Application of FabA gene and FabZ gene in improvement of rhamnolipid performance

Abstract

The invention discloses application of a FabA gene and a FabZ gene in improvement of rhamnolipid performance, and belongs to the technical field of genes. According to the method for improving the performance of the rhamnolipid, the structural composition of the rhamnolipid produced by the strain is changed by regulating and controlling expression of a FabA gene and / or a FabZ gene in the strain, so that the performance of the rhamnolipid is improved. According to the invention, the essential genes FabA and FabZ for the survival of bacteria are used for regulating and controlling the fatty acyl chain composition of the rhamnolipid for the first time, and the diversification of the length and saturation of the rhamnolipid fatty acid chain is realized by regulating and controlling the expression levels of the genes FabA and FabZ, so that the emulsifying property of the rhamnolipid is improved, and the performance and application of the rhamnolipid in different industrial applications are expanded.

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, and particularly to the application of fabA gene and fabZ gene in improving the properties of rhamnolipids. Background Art

[0002] Rhamnolipids are a class of glycolipid biosurfactants produced by microorganisms (such as Pseudomonas aeruginosa). It consists of rhamnose sugar groups and β-hydroxy fatty acid chains, and has good surface tension reduction and emulsifying ability, and has broad application prospects in industrial and environmental fields such as oil exploitation, bioremediation, pharmaceutical preparations and detergents. Rhamnolipids can be divided into various structural types such as mono-rhamnolipids (containing 1 rhamnose group) and di-rhamnolipids (containing 2 rhamnose groups). So far, more than 60 different structural rhamnolipid homologues have been identified, and their sugar group numbers and fatty acyl chain lengths / saturations are different. These structural differences will significantly affect the physical and chemical properties of rhamnolipids, including solubility, surface tension reduction efficiency, emulsifying ability, critical micelle concentration (CMC), etc., thus determining their performance in different application scenarios.

[0003] At present, most of the research on rhamnolipids focuses on improving the production and fermentation efficiency, such as enhancing the yield by optimizing the culture medium, engineering bacteria transformation and other means. However, relatively few studies have been conducted on how to customize the fatty acyl chain composition of rhamnolipids to optimize their functions. It has been reported that rhamnolipids with different fatty acid chain lengths and saturations have obvious differences in performance. For example, rhamnolipids with shorter and saturated fatty acyl chains may be more likely to form a dense arrangement at the interface, thus showing stronger emulsifying ability; while homologues with longer or higher unsaturated fatty acyl chains may reduce their surface activity efficiency. Therefore, developing a technology that can purposefully regulate the fatty acid chain structure of rhamnolipids is of great significance for preparing biosurfactant products that meet specific application requirements. Summary of the Invention

[0004] The purpose of the present invention is to provide the application of fabA gene and fabZ gene in improving the properties of rhamnolipids to solve the problems existing in the above prior art. The present invention first uses the essential genes for bacterial survival, fabA and fabZ, to regulate the fatty acyl chain composition of rhamnolipids. By regulating the expression levels of fabA and fabZ genes, the diversification of the fatty acid chain length and saturation of rhamnolipids is achieved, thereby improving its emulsifying performance and expanding the performance and uses of rhamnolipids in different industrial applications.

[0005] To achieve the above purpose, the present invention provides the following solutions:

[0006] The present invention provides the application of fatty acid synthesis-related genes in improving the properties of rhamnolipids, and the fatty acid synthesis-related genes include the fabA gene and the fabZ gene;

[0007] The method for improving the properties of rhamnolipids is to change the structural composition of rhamnolipids produced by bacteria by regulating the expression of the fabA gene and / or the fabZ gene in the bacteria, thereby improving the properties of rhamnolipids.

[0008] Optionally, the bacteria include Pseudomonas aeruginosa.

[0009] The present invention also provides a method for improving the properties of rhamnolipids, including the step of knocking out the fabZ gene in bacteria to increase the emulsifying performance of rhamnolipids;

[0010] Or, it includes the step of overexpressing the fabA gene in bacteria by genetic transformation technology to increase the emulsifying performance of rhamnolipids.

[0011] In some other embodiments of the present invention, knocking out the fabA gene in bacteria or overexpressing the fabZ gene in bacteria will produce rhamnolipids with a specific structural preference different from the above methods, increasing the diversity of the fatty acid combination and structure of rhamnolipids. For example, knocking out the fabA gene in bacteria will decrease the emulsifying performance of rhamnolipids and increase the critical micelle concentration; overexpressing the fabZ gene in bacteria by genetic transformation technology will increase the critical micelle concentration of rhamnolipids. In actual production applications, different regulation methods can be selected according to the requirements for the properties of rhamnolipids to meet the possible needs of different application fields.

[0012] Optionally, the bacteria include Pseudomonas aeruginosa.

[0013] The present invention also provides rhamnolipids prepared by using the above method.

[0014] The present invention also provides the application of the above rhamnolipids as emulsifiers in the emulsification of oil-water systems.

[0015] The present invention also provides the application of the above rhamnolipids in the preparation of detergents.

[0016] The present invention also provides the application of the above rhamnolipids in the preparation of biosurfactants.

[0017] The present invention discloses the following technical effects:

[0018] For the first time, the essential bacterial genes fabA and fabZ are used to regulate the fatty acyl chain composition of rhamnolipids. By regulating the expression levels of the fabA and fabZ genes, the fatty acyl chain composition and structure of rhamnolipids are changed, diversifying the fatty acid chain length and saturation of rhamnolipids, thereby improving their emulsifying properties, expanding the application potential of rhamnolipids in industry, pioneering the regulation of surfactant properties through genetic engineering techniques, and providing a research basis for the preparation, optimization, and upgrading of biosurfactants. Brief Description of the Drawings

[0019] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for use in the embodiments. Obviously, the drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can be obtained based on these drawings.

[0020] Figure 1 Schematic diagram for the construction of ΔrhlC / ΔfabZ-sup strain;

[0021] Figure 2 TLC diagram of rhamnolipid products of different strains;

[0022] Figure 3 LC-MS / MS diagram of the fatty acid chain composition of rhamnolipid products of different strains;

[0023] Figure 4 Distribution diagram of the proportion of fatty acid chain types in rhamnolipid products of different strains;

[0024] Figure 5 E24% diagram of rhamnolipid products of different strains; among them, A is the E24% diagram of rhamnolipid products of three strains of ΔrhlC, ΔrhlC / ΔfabA-sup, and ΔrhlC / fabA-OE; B is the E24% diagram of rhamnolipid products of three strains of ΔrhlC, ΔrhlC / ΔfabZ-sup, and ΔrhlC / fabZ-OE;

[0025] Figure 6 CMC diagram of rhamnolipid products of different strains; among them, A is the CMC diagram of rhamnolipid products of three strains of ΔrhlC, ΔrhlC / ΔfabA-sup, and ΔrhlC / fabA-OE; B is the CMC diagram of rhamnolipid products of three strains of ΔrhlC, ΔrhlC / ΔfabZ-sup, and ΔrhlC / fabZ-OE. Detailed Embodiments

[0026] The various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0027] It should be understood that the terms used in the present invention are only for describing specific embodiments and are not intended to limit the present invention. Additionally, for the numerical ranges in the present invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any intermediate value within any stated value or stated range, as well as each smaller range between any other stated value or intermediate value within the stated range, is also included in the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0028] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by a person of ordinary skill in the art to which the present invention pertains. Although the present invention only describes preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials related to the documents. In case of conflict with any incorporated document, the content of this specification shall prevail.

[0029] Without departing from the scope or spirit of the present invention, various improvements and changes can be made to the specific embodiments of the present invention specification, which are obvious to those skilled in the art. Other embodiments obtained from the specification of the present invention are obvious to those skilled in the art. The specification and examples of the present invention are merely exemplary.

[0030] Regarding the use of "comprising", "including", "having", "containing", etc. herein, they are all open-ended terms, meaning including but not limited to.

[0031] The methods involved in the following examples of the present invention are all conventional methods in the art unless otherwise specified; the reagents or materials involved are all commercially available through conventional channels unless otherwise specified.

[0032] Example 1 Construction of fabA and fabZ Knockout Strains and Overexpression Strains

[0033] 1. Knockout of the rhlC gene

[0034] In this example, Pseudomonas aeruginosa PAO1 was used as the test strain. Pseudomonas aeruginosa can produce both mono-rhamnolipid and di-rhamnolipid. To facilitate the subsequent study of the properties of rhamnolipids, the rhlC gene on Pseudomonas aeruginosa PAO1 was knocked out to obtain Pseudomonas aeruginosa that can only produce mono-rhamnolipid. The purpose of this step is only to simplify the product components and facilitate the analysis of the composition changes of fatty acid chains. In industrial applications, the rhlC gene does not need to be knocked out to obtain modified mono-rhamnolipid and di-rhamnolipid at the same time. The specific operation process of knocking out the rhlC gene is as follows:

[0035] (1) Use PCR to amplify the homologous arm sequences of about 500 bp upstream and downstream of the rhlC gene, and ligate the upstream and downstream homologous arms to the pUC19-GmR-sacB plasmid (using the pUC19 plasmid as the basic vector, carrying the Gm R resistance gene and the sacB sucrose sensitivity gene, as described in the literature "Analysis ofthe Plasmid-Based ts-MutantΔfabA / pTS-fabA RevealsIts Lethality under Aerobic Growth Conditions That Is Suppressed by MildOverexpression ofdesA at a Restrictive Temperature in Pseudomonas aeruginosa") to construct the homologous recombination knockout vector pUC19-Gm R -sacB-ΔrhlC.

[0036] The upstream homologous arm sequence is (SEQ ID NO.1):

[0037] ggctactcgctggccctctacggcgtgctcgcggtgctcgcccagaccctcggcgtgaacctctgcaagcggcgcctggacgacgcccgcctgctgcgcctgggcctcgccctgcaaggctgcggcctgctgctgttcgccctggtcgactcgtcattctggctggtctgcgcgctgctgcccttcgcgctcggcagcctcgccaccccggccatgcaggggctgctctcggcccgcgtgccggtcgaccgccagggcgagttgcagggcgtgctgagcagcctgatgagcctcgccgcgatcgtcggtccgccgctgatgagcggcctgttccactggggcagcggtccgctcgcgccgctgcccctggccggcgcgccattcctcgccggcgcccttctcgttctggccgggctggtcctggcctggcaacttcgacctacgggagaagaacgatcatggaccggatagacatgggcgtgctggtggtactgttcaatcctggcgacgacgacctggaacaccttg;

[0038] The downstream homologous arm sequence is (SEQ ID NO.2):

[0039] acaagctgctcaagctgcgctgcctgggctggggcctgtgggacggcctgcggggacgcggcggcgcgctggagaccaaccgcccgcgcctgctgaagcgcctcgccggcccggccgtggcgtccgtagcttccggcaaggccaaggcctagtcggcgaaacgcattcccgcatagggcgcttgccggcacgccgcgagccggctgcgcaggtcgccgacgtgggcctccaggcgatggccgtccgggtcgaggaagtagaacgaatcgccctcgctgcggttctgcttccattcgcgcacgccatgcgcgcgcagctgcgcggcgaagcgggcgaaatccgcggcggcgatgccgaaggcgtagtgcgtgtagtccgcggccggcccgccgtactgcggctcccgggacaggcacagccacagcgaacccagttcgagataggcgccctggtcccagcgcgcttccaggcgaaagccgagaagatcgcggtaga。

[0040] (2) The constructed homologous recombination knockout vector pUC19-Gm R -sacB-ΔrhlC was introduced into Pseudomonas aeruginosa PAO1 by electroporation, and single colonies with rhlC gene deletion (named ΔrhlC) were obtained by screening for sucrose-resistant double crossover homologous recombination. The complete deletion of the rhlC gene was verified by PCR and confirmed by sequencing. The obtained ΔrhlC strain was cultured and rhamnolipids were extracted. Thin layer chromatography (TLC) analysis confirmed that this strain no longer produced dirhamnolipids but only monorhamnolipids.

[0041] 2. Construction of the fabA knockout strain (ΔrhlC / ΔfabA-sup)

[0042] The fabA gene is a key gene for bacterial survival, and its knockout will lead to a lethal phenotype in bacteria. Previous studies by the research group found that overexpression of desA can completely suppress its lethality. Therefore, referring to the method in the literature (Analysis ofthe Plasmid-Basedts-MutantΔfabA / pTS-fabA Reveals Its Lethality under Aerobic GrowthConditions That Is Suppressed by Mild Overexpression of desA at a RestrictiveTemperature in Pseudomonas aeruginosa), first, the knockout plasmid carrying the ΔfabA deletion allele was introduced into Pseudomonas aeruginosa PAO1. In the presence of a rescued copy of fabA controlled by the native promoter provided by the plasmid, the targeted deletion of the fabA gene on the chromosome was completed. The constructed temperature-sensitive mutant strain was designated as ΔfabA / pTS-fabA, in which the chromosome carried the fabA deletion allele, and the plasmid pTS-fabA carried the wild-type fabA gene. Then, the desA sequence shown in SEQ ID NO.3 was cloned into the integration vector and then transformed into the ΔfabA / pTS-fabA strain to construct the ΔfabAP sup :desA / pTS-fabA strain that survived by upregulating the endogenous desA expression. Based on the ΔfabAP sup :desA / pTS-fabA strain, the rhlC gene of this strain was knocked out according to the steps of "1. Knockout of the rhlC gene" to obtain the ΔrhlC / ΔfabA-sup strain.

[0043] desA sequence (SEQ ID NO.3):

[0044]

[0045] 3. Construction of fabA overexpressing strain (ΔrhlC / fabA-OE)

[0046] Referring to the method in the literature (Analysis of the Plasmid-Based ts-Mutant ΔfabA / pTS-fabA Reveals Its Lethality under Aerobic Growth Conditions That Is Suppressed by Mild Overexpression of desA at a Restrictive Temperature in Pseudomonas aeruginosa), the fabA gene on the chromosome of Pseudomonas aeruginosa was amplified by PCR and cloned together with an inducible promoter (PBAD promoter regulated by AraC) into the expression plasmid pBBR1MCS-5 to construct a recombinant plasmid. After sequencing confirmation, it was transferred into PAO1 strain to obtain the fabA overexpressing strain (fabA-OE). This strain can induce the overexpression of fabA using 0.02% l-arabinose. Based on the fabA-OE strain, the rhlC gene of this strain was knocked out according to the steps of "1. Knockout of rhlC gene" to obtain the ΔrhlC / fabA-OE strain.

[0047] 4. Construction of fabZ knockout strain (ΔrhlC / ΔfabZ-sup)

[0048] Since the fabZ gene is an essential gene of Pseudomonas aeruginosa PAO1, its direct knockout is lethal. Therefore, the inhibitory effect of lpxH gene deletion on the lethal effect of fabZ deletion was utilized, and a temperature-sensitive recovery plasmid was used to provide the functions of fabZ and lpxH genes, and the strain PAO1ΔfabZ-sup with double knockout of fabZ and lpxH was constructed step by step (see Figure 1 ), and the rhlC gene was further knocked out on this bacterium to obtain the ΔrhlC / ΔfabZ-sup strain. The specific steps are as follows:

[0049] (1) Construction and transformation of fabZ knockout plasmid

[0050] First, two pairs of primers were designed based on the upstream and downstream sequences of the fabZ gene in the PAO1 genome. Appropriate restriction enzyme sites were added to the ends of the primer sequences for easy cloning. Using the PAO1 genomic DNA as a template, the upstream and downstream homologous arm fragments of the fabZ gene were obtained by PCR amplification. The sequences of the amplified homologous arm fragments are shown in SEQ ID NO.4-5. In addition, primers fabZ-popID-F1 / R1 for verifying the fabZ gene knockout were also designed, and the sequences are shown in SEQ ID NO.6-7.

[0051] Upstream homologous arm sequence:

[0052] gagcactgtccgatacgctgatcggcaacggtgtgaagctggacaaccagatcatgatcgcgcacaacgtgcagatcggcgatcataccgccatggccgcttgcgtcggcatttccggcagcgccaagatcggcaggcattgcatgctcgccggcggcgttggcctggtcggccatatcgagatctgcgacaacgttttcgtgaccggcatgaccatggtgacccgctcgatcaccgagccgggatcgtattcctccggtaccgccatgcaaccggcggccgaatggaaaaaaagcgccgcgcgcattcgtcaactggacgacatggcgcgtcgacttcagcagctggaaaaacgcctggctgccgtgacctcaagcggtgacgcttcatctgatgcgtaattgacgttttttgcgtcacccttttctgaacaggctccccctaacatgatggacatcaacgagattcgcgaatacctgcctcatcgctat (SEQ ID NO.4);

[0053] Downstream homologous arm sequence:

[0054] Tatgctcggctgaaatcatctgtgcggaacgcaaactatgagtttgatcgatcctcgcgccatcatcgatccgagcgccaggctggcggctgacgtccaggtgggcccgtggtccatcgtcggggcggaagtggagatcggtgaagggacggtgatcggtccgcacgtggtgctcaagggccccacgaagatcggcaagcacaaccgcatctaccagttttccagcgtcggcgaggatactcccgacctgaaatacaagggcgagccgacgcgcctggtgatcggtgaccacaacgtgatccgcgaaggcgtgaccatccatcgcggaaccgtccaggatcgcgcggaaaccaccattggcgaccacaacctgatcatggcctatgcgcacatcggccatgacagcgtgatcggcaaccattgcatcctggtgaacaacacggcgctggccgggcatgtccacgtggacgact(SEQ ID NO.5).

[0055] Primers for verifying fabZ gene knockout:

[0056] FabZ-popID-F1: TCCCTTCACCGATCTCCACTT(SEQ ID NO.6);

[0057] FabZ-popID-F2: CGACTTCAGCAGCTGGAAAAAC(SEQ ID NO.7).

[0058] The purified upstream and downstream homologous arm fragments were successively cloned into the corresponding restriction enzyme sites of the knockout plasmid vector (pUC19-Gm R -sacB) carrying the reporter gene sacB and the antibiotic resistance marker to construct the fabZ knockout plasmid (pUC19-Gm R-sacB-ΔfabZ). After construction, the plasmid was sequenced to confirm the correct insertion direction and sequence of the fragment. The obtained fabZ knockout plasmid was electrotransformed into competent cells of Pseudomonas aeruginosa PAO1 (electroporation conditions: using a 0.2 cm gap electroporation cuvette, voltage 2.5 kV, pulse time 5 ms, suspending the cells in a salt-free ice-cold 10% glycerol solution); after electroporation, it was incubated in SOC medium at 30 °C for 3 hours, and then spread on an LB agar plate containing the corresponding antibiotic (50 μg / mL gentamicin), and cultured at 30 °C to obtain antibiotic-resistant clones. The resistant clones were selected, and the knockout plasmid was identified by PCR using the fabZ gene knockout verification primers to have been integrated into the fabZ locus of the PAO1 genome through homologous recombination single crossover, and a PAO1 single crossover recombinant strain with fabZ knockout was obtained.

[0059] (2) Construction and transformation of the fabZ and lpxH double rescue plasmid

[0060] To provide the functions of the fabZ and lpxH genes during the first knockout of fabZ and the subsequent knockout of lpxH, a temperature-sensitive rescue plasmid (the same rescue plasmid used in the fabA knockout process) was used to construct a rescue vector. First, primers were designed according to the PAO1 genome sequence, and the functional fragments of the fabZ gene (including its own promoter region, approximately containing 200 bp of sequence upstream of the start codon) and the lpxH gene (containing its own promoter region, approximately containing 200 bp of promoter sequence upstream) were amplified by PCR.

[0061] Primers for amplifying the functional gene fragments of fabZ and lpxH:

[0062] fabZ-rescue-F1: gcccgggatccgatatctagaGATCGTATTCCTCCGGTACCG (SEQ ID NO.8);

[0063] fabZ-rescue-R1: ttatgcgattcGCGAGGATCGATCAAACTCATAG (SEQ ID NO.9);

[0064] lpxH-rescue-F2: gatcctcgcGAATCGCATAATGCTTCGCTGA (SEQ ID NO.10);

[0065] lpxH-rescue-R2: cttgcggagaactgtggtaccTCCAGGTCGGCTTGAACGAT (SEQ ID NO.11);

[0066] Functional sequence of the fabZ gene:

[0067] gatcgtattcctccggtaccgccatgcaaccggcggccgaatggaaaaaaagcgccgcgcgcattcgtcaactggacgacatggcgcgtcgacttcagcagctggaaaaacgcctggctgccgtgacctcaagcggtgacgcttcatctgatgcgtaattgacgttttttgcgtcacccttttctgaacaggctccccctaacatgatggacatcaacgagattcgcgaatacctgcctcatcgctatcctttcctgctggtggatcgggtggtagagctggacatcgagggcaagcgcattcgcgcctacaagaatgtcagtatcaatgagccgttcttcaacggacatttccccgagcacccgatcatgccgggcgtgctgatcatcgaggcgatggcccaggcggccggtatcctcggtttcaagatgctcgacgtgaagcccgccgacggcaccctttactacttcgtcggttcggacaagctgcgcttccgccagccggtcctgccgggcgaccaactgcaactgcacgccaagttcatcagcgtgaagcgcagcatctggaaattcgactgccacgctaccgtcgacgacaagccggtatgctcggctgaaatcatctgtgcggaacgcaaactatgagtttgatcgatcctcgc(SEQ ID NO.12);

[0068] Functional sequence of lpxH gene:

[0069]

[0070] The above functional fragments of the fabZ and lpxH genes were simultaneously cloned into the appropriate multiple cloning sites of the temperature-sensitive restoration plasmid vector using recombinant cloning method, so that both genes were expressed under the drive of their respective natural promoters, and the fabZ and lpxH double-gene restoration plasmid (pTS-fabZ-lpxH) was constructed. After the plasmid construction was completed, it was transformed into the PAO1 single-exchange recombinant strain obtained in step (1). The transformation was carried out by an electroporation method similar to that in step (1), and the transformants were screened on an LB plate containing the restoration plasmid antibiotic (100 μg / mL tetracycline) at 30 °C. A recombinant strain carrying both the single-exchange integration of the fabZ knockout plasmid and the temperature-sensitive restoration plasmid of the fabZ and lpxH double genes was obtained.

[0071] (3) Sucrose negative selection of the fabZ gene

[0072] The strain obtained in step (2) was cultured on an LB plate containing 10% sucrose to screen for the secondary recombinant strain with fabZ knockout. The deletion of the fabZ gene was confirmed by PCR using the fabZ gene knockout verification primers fabZ-popID-F1 / R1.

[0073] (4) Construction and transformation of the lpxH knockout plasmid

[0074] Repeat the method in step (1) to construct the lpxH knockout plasmid ((pUC19-Gm R -sacB-ΔlpxH), and transform it into the fabZ deletion strain obtained in step (3). The single-exchange integration strain was confirmed by PCR using the lpxH gene knockout verification primers.

[0075] The upstream homologous arm sequence of the lpxH gene:

[0076] tgggatccttggtcatgctctcgcccgaccagggtaggccgggcaaatcaaagcgcttatcatagccgaagctgtcaaccccctgacaggccttcgattttcacgacaaagcggattacccacatgatcaagctgcataccaaccatggcgtcatcaccctgaagctcgatgaagagaaagccccggaaaccgcggcgaacttcaaggagtacgtgaaaagcggccactacgacaacaccgtcttccaccgcgtgatcaacaacttcatgatccagggcggcggtttcgagccgggcatgaagcagaagcccactcgcgcaccgatcaagaacgaagccaacaacggcctgaccaacaaggtcggcagcatcgccatggctcgtaccatggacccgcattcggccagcgcgcagttcttcatcaacgtcgccgacaacgatttcctcaaccataccgcccccaccacccagggctggggctatgccgtcttcggcgaagtggtcgagggcatggacgtggtcaacaagatcaagggcgtggccaccaccatgcgcagcggccaccaggacgtgccggccgaggacgtgatcatcgagaaggccgaaatcgtcgaagaatgaagcgatgagcgtcctgttcatctcggacctgcatctcgaagcggaacgcccggac(SEQ ID NO.14);

[0077] Homologous arm sequence downstream of the lpxH gene:

[0078] gccctggagatcgacgccaacggccatcgccaggcgcccttcccgctctgacccaccccaggcccgccatgcgggcctttcagcgaagcattatgcgattcgcattttttccgccgtccatcttgacgtcgcgggccacctttcagcaggatcgcgctcccccaccccgcatcaaggaatgatcgtgatcatctcgaagggaaacctgatcaagttcgtcgccgcccccctcggcgtgctcgccctcggcttcggcctgttcaacggcgtgttcttctataacgaagccggcttcatgacccacgtaaggaccatcttcggcgacgagaagatcgtcgatgacgtcggctacgcgaccaagtggttcggtcgcgccaccacctggaagaaggccatcagcgtgcagtccgtgctggtcatggacgataacgacaccaatccggacaacgacggcctcggcgccaccatcgaggctttcccgatcgtgttcctcggcaacgt(SEQ ID NO.15).

[0079] Verification primers for lpxH gene knockout:

[0080] lpxH-popID-F1: TGATCACGATCATTCCTTGATGC(SEQ ID NO.16);

[0081] lpxH-popID-R1: TGGACGTGGTCAACAAGATCAAG(SEQ ID NO.17).

[0082] (5) Negative sucrose selection of lpxH gene

[0083] The strain obtained in (4) was cultured on an LB plate containing 10% sucrose to screen for secondary recombinant strains with lpxH knockout. The deletion of the lpxH gene was confirmed by PCR using the verification primers for lpxH gene knockout.

[0084] (6) Elimination of temperature-sensitive recovery plasmid

[0085] The strain obtained in (5) was cultured at 42 °C to screen for colonies that had lost the temperature-sensitive recovery plasmid. The absence of plasmid residue was confirmed by resistance testing and PCR using the verification primers for fabZ and lpxH gene knockout to obtain the ΔfabZ-sup strain.

[0086] Deletion of the rhlC gene

[0087] According to the steps of "1. Deletion of the rhlC gene", the rhlC gene of the ΔfabZ-sup strain was deleted to obtain the ΔrhlC / ΔfabZ-sup strain.

[0088] 5. Construction of the fabZ overexpression strain (ΔrhlC / fabZ-OE)

[0089] Referring to the method in the literature (Analysis of the Plasmid-Based ts-Mutant ΔfabA / pTS-fabA Reveals Its Lethality under Aerobic Growth Conditions That Is Suppressed by Mild Overexpression of desA at a Restrictive Temperature in Pseudomonas aeruginosa), the fabZ gene on the chromosome of Pseudomonas aeruginosa was amplified by PCR and cloned together with an inducible promoter (carrying the PBAD promoter regulated by AraC) into the expression plasmid pBBR1MCS-5 to construct a recombinant plasmid. After sequencing confirmation, it was transferred into the PAO1 strain to obtain the fabZ overexpression strain (fabZ-OE). On the basis of the fabZ-OE strain, according to the steps of "1. Deletion of the rhlC gene", the rhlC gene of this strain was deleted to obtain the ΔrhlC / fabZ-OE strain.

[0090] Example 2 Effects of fabA / fabZ deletion and overexpression on fatty acid chains

[0091] 1. The test strains are shown in Table 1

[0092] Table 1 Test strains

[0093]

[0094]

[0095] 2. Cultivation and product extraction: Inoculate each strain in Table 1 under the same conditions for cultivation to produce rhamnolipids. The medium uses MS plus 2% glycerol as the carbon source, and is shaken and cultivated at 28 - 30 °C for 5 days to allow the strains to fully produce rhamnolipids. For the overexpression strains, l - arabinose is added during the cultivation process to induce the expression of fabA or fabZ. After fermentation, collect the culture supernatants of each strain, extract rhamnolipids through three extractions with chloroform:methanol (2:1, volume ratio), combine the organic phases and concentrate and dry them to obtain the crude rhamnolipid product.

[0096] 3. Detection of fatty acid composition of rhamnolipid products: Dissolve the extracted rhamnolipid samples in methanol and perform thin - layer chromatography (TLC) and liquid chromatography - tandem mass spectrometry (LC - MS / MS) analyses respectively. The TLC results are as Figure 2 shown, confirming that all samples are monorhamnolipids and do not contain dirhamnolipids (because the strains are all lacking rhlC). Subsequently, data is collected in the negative ion mode by LC - MS / MS, and the fatty acyl chain composition of rhamnolipid molecules is identified based on characteristic fragment ions. The LC - MS / MS analysis results are as Figure 3 , Figure 4 and Table 2 show that the samples of each strain are mainly composed of 7 monorhamnolipid homologues, and there are obvious differences in the relative contents among different strains.

[0097] Table 2 LC - MS / MS analysis results of rhamnolipid samples of each strain

[0098]

[0099]

[0100] Among them, for the control strain ΔrhlC: The main products are Rha - C10 - C10 (monorhamnolipid with double C10 fatty acid chains) and Rha - C10 - C12:1 / Rha - C12:1 - C10 (containing C10 and C12 unsaturated fatty acid chains), followed by approximately 17% of Rha - C10 - C12 / Rha - C12 - C10 (containing C10 and C12 saturated fatty acid chains) and approximately 8% of Rha - C10 - C12:1 / Rha - C12:1 - C10 (C12 fatty acid chain with one unsaturated bond). Small amounts of short - chain components such as Rha - C8 - C8 and Rha - C10 - C6 are detected.

[0101] ΔrhlC / ΔfabA-sup: The fatty acyl chain composition changes drastically. The proportion of the medium-chain-length unsaturated component Rha-C10-C12:1 (and its equivalent structure Rha-C12:1-C10) increases to approximately 59.3% and becomes the main component; correspondingly, the content of the saturated Rha-C10-C10 decreases to approximately 12.9%, and the short-chain saturates Rha-C8-C8 and Rha-C10-C6 almost completely disappear (<0.5%). This result indicates that the deletion of fabA leads to the accumulation of cis-unsaturated intermediates in the fatty acid synthesis pathway, making the final rhamnolipids tend to carry medium-chain unsaturated fatty acids.

[0102] ΔrhlC / fabA-OE: Contrary to the deletion of fabA, the excessive FabA enzyme activity results in the redistribution of fatty acid metabolic flux. The proportion of Rha-C10-C14:1 (or Rha-C14:1-C10) is detected to increase to 23.4% (only 8.46% in the control ΔrhlC), indicating an increase in the production of long-chain unsaturated fatty acids. At the same time, the medium-chain unsaturated Rha-C10-C12:1 slightly decreases (still one of the main components), and the saturated Rha-C10-C10 also decreases. Notably, this overexpression strain also produces a large amount of short-chain unsaturated rhamnolipids (such as Rha-C8-C8 / Rha-C10-C6, accounting for approximately 27.54% of the total), showing that the enhanced FabA activity accumulates unsaturated acyl precursors of various lengths. Overall, the overexpression of fabA expands the diversity of the fatty acyl chain composition of rhamnolipids and increases the proportion of short-chain and long-chain unsaturated components.

[0103] ΔrhlC / ΔfabZ-sup: The fatty acid composition of the products of this strain is biased towards medium-chain-length saturated / partially unsaturated fatty acids. Among them, Rha-C10-C10 increases to approximately 43.4% and becomes the most abundant component; while the long-chain-containing Rha-C10-C14:1 only accounts for 3.97%, and the C12-containing saturated rhamnolipids (Rha-C10-C12 / Rha-C12-C10) also decrease to 1.62%, presenting a characteristic dominated by C10-C10. This indicates that the fatty acid elongation is blocked after the deletion of fabZ, and more fatty chains stay at the C10 length.

[0104] ΔrhlC / fabZ-OE: The fatty acid distribution of the rhamnolipid products of this strain showed a "polarization" trend. Compared with the ΔrhlC strain, the proportion of short-chain saturated Rha-C8-C8 (or Rha-C10-C6) increased to 20.29%, and the long-chain unsaturated Rha-C10-C14:1 (or Rha-C14:1-C10) increased to 18.3%. The medium-chain unsaturated Rha-C10-C12:1 was still one of the main components (about 30.9%). At the same time, a certain amount of short-chain products was also detected. Overall, it was shown that overexpression of fabZ led to a wider distribution of fatty acyl chain lengths: both shorter-chain and longer-chain rhamnolipid species appeared, with a complex and diverse composition. It was speculated that excessive FabZ enzyme activity disrupted the normal balance of fatty acid synthesis intermediates, causing some acyl groups to be overextended while some acyl groups prematurely entered the FabA pathway to produce unsaturation, thus forming a bimodal distribution.

[0105] The above results of fatty acid composition analysis indicated that fabA and fabZ played important regulatory roles in the length and saturation of the fatty acyl chains of rhamnolipids: reducing the function of FabA made rhamnolipids tend to have longer and unsaturated chains, while increasing FabA increased both short-chain and long-chain unsaturation; reducing the function of FabZ made rhamnolipids tend to have medium-length saturated chains, and increasing FabZ led to uneven chain length distribution. By genetically engineering these two genes in different ways, the structure of rhamnolipids could be customized at the molecular level, laying a foundation for the optimization of downstream performance.

[0106] 4. Emulsifying ability test of rhamnolipid products

[0107] The crude rhamnolipid samples of each strain were prepared into a series of solutions with concentrations (7.8, 15.6, 31.3, 62.5, 125, 250, 500 mg / L) using deionized water (pH adjusted to 7.0). 1 mL of each solution was taken and mixed with 1 mL of crude oil (or vegetable oil) in a test tube, shaken vigorously for 2 minutes, and after standing for 24 hours, the height of the emulsified layer was measured and the emulsification index E24 (height of emulsified layer / total liquid height × 100%) was calculated. Sodium dodecyl sulfate (SDS) solution was used as a positive control reference.

[0108] The results were as Figure 5 shown, and the emulsifying activities of the products of each strain were significantly different, which was related to their respective acyl chain compositions.

[0109] ΔrhlC / fabA-OE: Exhibited the strongest emulsifying ability. At 500 mg / L, the E24 of this sample was close to 100%, almost completely emulsifying the oil phase into a stable emulsion. This performance was significantly better than that of the rhamnolipid of the unmodified control (ΔrhlC) (the latter had an E24 of approximately 85% at the same concentration). Even at 250 mg / L, the E24 of the fabA-OE sample was significantly higher than that of the control. This indicates that the rhamnolipid obtained by increasing FabA expression had excellent emulsification efficiency at high concentrations.

[0110] ΔrhlC / ΔfabA-sup: The emulsifying performance decreased slightly. At 500 mg / L, the E24 of this sample was approximately 70% - 75%, slightly lower than that of the control and other modified samples. This means that the deletion of fabA weakened the emulsification of rhamnolipid, and a higher dose was required to achieve the same effect.

[0111] ΔrhlC / ΔfabZ-sup: The emulsifying ability was improved compared to the control. At 500 mg / L, the E24 could reach about 90%, which was better than 85% of the control. At 250 mg / L, its E24 was also slightly higher than that of the control. This shows that the rhamnolipid with reduced FabZ function had a certain enhancement in emulsification performance at high concentrations.

[0112] ΔrhlC / fabZ-OE: The emulsification curve was close to that of the control. At 500 mg / L, the E24 was approximately 80% - 85%, almost equivalent to that of the unmodified ΔrhlC rhamnolipid, showing no obvious advantage or disadvantage.

[0113] Combined with the fatty acid composition analysis, it can be seen that the difference in emulsification performance was closely related to the fatty acyl chain structure of rhamnolipid.

[0114] 5. Surface Tension and Critical Micelle Concentration (CMC) Tests of Rhamnolipid Products

[0115] The crude rhamnolipid samples of each strain were prepared into a stock solution of 100 mg / L with deionized water. Starting from this, the sample solution was serially diluted to prepare a series of concentrations (100, 50, 25, 12.5, 6.25, 3.13 mg / L). The equilibrium surface tension values of the samples at each concentration were measured using a surface tensiometer. By plotting a curve with the surface tension σ as the vertical axis and the concentration as the horizontal axis, it can be observed that as the concentration decreased, σ gradually increased and finally approached the surface tension of pure water. By determining the concentration corresponding to the inflection point of the plateau where the surface tension began to level off in the curve, the CMC value of the sample could be obtained.

[0116] The results are as Figure 6As shown, the surface tension curves of each rhamnolipid sample are typically two-stage: the surface tension rapidly decreases at high concentrations, and after reaching a certain critical concentration, the rate of decrease significantly becomes smaller, and the curve tends to flatten. The CMC results obtained by the double-line intersection method are as follows:

[0117] Control ΔrhlC: CMC ≈ 14.53 mg / L. This is a typical critical micelle concentration level of single rhamnolipid.

[0118] ΔrhlC / ΔfabA-sup: CMC ≈ 21.24 mg / L. It is significantly increased by about 46% compared with the control, indicating that this sample requires a higher concentration to form micelles, that is, its efficiency of reducing surface tension becomes worse.

[0119] ΔrhlC / fabA-OE: CMC ≈ 16.20 mg / L. It is slightly higher than the control, but significantly lower than the fabA-deficient sample. This shows that although the composition of the overexpressed product of fabA has changed, its surface activity is still close to the normal level.

[0120] ΔrhlC / ΔfabZ-sup: CMC ≈ 15.80 mg / L. It is very close to the control (14.53), with almost no obvious difference. This indicates that although the fatty chain composition of the fabZ-deficient product has changed, its ability to reduce surface tension has not been greatly negatively affected and still belongs to the category of highly efficient surfactants.

[0121] ΔrhlC / fabZ-OE: CMC ≈ 22.44 mg / L. It is the highest among all samples, about 54% higher than the control. This reflects that the critical concentration for this sample to form micelles has increased significantly, and the surface activity efficiency is the worst. Considering the bimodal situation of its rhamnolipid composition, the excessive diversification of fatty chains makes it difficult for molecules to cooperate to form a stable micelle core, which is the reason for the increase in CMC.

[0122] The trend of the CMC test results is basically consistent with the results of the emulsifying performance detection: the deletion of fabA and the overexpression of fabZ lead to a decrease in the efficiency of reducing surface tension (an increase in CMC), corresponding to poor emulsifying performance; while the overexpression of fabA and the deletion of fabZ maintain a low CMC (close to the unmodified control), corresponding to good or improved emulsifying performance. This further proves that the changes in the fatty acyl chain structure of rhamnolipids caused by regulating fabA and fabZ have a direct causal relationship with the functional performance of rhamnolipid products as surfactants.

[0123] The embodiments described above are only descriptions of the preferred embodiments of the present invention, and do not limit the scope of the present invention. Without departing from the design spirit of the present invention, various deformations and improvements made by those of ordinary skill in the art to the technical solutions of the present invention shall fall within the protection scope determined by the claims of the present invention.

Claims

1. Use of genes related to fatty acid synthesis in improving the properties of rhamnolipids, characterized in that, The fatty acid synthesis-related genes include the fabA gene and the fabZ gene; The method for improving the properties of rhamnolipids is to change the structural composition of rhamnolipids produced by bacteria by regulating the expression of the fabA gene and / or the fabZ gene in the bacteria, thereby improving the properties of rhamnolipids.

2. The application according to claim 1, characterized in that, The bacteria include Pseudomonas aeruginosa.

3. A method for improving the performance of rhamnolipid, characterized in that, It includes the step of knocking out the fabZ gene in the bacteria to increase the emulsifying property of rhamnolipids; Or, it includes the step of overexpressing the fabA gene in the bacteria by genetic transformation technology to increase the emulsifying property of rhamnolipids.

4. The method according to claim 3, characterized in that, The bacteria include Pseudomonas aeruginosa.

5. Rhamnolipids prepared by using the method described in claim 3 or 4.

6. Use of the rhamnolipids described in claim 5 as an emulsifier for emulsifying an oil-water system.

7. Use of the rhamnolipids described in claim 5 in the preparation of a detergent.

8. Use of the rhamnolipids described in claim 5 in the preparation of a biosurfactant.

Images