Application of soybean Rubisco activating enzyme coding gene GmRCA03

Abstract

The invention discloses an application of a coding gene GmRCA03 of a soybean Rubisco activating enzyme. The invention further discloses application of the soybean Rubisco activating enzyme encoding gene GmRCA03 as shown in SEQ ID NO.1 in genetic engineering modification of the photosynthetic rate and the seed yield of soybeans. Through overexpression of the GmRCA03 gene, the photosynthetic rate and the seed yield of soybeans can be improved. Mutation of the gene reduces the photosynthetic rate and seed yield of soybean. The overexpressed GmRCA03 gene reduces the lodging rate and improves the photosynthetic rate seed yield in a soybean and corn strip-shaped composite planting mode. The soybean Rubisco activating enzyme coding gene GmRCA03 disclosed by the invention can be transformed into soybeans through genetic engineering, and finally, the photosynthetic rate and the seed yield of the soybeans are positively regulated and controlled.

Description

Technical Field

[0001] The present invention relates to the application of the soybean Rubisco activase encoding gene GmRCA03, and belongs to the field of genetic engineering. Background Art

[0002] Soybeans originated in China, are rich in vegetable oils and vegetable proteins, and are one of the top five crops in the world. As a C3 crop, the photosynthetic rate of soybeans is relatively low compared to C4 crops. Improving its photosynthetic rate is of great significance for increasing soybean yield. Photosynthesis is the fundamental source of life substances and energy, laying a solid foundation for the development of crop biomass and yield. Ribulose-1,5-bisphosphate carboxylase / oxygenase (Rubisco), as the key rate-limiting enzyme that determines the carbon assimilation efficiency in photosynthesis, plays a crucial role. However, the catalytic rate of Rubisco is relatively low and it is easily inhibited by intracellular metabolites and environmental factors. Rubisco activase (RCA) is responsible for catalyzing and maintaining Rubisco in an active state. RCA induces a conformational change in Rubisco by means of the energy generated by ATP hydrolysis, prompting the opening of its catalytic site. This process triggers the release of inhibitory sugar phosphate derivatives, thereby increasing the activity of Rubisco. Therefore, RCA is regarded as a very promising target for improving carbon dioxide fixation and increasing plant productivity.

[0003] To date, three types of RCA have been identified, namely the green type, the red type (also known as CbbX), and the CbbQO type. All three types of RCA belong to the AAA+ superfamily (ATPases related to various cellular activities). The green type of RCA is widely present in all higher plants, algae, and cyanobacteria. The red type of RCA specifically appears in red lineage phytoplankton and proteobacteria. The CbbQO type of RCA is widely distributed in chemolithoautotrophic proteobacteria. These three RCA types are significantly different in their primary sequences and mechanisms, indicating convergent evolution among them. In plants, RCA is encoded by the nucleus and synthesized in the cytoplasm. Subsequently, it is transported to the chloroplast with the assistance of a transit peptide at its N-terminus, which is cleaved upon entering the plastid. Most plants have two RCA isoforms, namely the longer α-isoform and the shorter β-isoform. These two isoforms differ only at the C-terminus. Specifically, unlike the β-isoform, the α-isoform has a C-terminal extension containing a redox-sensitive Cys residue. Both isoforms contain two conserved ATP-binding domains, where GGKGQGKS plays a key role in Rubisco activation and ATP hydrolysis, while LFIND is related to subunit aggregation. We found that overexpressing the soybean Rubisco activase-encoding gene GmRCA03 can increase the photosynthetic rate and seed yield of soybeans, and mutating this gene reduces the photosynthetic rate and seed yield of soybeans. The excellent haplotype of the GmRCA03 gene has a high photosynthetic rate, high 100-seed weight, and seed yield. This finding provides a basis for future high photosynthetic efficiency and high-yield breeding of soybeans. Summary of the Invention

[0004] The object of the present invention is to disclose the genetic engineering application of the soybean Rubisco activase-encoding gene GmRCA03.

[0005] The object of the present invention can be achieved by the following technical solutions:

[0006] Any one or more of the following applications of the soybean Rubisco activase-encoding gene GmRCA03 shown in SEQ ID NO.1: (A1) Application in increasing the photosynthetic rate of soybeans;

[0007] (A2) Application in increasing seed yield;

[0008] (A3) Reducing the lodging rate of soybeans.

[0009] The above applications are achieved by overexpressing the GmRCA03 gene.

[0010] Any one or more of the following applications of the recombinant expression vector overexpressing the soybean Rubisco activase-encoding gene GmRCA03:

[0011] (B1) Application in improving the photosynthetic rate of soybeans;

[0012] (B2) Application in increasing seed yield;

[0013] (B3) Reducing the lodging rate of soybeans.

[0014] This gene is mainly expressed in soybean leaves and hardly expressed in other tissues. Subcellular localization analysis shows that GmRCA03 is localized in chloroplasts, while GmRCA03 without the N-terminal transit peptide is localized in the cytoplasm. Overexpression of GmRCA03 can improve the photosynthetic rate and seed yield of soybeans, and mutating this gene reduces the photosynthetic rate and seed yield of soybeans. The excellent haplotype of GmRCA03 has a high photosynthetic rate, high 100-seed weight and seed yield.

[0015] Beneficial effects

[0016] GmRCA03 is a soybean Rubisco activase gene, and its family is involved in the activation of Rubisco protein in plants. In soybeans, we found that GmRCA03 positively regulates the photosynthetic rate and seed yield of soybeans. Through expression analysis, it is proved that GmRCA03 is mainly expressed in soybean leaves. Through subcellular localization analysis, it is proved that GmRCA03 is localized in chloroplasts, while GmRCA03 without the N-terminal transit peptide is localized in the cytoplasm. At the same time, through functional verification, it is found that this gene positively regulates the photosynthetic rate and seed yield of soybeans. Therefore, GmRCA03 can be used as a target for regulating the photosynthetic rate and seed yield of soybeans, and is used for high photosynthetic efficiency and high-yield breeding of soybeans. Description of the drawings

[0017] Figure 1 . Agarose gel electrophoresis map after PCR cloning of GmRCA03. The size of the target fragment is 1425 bp. Marker: DL2000.

[0018] Figure 2 . Tissue expression pattern of GmRCA03. N = 3.

[0019] Figure 3 . Subcellular localization analysis of GmRCA03 protein and GmRCA03 protein without the N-terminal transit peptide. GFP, GFP fluorescence; Chloroplast, chloroplast autofluorescence; Merge, fusion protein; 35S-GFP, empty vector control; 35S:GmRCA03-GFP, GmRCA03 protein with GFP tag; 35S:GmRCA03(-)-GFP, GmRCA03 protein without the N-terminal transit peptide with GFP tag. Scale bar: 10 μm.

[0020] Figure 4. Overexpression of GmRCA03 increases the photosynthetic rate and seed yield of soybean. (A) Representative plant photos of wild-type (Jack), GmRCA03 overexpression lines OE-15 and OE-17 under field conditions. Scale bar = 10 cm. (B) Representative plant photos of wild-type (Jack), OE-15 and OE-17 under field conditions at the harvest stage. Scale bar = 10 cm. (C)-(E) Comparison of net photosynthetic rate (C), 100-seed weight (D), and seed yield per plant (E) of wild-type, OE-15 and OE-17 lines under field conditions in 2019, 2021 (D), and 2023 (E). (F) Comparison of seed yield per unit plot of wild-type (Jack), OE-15 and OE-17 plants under field conditions in 2023. The significance test was Duncan's multiple test, and different letters represent significant differences at P<0.05. Standard error of the mean (SEM).

[0021] Figure 5 . Mutation of GmRCA03 reduces the photosynthetic rate and seed yield of soybean. (A) Structure of the GmRCA03 gene and mutation positions of two mutants, gmrca03-1 and gmrca03-2. (B) Representative plant photos of wild-type (W82), gmrca03-1 and gmrca03-2 under field conditions. Scale bar = 10 cm. (C) Representative plant photos of wild-type (W82), gmrca03-1 and gmrca03-2 under field conditions at the harvest stage. Scale bar = 10 cm. (D) Comparison of net photosynthetic rate among wild-type (W82), gmrca03-1 and gmrca03-2 plants. (E) Comparison of seed yield per plant among wild-type (W82), gmrca03-1 and gmrca03-2 plants. Two-tailed test, **: P<0.01; ***: P<0.001. Error bars indicate ±SEM.

[0022] Figure 6 . Overexpression of GmRCA03 reduces the lodging rate and increases the photosynthetic rate and seed yield in the soybean-corn strip intercropping pattern. (A), (B) Comparison of net photosynthetic rate (A) and seed yield per plant (B) between wild-type (Jack) and GmRCA03 overexpression line OE-17 in the soybean-corn strip intercropping pattern. (C) Comparison of lodging rates of Jack and OE-17 at four stages in the soybean-corn strip intercropping pattern. 1, 2, 3, and 4 represent V6, R2, R4, and R6 stages, respectively. Two-tailed test, *: P<0.05; **: P<0.01. Error bars indicate ±SEM. Detailed implementation manners

[0023] The present invention will be further described below in conjunction with the accompanying drawings and embodiments.

[0024] Unless otherwise specified, the methods used in the following examples are all conventional methods.

[0025] Example 1

[0026] 1) Cloning of soybean Rubisco activase gene GmRCA03

[0027] Taking the soybean variety Kefeng No. 1 as the research object, its leaves were ground, and the ground sample was added to a 1.5 mL EP tube containing lysis buffer. After sufficient oscillation, it was transferred to another 1.5 mL EP tube to extract total RNA (using Total RNA Kit, Tiangen, Beijing, China). The quality of the total RNA was identified by formaldehyde denaturing gel electrophoresis, and the RNA content was measured using a spectrophotometer. Using the obtained total RNA as a template, reverse transcription was carried out according to the instructions of the reverse transcription kit (TaKaRa Primer Script TM RT reagent kit, Japan) provided by TaKaRa Company, Japan, to synthesize the first strand of cDNA. Subsequently, PCR amplification was carried out, and the program was as follows: pre-denaturation at 95 °C for 3 minutes; denaturation at 95 °C for 15 seconds; annealing at 58 °C for 15 seconds; extension at 72 °C for 45 seconds, for a total of 35 cycles; finally, incubation at 72 °C for 5 minutes, and then cooled to 4 °C for constant temperature, so as to obtain the cDNA of Kefeng No. 1.

[0028] From the NCBI database and the Phytozome v13 soybean database, the gene corresponding to GmRCA03 (Glyma.03g068100, Gene ID: 100795298) was found. Specific primers were designed according to the nucleotide sequence provided by the database, and the primer sequences were F1: atgacagatcctcagtccaattt and R1: tcacattgaactctccccatcatgt. This gene was amplified from the gene coding sequence (CDS) of the soybean variety Kefeng No. 1, and PCR cloning was carried out. Subsequently, the PCR product was subjected to gel cutting purification, ligation and transformation operations, and positive monoclonal colonies were picked for sequencing. Finally, the CDS sequence of the soybean GmRCA03 gene with a complete coding region was obtained, with a length of 1425 bp, and the coding region sequence is shown in SEQ ID NO.1, with a size of 1425 bp ( Figure 1 ), and the amino acid sequence is shown in SEQ ID NO.2.

[0029] 2) Tissue expression analysis of GmRCA03

[0030] To identify the expression levels of GmRCA03 in different tissues, we collected root, stem, leaf, flower, pod, and seed samples of the soybean variety Kefeng No. 1 at different developmental stages. Among them, roots, stems, and leaves were at the V4 stage; mature flowers were at the R2 stage; while seeds and pods were collected 15 days after flowering. All samples were snap-frozen in liquid nitrogen and stored at -80 °C. Total RNA was extracted according to step 1. Using the total RNA obtained from each of the above tissues as a template, cDNA was reverse-transcribed. The primer sequences for quantitative fluorescence of the GmRCA03 gene are shown as F2: ctcagagaggcccttcctct and R2: cctctacaacatttgaggaggg. When detecting the changes in the expression level of the GmRCA03 gene in each tissue, the soybean internal reference gene Tubulin was used as an internal reference, and its primer sequences are shown as F3: ggagttcacagaggcaga and R3: cacttacgcatcacatagca, and then a real-time fluorescence quantitative PCR reaction (Real-time RT-PCR) was carried out.

[0031] GmRCA03 was mainly expressed in soybean leaves, and its expression levels in roots, stems, flowers, pods, and seeds were relatively low ( Figure 2 ), indicating that GmRCA03 might play a role in leaves.

[0032] Example 2

[0033] 1) Cloning of the soybean Rubisco activase gene GmRCA03

[0034] Using the total RNA of the leaves of the soybean variety Kefeng No. 1 as a template, after reverse transcription to synthesize the first strand of cDNA, PCR amplification was carried out. The primer sequences are shown in F4: acaaatctat ctctctcgag atggccgcct cagtaccaa and R4: gctcaccatggatccaaatt tgtatgtgca gcttccatc. The procedure is as follows: pre-denaturation at 95°C for 3 minutes; denaturation at 95°C for 15 seconds; annealing at 58°C for 15 seconds; extension at 72°C for 45 seconds, for a total of 35 cycles; finally, incubation at 72°C for 5 minutes, and then cooled to 4°C for constant temperature. After sequencing, the CDS sequence of the soybean GmRCA03 gene without a stop codon was obtained. In addition, using the primer sequences F5: acaaatctat ctctctcgag atgcaatgtg agcttgtctt tgcc and R4: gctcaccatggatccaaatttgtatgtgca gcttccatc, through PCR reaction, the GmRCA03 gene sequence without a stop codon and without the N-terminal transit peptide [named GmRCA03(-)] was obtained. The PCR procedure is as follows: pre-denaturation at 95°C for 3 minutes; denaturation at 95°C for 15 seconds; annealing at 58°C for 15 seconds; extension at 72°C for 30 seconds, for a total of 35 cycles; finally, incubation at 72°C for 5 minutes, and then cooled to 4°C for constant temperature.

[0035] 2) Construction of subcellular localization vector

[0036] In the process of constructing the subcellular localization vector, the CDS sequence of the soybean GmRCA03 gene without a stop codon and GmRCA03(-) were inserted into the pAN580 expression vector containing the GFP tag. This vector is equipped with a 35S promoter, which can effectively induce the expression of the target gene GmRCA03 in the receptor. At the same time, the empty vector pAN580 was used as a control group.

[0037] 3) Subcellular localization of GmRCA03

[0038] The 35S:GmRCA03-GFP, 35S:GmRCA03(-)-GFP and 35S:GFP vectors were transformed in Escherichia coli, and then the plasmids were extracted in large quantities. The plasmids were respectively transformed into Arabidopsis protoplasts. After culturing for 12 - 18 hours, the localization of the reporter gene GFP was observed with a Leica TCS SP2 type laser confocal microscope. The GFP signal showed that the GmRCA03-GFP fusion protein was localized in the chloroplast, the GmRCA03(-)-GFP fusion protein was localized in the cytoplasm, and the empty vector was localized in the whole tobacco cell ( Figure 3 ).

[0039] Example 3 Genetic engineering application of the gene GmRCA03

[0040] 1) Cloning of the Soybean Rubisco Activase Gene GmRCA03

[0041] Using the total RNA of the leaves of the soybean variety Kefeng No. 1 as a template, after reverse transcription to synthesize the first strand of cDNA, PCR amplification was carried out. The primer sequences are shown in F4: acaaatctatctctctcgag atggccgcctcagtaccaa and R4: gctcaccatggatccaaatttgtatgtgcagcttccatc. The procedure is as follows: pre-denaturation at 95°C for 3 minutes; denaturation at 95°C for 15 seconds; annealing at 58°C for 15 seconds; extension at 72°C for 45 seconds, for a total of 35 cycles; finally, incubation at 72°C for 5 minutes, and then cooled to 4°C for constant temperature. After sequencing, the CDS sequence of the soybean GmRCA03 gene with a complete coding region was obtained, and its sequence is shown in SEQ ID NO.1.

[0042] 2) Construction of the Plant Expression Vector

[0043] When constructing the gene overexpression vector, the coding sequence of GmRCA03 containing the complete ORF was inserted into the D60003 vector (Dabeinong Group) to obtain the recombinant vector D60003-GmRCA03. The specific primer sequences required for the PCR reaction are the same as those in step 1) of Example 1.

[0044] 3) Creation of GmRCA03 Overexpressing Soybeans

[0045] 1. The cotyledon node transformation method was used to transform the soybean cultivar Jack. First, the axils of soybeans grown for 5 - 6 days were wounded, and then the GmRCA03 overexpression vector obtained in step 2 was inoculated at the wound at the axil of the soybean leaf, and co-cultured at 25°C for 4 - 5 days. Subsequently, the samples were washed with sterilized ultrapure water and Wish-Liquid respectively, and placed in the SIM medium without glufosinate, and cultured under light conditions at 26°C for 15 days to induce bud emergence. After 15 days, the samples were transferred to the SIM medium supplemented with 6 mg / L glufosinate. Thereafter, subculture was carried out every 15 days, and the dose of glufosinate was gradually reduced. When the buds on the explants grew to about 6 cm, they were transferred to the rooting medium and cultured for about 10 days to induce root development. After the roots grew sufficiently, transplantation could be carried out. The leaves of the transgenic plants were taken to extract DNA. The transgenic plants were detected using the overexpression identification primers F6: gctcctacaa atgccatcattgc, and R6: tcacattgaactctccccatcatgt.

[0046] 4) Increase in the Photosynthetic Rate and Seed Yield of GmRCA03 Overexpressing Soybeans

[0047] We selected two independent overexpression lines, OE-15 and OE-17, for phenotypic investigation. Compared with the wild type (WT) Jack, under pot conditions in 2019, field conditions in 2021, and field plot conditions in 2023, the net photosynthetic rates of OE-15 and OE-17 lines increased significantly by 6.2% and 9.6%, 9.3% and 14.3%, 6.9% and 10.3%, respectively. Phenotypic evaluation of agronomic traits showed that GmRCA03 overexpressing plants generally grew better than the WT. Additionally, overexpression of GmRCA03 significantly increased the 100-seed weight, seed yield per plant, and plot yield ( Figure 4 ).

[0048] Example 4 Genetic engineering application of gene GmRCA03

[0049] The GmRCA03 gene mutant soybean seeds were sourced from the iSoybean soybean mutant library (http: / / isoybean.org). This mutant library was obtained by the research group of Professor Song Qingxin from Nanjing Agricultural University through ethylmethane sulfonate (EMS) mutagenesis. We selected two homozygous mutant lines for further study, named gmrca03-1 and gmrca03-2 respectively. These plants were grown at the Liuhe Experimental Base of Jiangsu Academy of Agricultural Sciences. At the R2 stage, the photosynthetic rate was measured using a LI-6800XT photosynthesis meter; the yield per plant was investigated at the mature stage. Under field conditions, the gmrca03 mutants showed weaker growth vigor than the WT. The phenotypic analysis results showed that the gmrca03 mutants significantly reduced the photosynthetic rate and seed yield. The research results indicated that the mutation of the GmRCA03 gene decreased the photosynthetic rate and seed yield of soybeans ( Figure 5 ).

[0050] Example 5 Genetic engineering application of gene GmRCA03

[0051] The wild type control Jack and the GmRCA03 overexpressing material OE-17 were planted at the Liuhe Transgenic Experimental Base of Jiangsu Academy of Agricultural Sciences. The row ratio of corn to soybean was 2:2, the large row was 1.6 meters wide, the small row was 0.4 meters wide, the spacing between corn and soybean was 60 centimeters, and the plant spacing of corn was 13 - 14 centimeters. The selected corn variety was "Zhengdan 958". The lodging rate was investigated at the V6, R2, R4, and R6 stages, the photosynthetic rate was measured at the R2 stage, and the yield per plant was investigated at the harvest stage. Compared with Jack, at the vegetative growth stage (V6) and the three reproductive growth stages (R2, R4, and R6), the OE-17 plants showed a lower lodging rate, and had a higher net photosynthetic rate and seed yield ( Figure 6 ).

Claims

1. Any one or more of the following applications of the soybean Rubisco activase-encoding gene GmRCA03 shown in SEQ ID NO.1: (A1) Application in improving the photosynthetic rate of soybeans; (A2) Application in increasing seed yield; (A3) Reducing the lodging rate of soybeans.

2. The application according to claim 1, characterized in that, The said application is achieved by overexpressing the GmRCA03 gene.

3. Any one or more of the following applications of the recombinant expression vector overexpressing the soybean Rubisco activase-encoding gene GmRCA03 described in claim 1: (B1) Application in improving the photosynthetic rate of soybeans; (B2) Application in increasing seed yield; (B3) Reducing the lodging rate of soybeans.

Images