Application of cotton GhMYB44A05 gene in improvement of cotton fiber quality
By overexpressing the cotton transcription factor GhMYB44_A05 gene, the problem of improving cotton fiber quality, especially the fiber length and strength, is solved, and the cultivation of high-fiber quality cotton is achieved.
Patent Information
- Application Number
- CN202510643527.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-19
- Publication Date
- 2025-07-18
AI Technical Summary
The prior art is difficult to effectively improve the quality of cotton fibers, especially the fiber length and strength, which affects the high-quality cultivation of cotton.
The cotton transcription factor GhMYB44_A05 gene is overexpressed through transgenic technology, and its dominant expression in the period of fiber elongation and thickening and late ovule development can be improved to improve its expression or protein activity in cotton and promote the increase of fiber length and strength.
It significantly improves the length and strength of cotton fibers, promotes the cultivation and development of high-fiber quality cotton varieties, and has important industrial value.
Smart Images

Figure CN120330249A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical fields of biotechnology and genetic breeding technology, and particularly relates to the application of cotton GhMYB44_A05 gene in improving cotton fiber quality. Background Art
[0002] Cotton is an important economic crop in China. Cotton fiber is an important raw material for the textile industry. Improving cotton fiber quality has always been the breeding goal of cotton researchers. Cotton fiber differentiates from ovule epidermal cells and is considered to be one of the longest single cells. Cotton fibers can be divided into two categories. One is the long lint fibers that differentiate from ovule epidermal cells starting from 0 - 3 days after flowering, and the other is the fuzz fibers that start to differentiate and develop 5 - 10 days after flowering and attach to the seeds. According to the developmental stage, cotton fiber development includes the following five stages: initiation period (-3 - 5 DPA), rapid elongation period (3 - 18 DPA), transition period from primary cell wall to secondary cell wall thickening (16 - 20 DPA), secondary cell wall thickening period (20 - 40 DPA), and dehydration and maturation period (40 DPA). MYB transcription factors play important regulatory roles in all stages of cotton fiber development.
[0003] Studies have shown that the MYB family participates in all stages of cotton fiber development. For example, GhMYB109, GhMYB25, GhMML3 / GhMYB25 - like, and GhMML4 positively regulate the processes of cotton fiber initiation and early elongation, GhMYB4 negatively regulates fiber elongation, GhMYB30D04 positively regulates fiber elongation, GhMYB102 positively regulates fiber elongation and secondary cell wall thickening processes, etc. Therefore, further studying the regulatory role of MYB family proteins on cotton fibers is beneficial to cultivating cotton varieties with high fiber quality. Summary of the Invention
[0004] The present invention provides the application of a transcription factor GhMYB44_A05 related to improving cotton fiber quality in improving cotton fiber quality. According to the expression profile of Gossypium hirsutum TM - 1, the transcription factor GhMYB44_A05 (Ghir_A05G026680) located on chromosome ChrA05 was screened out. This gene is highly expressed during the fiber elongation and thickening periods and in the late stage of ovule development. The function of this gene was analyzed by transgenic technology. The results show that overexpression of the GhMYB44_A05 gene can improve cotton fiber quality, especially cotton fiber length and strength, and promote the cultivation and development of cotton varieties with high fiber quality.
[0005] The present invention provides the application of the GhMYB44_A05 gene, the protein encoded thereby, an expression cassette containing the gene, a recombinant vector, a transgenic cell line, or a recombinant bacterium in any of the following:
[0006] A1) Regulating the quality of cotton fibers;
[0007] A2) Preparing products for regulating the quality of cotton fibers;
[0008] A3) Promoting the length and / or strength of cotton fibers;
[0009] A4) Preparing products for promoting the length and / or strength of cotton fibers;
[0010] A5) Cultivating cotton varieties with high fiber quality;
[0011] A6) Preparing products for cultivating cotton varieties with high fiber quality;
[0012] Wherein, the amino acid sequence encoded by the GhMYB44_A05 gene is as shown in SEQ ID NO.2.
[0013] Furthermore, the nucleotide sequence of the GhMYB44_A05 gene is as shown in SEQ ID NO.1.
[0014] Furthermore, the fiber quality includes fiber length and / or fiber strength.
[0015] Furthermore, the expression level or functional activity of the GhMYB44_A05 gene or its encoded protein in cotton is increased, thereby significantly promoting the increase in the length and / or strength of cotton fibers.
[0016] The present invention also provides a method for increasing the length and / or strength of cotton fibers, comprising the step of increasing the expression level or protein activity of the GhMYB44_A05 gene in recipient cotton, and the nucleotide sequence of the GhMYB44_A05 gene is as shown in SEQ ID NO.1.
[0017] Furthermore, construct an overexpression vector of the GhMYB44_A05 gene and introduce it into recipient cotton to obtain transgenic cotton materials.
[0018] Furthermore, the transgenic cotton materials exhibit higher fiber length and / or fiber strength compared to the recipient cotton.
[0019] The present invention also provides a method for cultivating cotton germplasm with high fiber quality, including enhancing, increasing or upregulating the expression level of the GhMYB44_A05 gene or the function or activity of its protein in recipient cotton, thereby obtaining cotton germplasm with significantly better fiber quality than the recipient material, and the nucleotide sequence of the GhMYB44_A05 gene is as shown in SEQ ID NO.1.
[0020] Furthermore, an overexpression vector of the GhMYB44_A05 gene was constructed and introduced into recipient cotton to obtain transgenic cotton materials.
[0021] Furthermore, the transgenic cotton materials exhibited higher fiber length and / or fiber strength compared to the recipient cotton.
[0022] Compared with the prior art, the beneficial effects of the present invention are as follows: The present invention provides a transcription factor GhMYB44_A05 related to improving cotton fiber quality, and overexpresses the GhMYB44_A05 gene by using transgenic technology, clearly verifying its effect on cotton fiber quality, which can be used to cultivate new cotton germplasms with high fiber quality and has extremely high industrial value. BRIEF DESCRIPTION OF THE DRAWINGS
[0023] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings required for use in the embodiments will be briefly introduced below. It should be understood that the following drawings only show some embodiments of the present invention and should not be regarded as limiting the scope. For those of ordinary skill in the art, other related drawings can be obtained based on these drawings without creative efforts.
[0024] Figure 1 Expression analysis of the GhMYB44 gene in upland cotton. Among them, Figure A shows the expression profiles of the GhMYB44 gene in different cotton tissue parts of the upland cotton standard line TM-1, and the data are FPKM values. root: root; stem: stem; left: leaf; petal: petal; pistil: pollen; torus: receptacle; stamen: stamen; calycle: sepal; 5, 10, 20, and 25 DPA_Fiber: fibers at 5, 10, 20, and 25 days after flowering; -3, -1, 0, 1, 3, 5, 10, 20, 25, and 35 DPA_Ovule: ovules at -3, -1, 0, 1, 3, 5, 10, 20, 25, and 35 days after flowering; Figure B shows the RT-qPCR analysis of the GhMYB44_A05 gene in different tissue organs of upland cotton E22. Leaf: leaf; Stigma: stigma; Anther: anther; Petal: petal; 0, 10, 15, 20, 25, and 30 DPA_Ovule: ovules at 0, 10, 15, 20, 25, and 30 days after flowering; 5, 10, 15, 20, 25, and 30 DPA_Fiber: fibers at 5, 10, 15, 20, 25, and 30 days after flowering.
[0025] Figure 2 Subcellular localization analysis of GhMYB44_A05 in tobacco leaves.
[0026] Figure 3 For the construction map of the overexpression vector.
[0027] Figure 4 For the positive detection of OE-MYB44 transgenic materials. Figure A shows the PCR detection of the leaves of T0 generation OE-MYB44 transgenic materials. M, nucleic acid Marker; WT, Jin668; P, positive plasmid; 412, 425, 430, 437, 450, 459, 460, 461 and 466: transgenic materials; Figure B shows the detection of the expression level of 0DPA ovules of T1 generation OE-MYB44 transgenic positive lines, WT, Jin668; CK, transgenic negative lines; M-412, M-425, M-437, M-459, M-461, OM-46: transgenic positive lines; 3 biological replicates; ns, no significant difference, *p<0.05, ***p<0.001, t-test.
[0028] Figure 5 For the expression analysis of GhMYB44_A05 in fibers and the mature fiber length of overexpression materials. Figure A shows the detection of the expression level during the fiber development period in OE-MYB44 transgenic materials, 3 biological replicates, ns, no significant difference; **p<0.01, ***p<0.001, t-test. Figure B shows the mature fiber length. The scale bar is 1 cm. Detailed implementation manners
[0029] The following examples are only used to illustrate the technical solutions of the present invention more clearly, so they are only examples and cannot be used to limit the protection scope of the present invention. It should be noted that unless otherwise specified, the technical terms or scientific terms used in this application should be the common meanings understood by those skilled in the art to which the present invention belongs. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in this technical field. Unless otherwise specified, the reagents and materials used in the following examples are all commercially available.
[0030] Examples
[0031] 1. Cultivation of plant materials
[0032] Upland cotton E22 was planted in the experimental field of Huazhong Agricultural University to obtain samples of cotton fibers and cotton ovules from various tissues and organs and at different developmental stages. Tags were attached on the day of flowering (0 DPA), and cotton fibers and ovules were harvested at specific developmental stages, immediately frozen in liquid nitrogen, and stored at -80 °C for later use. Nicotiana benthamiana was planted in the greenhouse (25 °C / 16 h light, 20 °C / 8 h dark); transgenic materials were planted in the greenhouse (28 °C / 16 h light, 20 °C / 8 h dark). The transgenic and transgenic receptor materials Jin668 of the later generations were planted in Wuhan in 2024 to investigate the agronomic traits related to fiber quality.
[0033] 2. Identification of the cotton transcription factor GhMYB44_A05 gene
[0034] First, 19 GhMYB44 genes were identified in upland cotton. The expression profile data of GhMYB44 genes in 22 cotton tissues of upland cotton TM-1 were downloaded from the database CottonMD (Zhang et al., 2015), and the expression heatmap of these genes was generated using TBtools software. The results showed that the GhMYB44_A05 (Ghir_A05G026680) gene was predominantly expressed during cotton fiber development and in the later stage of ovule development, while the expression abundance in other parts was relatively low ( Figure 1 A).
[0035] In addition, previous studies have shown that (Xing K, etc. N 6N6-Methyladenosine mRNA modification regulates transcripts stability associated with cotton fiber elongation. (Plant J. 2023 Aug;115(4):967-985. doi: 10.1111 / tpj.16274. Epub 2023 May 23. PMID: 37158663.) Overexpression of the GhMYB44_D11 gene (Gh_D11G052400, corresponding to the gene ID Ghir_D11G005320 in the TM-1 genome assembled by Huazhong Agricultural University) inhibits cotton fiber elongation, while its silencing increases fiber length, that is, negatively regulates cotton fiber elongation. Phylogenetic tree analysis shows that GhMYB44_A05 and GhMYB44_D11 are divided into different branches, that is, although they belong to the same subfamily, there is a certain evolutionary distance, and it is speculated that more amino acid variations have accumulated during evolution, leading to functional differentiation. Further comparing the protein structures of GhMYB44_D11 and GhMYB44_A05 (Ghir_A05G026680), it is found that there are significant differences in their amino acid sequences, that is, there are differences in the N-terminal conserved domain (R2R3) between the two, which may lead to different key downstream genes / pathways targeted by the two, or recognition of different cis-regulatory elements or affect the binding ability to target genes; in addition, MYB transcription factors have a transcriptional activation / inhibition domain at the C-terminal, and differences in this region may also cause opposite transcriptional regulatory effects. Finally, expression profile analysis in Gossypium hirsutum TM-1 shows that their expression patterns are also different. Compared with GhMYB44_A05, GhMYB44_D11 is mainly highly expressed at the initial stage of ovule development and has a lower expression level in the whole tissue.
[0036] Finally, the GhMYB44_A05 gene was selected as a candidate gene for subsequent gene function verification.
[0037] Specific RT-qPCR primers RT-MYB44_A05-F / R (Table 1) were designed for the GhMYB44_A05 gene, and RT-qPCR primers GhUB7-F / R (Table 1) were designed using the cotton endogenous gene GhUBQ7 (Ghir_A11G011460) as an internal reference gene. The expression level of the GhMYB44_A05 gene in various tissue parts of Gossypium hirsutum E22 was analyzed by RT-qPCR. The results show that the GhMYB44_A05 gene is highly expressed in the middle and late stages of fiber development and the late stage of ovule development ( Figure 1 B).
[0038] For RNA extraction, the Tiangen Total RNA Extraction Kit (Tiangen Biochemical Technology, DP411) was used and the operation was carried out according to the product instruction manual.
[0039] The reverse transcription of RNA was as follows: Take 3 μg of RNA in a new 0.5 mL RNA centrifuge tube, add 1 μL of oligo(dT), then supplement DEPC water to 15 μL, mix well, incubate at 70 °C for 5 min in a reverse transcription instrument, and place on ice for 10 min. Then add the following reaction mixture (10 μL) in proportion: 5 μL of 5×MLV Buffer, 1.25 μL of 10 mmol / L dNTPs, 1 μL of Rnasin (40 U), 1 μL of M-MLV RTase (200 U), and make up to 25 μL with RNase free H2O. After mixing, place it in the reverse transcription instrument, and the program was as follows: 42 °C for 60 min, 70 °C for 15 min. After reverse transcription was completed, the cDNA was diluted to 250 μL and stored at -20 °C for standby.
[0040] The reaction system of RT-qPCR was: 8 μL of cDNA template (diluted 100 times from the stock solution), 6 μL of SybrGreen-mix (BIO-RAD), 0.5 μL of forward primer, 0.5 μL of reverse primer. Briefly centrifuge the prepared reaction system to ensure that the mixture was at the bottom of the PCR plate. Place it in a real-time fluorescence quantitative PCR instrument (ABIPrism 7500system), and the running program was as follows: Stage1: 95 °C for 30 s, 1 cycle; Stage2: 95 °C for 5 s, 60 °C for 35 s, 40 cycles. After the program was run, calculate the relative expression level of the gene.
[0041] 3. Subcellular localization analysis of GhMYB44_A05 protein
[0042] Obtain the sequence information related to the GhMYB44_A05 gene from the upland cotton reference genome TM-1. This gene has the full-length cDNA ORF nucleotide sequence shown in SEQ ID NO.1 and the amino acid sequence shown in SEQ ID NO.2. Using the full-length cDNA ORF nucleotide sequence of this gene as the reference sequence, it was constructed into the expression vector pGWB741 fused with GFP at the N-terminus. The schematic diagram of the subcellular localization vector construction was as Figure 2 shown in A. The results showed that the GhMYB44_A05 protein co-localized with the nuclear Marker protein ( Figure 2 B), and this protein was localized in the nucleus.
[0043] The process of constructing the subcellular localization vector was as follows:
[0044] Design primers BP-MYB44_A05-F / R with bp adapters (Table 1), and use the cDNA of 15DPA fibers of E22 as a template to amplify the full-length cDNA ORF sequence of the GhMYB44_A05 gene.
[0045] The PCR reaction system is 20 μL: 10 μL cDNA template, 7 μL ddH2O, 2 μL 10× LongTaq Buffer, 0.4 μL dNTP, 0.2 μL Forward / Reverse Primer, 0.2 μL LongTaq.
[0046] The PCR reaction program is: 95°C for 5 min; 95°C for 30 s, 57°C for 90 s, 72°C for 60 s, for 32 cycles; 72°C for 5 min. After PCR amplification, the correct GhMYB44_A05 coding region fragment containing the BP adapter is obtained, and then the BP ligation reaction is carried out.
[0047] The BP ligation reaction system is 5 μL: 1.5 μL ddH2O, 1 μL pDONERZeo (Zeo + ), 2 μL PCR product, 0.5 μL Gateway BP Clonase (Invitrogen, USA). The reaction condition is to place at 25°C for 4 h, transform into Escherichia coli strain Top10, and spread on the LB plate with Zeo + . Through monoclonal positive detection and sequencing, the positive detection primers are the M13 forward primer 5’CCCAGTCACGACGTTGTAAAACG 3’ and the reverse primer BP-MYB44_A05-R1. The positive strains are sent to Wuhan Qingke Biotechnology Co., Ltd. for sequencing. After obtaining the correct BP plasmid, the LR ligation reaction is carried out.
[0048] The LR reaction system is 5 μL: 2.5 μL ddH2O, 1 μL pGWB741 (Kan + ), 1 μL BP plasmid, 0.5 μL GatewayLR Clonase. The reaction condition is to place at 25°C for 4 h, transform into Escherichia coli strain Top10, and spread on the LB plate with Kan + . The pGWB741-MYB44_A05 recombinant plasmid is obtained.
[0049] The recombinant plasmid is transformed into Agrobacterium tumefaciens strain GV3101 by electroporation, and spread on the LB plate with Kan + and Rif + . Detect and pick positive strains for cotton genetic transformation.
[0050] The subcellular localization process is as follows:
[0051] The Agrobacterium tumefaciens transformed with the recombinant plasmid was injected into the tobacco epidermal cells, and after culturing for 48 - 72 h, GFP fluorescence was observed under a laser confocal microscope (Olympus, FV1200) to determine the subcellular localization position of the target protein.
[0052] The steps of Agrobacterium-mediated transient transformation of tobacco leaves are as follows:
[0053] Absorb the expression vector bacterial liquid and p19 bacterial liquid into the liquid LB medium supplemented with 50 μg / mL kanamycin rifampicin resistance, place it in a shaker at 28 °C for 12 - 14 h, and centrifuge at 5000 r / min for 5 min to collect the bacteria. Resuspend the bacteria with the suspension to an OD600 of 1, mix the expression vector bacterial liquid and p19 bacterial liquid in equal amounts and activate them in a shaker at 28 °C for 1 h. Use a 1 mL disposable syringe to inject the treated bacterial liquid into the back epidermal cells of tobacco that has grown for about one month. After the tobacco is covered with a black film and grown in the dark for 24 h, it is then cultured under normal light, and the fluorescence signal is observed within the range of 48 - 72 h after injection. Suspension formula: 10 mmol / L MgCl2, 10 mmol / L MES, 150 μmol / L AS (acetosyringone).
[0054] 4. Creation of overexpression materials of the GhMYB44_A05 gene
[0055] To explore the function of the GhMYB44_A05 gene, using the full-length cDNA ORF nucleotide sequence of this gene as the reference sequence, primers BP-MYB44_A05-F / R1 with bp adapters were designed (Table 1) to amplify the full-length cDNA ORF sequence of the GhMYB44_A05 gene, and it was ligated to the expression vector pGWB417 through BP-LR homologous recombination for the construction of the overexpression vector ( Figure 3 ).
[0056] Extract DNA from the leaves of the obtained overexpression T0 generation lines, and use the universal primer 35S-F on the vector and the reverse primer MYB44_A05-R of GhMYB44_A05 (Table 1) for PCR amplification to detect positive. A total of 6 positive single plants 412, 425, 430, 437, 450, 459, 460, 461, and 466 were obtained ( Figure 4 A). Take the ovule samples of the T1 generation positive plants at 0 DPA and detect the expression level of the target gene. Compared with the control, the expression levels of GhMYB44_A05 in the M-437, M-459, M-461, and M-466 lines were significantly increased ( Figure 4 B). Combining the field performance and seed harvesting of these lines, select the M-437 and M-461 lines for subsequent research, and name them OE-MYB44-1 and OE-MYB44-2 respectively.
[0057] DNA was extracted using the CTAB method. The specific steps are as follows:
[0058] Around 10 am on a sunny day, take about 0.1 g of fresh and tender leaves and place them in a 2 mL centrifuge tube on an ice box. After arranging them on ice, add steel beads and 200 μL of DNA extraction buffer one by one, and grind with a grinding machine for 60 s at a frequency of 60 Hz; adjust the water bath to 65 °C; add 600 μL of DNA extraction lysate and shake well; incubate in a 65 °C water bath for 30 min, gently invert the tube up and down every 10 min. Avoid strong shaking during this and subsequent steps; add an equal volume of chloroform:isopropanol (volume ratio 24:1), gently shake well and extract for 20 min to remove impurities such as pigments, centrifuge at 10000 r / min for 10 min at room temperature. Since there are steel beads, the centrifugation speed should not be too high; pipette 500 μL of the supernatant into a new tube, add an equal volume of isopropanol and mix well. At this time, a white flocculent precipitate is the crude DNA extract; pour off the supernatant, wash the flocculent precipitate twice with 75% alcohol and then air-dry, and dissolve it with 500 μL of TE Buffer for standby.
[0059] The PCR reaction system is 20 μL: 10 μL of cDNA template, 7 μL of ddH2O, 2 μL of 10×LongTaq Buffer, 0.4 μL of dNTP, 0.2 μL of Forward / Reverse Primer, 0.2 μL of LongTaq.
[0060] The PCR reaction program is: 95 °C for 5 min; 95 °C for 30 s, 57 °C for 90 s, 72 °C for 60 s, for 32 cycles; 72 °C for 5 min.
[0061] Table 1 Primer information used in the present invention
[0062]
[0063] 5. Investigation of the agronomic traits of OE-MYB44 transgenic materials
[0064] To detect the expression effect of OE-MYB44 transgenic materials in fibers, the expression levels of fibers at 10 DPA and 15 DPA of OE-MYB44-1 and OE-MYB44-2 lines were analyzed. The expression level of GhMYB44_A05 was significantly increased during the fiber development period ( Figure 5 A), and compared with the control, the mature fibers of OE-MYB44 transgenic materials were longer ( Figure 5 B).
[0065] Harvest mature cotton bolls from the middle part of wild-type WT, transgenic negative control CK, and transgenic plants in the field. Harvest 3 biological replicates for each line. The fiber quality indexes of mature cotton were measured using an HVI (High Volume Instrument) (HFT9000, Premier, India) instrument. The weight of the fiber sample for each replicate was 9.5 - 11 g. The fiber quality indexes included fiber length and fiber strength, as shown in Table 2.
[0066] Table 2 Fiber quality analysis of OE-MYB44 transgenic materials
[0067]
[0068] Three biological replicates were taken from each line for fiber quality determination. *p < 0.05, **p < 0.01, ***p < 0.001, t-test.
[0069] The results of fiber quality trait analysis of plants grown in Wuhan in 2024 showed that the fiber length and strength of OE-MYB44 transgenic materials were significantly increased compared with WT (Table 2). Therefore, it has important application value for improving cotton fiber quality, especially cotton fiber length and strength.
[0070] The above specific embodiments have described the implementation of the present invention in detail. However, the present invention is not limited to the specific details in the above embodiments. Within the scope of the claims and technical concept of the present invention, various simple modifications and changes can be made to the technical solutions of the present invention, and these simple variations all belong to the protection scope of the present invention.
Claims
1. Use of the GhMYB44_A05 gene, the protein encoded thereby, an expression cassette containing the gene, a recombinant vector, a transgenic cell line or a recombinant bacterium in any of the following: A1) Regulating the quality of cotton fibers; A2) Preparing a product for regulating the quality of cotton fibers; A3) Promoting the length and / or strength of cotton fibers; A4) Preparing a product for promoting the length and / or strength of cotton fibers; A5) Cultivating cotton varieties with high fiber quality; A6) Preparing a product for cultivating cotton varieties with high fiber quality; Among them, The amino acid sequence encoded by the GhMYB44_A05 gene is as shown in SEQ ID NO.
2.
2. The application according to claim 1, wherein The nucleotide sequence of the GhMYB44_A05 gene is as shown in SEQ ID NO.
1.
3. The application according to any one of claims 1-2, characterized in that, Fiber quality includes fiber length and / or fiber strength.
4. The application according to any one of claims 1-2, characterized in that, An increase in the expression level or functional activity of the GhMYB44_A05 gene or its encoded protein in cotton, thereby significantly promoting an increase in the length and / or strength of cotton fibers.
5. A method for increasing cotton fiber length and / or fiber strength, characterized in that, Comprising the step of increasing the expression level or protein activity of the GhMYB44_A05 gene in the recipient cotton, wherein the nucleotide sequence of the GhMYB44_A05 gene is as shown in SEQ ID NO.
1.
6. The method according to claim 5, characterized in that, Construct an overexpression vector of the GhMYB44_A05 gene and introduce it into the recipient cotton to obtain a transgenic cotton material.
7. The method according to claim 6, wherein The transgenic cotton material exhibits higher fiber length and / or fiber strength compared to the recipient cotton.
8. A method for cultivating cotton germplasm with high fiber quality, characterized in that, Including enhancing, increasing or upregulating the expression level of the GhMYB44_A05 gene or the function or activity of its protein in the recipient cotton, thereby obtaining cotton germplasm with significantly better fiber quality than the recipient material, wherein the nucleotide sequence of the GhMYB44_A05 gene is as shown in SEQ ID NO.
1.
9. The method according to claim 8, characterized in that, Construct an overexpression vector of the GhMYB44_A05 gene and introduce it into the recipient cotton to obtain a transgenic cotton material.
10. The method according to claim 9, wherein The transgenic cotton material exhibits higher fiber length and / or fiber strength compared to the recipient cotton.
Citation Information
Cited By
Application of cotton GhSAC7 protein in regulation and control of initial differentiation of cotton fibers
CN120485265A