band pattern of the parent P60, denoted as the "BB" type. Phenotypic data analysis shows that the average pre-harvest germination rate of the "AA" type is 0.91%, and the average pre-harvest germination rate of the "BB" type is 45.47%. Therefore, the InDel genotype is consistent with its phenotypic identification. According to the functional annotation and genotype analysis of CsDOG1, this gene is determined to be a functional candidate gene at the qPHS4.1 locus.

[0069] Table 1 Verification of InDel co-dominant markers in 40 cucumber germplasm resources

[0070]

[0071]

[0072] The above results indicate that this method has reliability and wide applicability.

[0073] ​The above are only the preferred embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention shall be included within the protection scope of the present invention.

Claims

1. A gene CsDOG1 for controlling the pre-harvest germination trait of cucumber seeds, characterized in that: The nucleotide sequence of the gene CsDOG1 is shown in SEQ ID NO.1 or SEQ ID NO.

2.

2. An InDel marker for identifying the CsDOG1 gene for cucumber resistance to pre-harvest sprouting, characterized in that: The InDel marker is an insertion / deletion of a 3-bp nucleotide sequence, and the nucleotide sequence is CAA.

3. Primer pair for amplifying the InDel molecular marker, characterized in that: The sequences of the primer pair are shown in SEQ ID NO.3 and SEQ ID NO.

4.

4. A kit for identifying the pre-harvest germination resistance of cucumber seeds, characterized in that: The kit contains the primer pair described in claim 3.

5. Use of the InDel marker described in claim 2 or the primer pair described in claim 3 in identifying the pre-harvest germination resistance of cucumber seeds.

6. A method for identifying the pre-harvest germination resistance of cucumber seeds, characterized in that: It includes detecting the insertion / deletion situation of the InDel marker on chromosome 4 of cucumber.

7. The method according to claim 6, wherein: The method includes the following steps: (1) Extract the genomic DNA of the cucumber sample to be tested; (2) Using the genomic DNA of the cucumber sample to be tested as a template, add the primer pair SEQ ID NO.3 and SEQ ID NO.4 to the PCR reaction system, and perform PCR amplification on the genomic DNA of the cucumber sample to be tested to amplify the corresponding DNA fragment; (3) Identify the pre-harvest germination resistance phenotype of cucumber seeds according to the gel electrophoresis results.

8. The method according to claim 7, wherein: In step (3), if the gel electrophoresis result shows a single 82-bp band pattern, the cucumber sample to be tested is a genotype resistant to pre-harvest germination; if the gel electrophoresis result shows a single 79-bp band pattern, the cucumber sample to be tested is a genotype susceptible to pre-harvest germination; when both of the above two band patterns are present, it is a heterozygous genotype.

9. The method according to claim 7, wherein: In the step (2), the PCR amplification reaction system is 8 μL, specifically as follows: 2×T5 Super PCR Mix 4 μL, 10 μM·μL -1 Forward primer 0.32 μL, 10 μM·μL -1 Reverse primer 0.32 μL, 100 ng·μL -1 Template DNA 1 μL, supplemented with 2.36 μL of ddH2O.

10. The method according to claim 7, characterized in that: The PCR reaction program in step (2) is: pre-denaturation at 98°C for 2 min; then denaturation at 98°C for 10 s, annealing at 58°C for 10 s, extension at 72°C for 15 s, for 35 cycles; finally, extension at 72°C for 3 min and preservation at 4°C.

Images