Cathelicidin-1 protein and application thereof

Abstract

The invention relates to a preparation method of Cathelicidin-1 protein or Cathelicidin-1 fermentation liquor. The preparation method comprises the following steps: obtaining a yeast strain capable of secreting the Cathelicidin-1 protein; inoculating the saccharomycetes strain into a specific liquid culture medium; a yeast strain is fermented, and Cathelicidin-1 fermentation liquor is obtained; the fermentation broth comprises Cathelicidin-1 protein, and the Cathelicidin-1 protein is added into the fermentation broth; wherein the pH value of the specific culture medium is 6-7.4, the inoculum size of the saccharomycetes strain in the specific culture medium is 0.005-0.02 OD / mL, and the temperature of the fermentation saccharomycetes is 28-33 DEG C. The antibacterial peptide Cathelicidin-1 protein or Cathelicidin-1 fermentation liquor provided by the invention is simple in preparation method and high in yield, the immunity of fishes can be remarkably improved, and the survival rate of the fishes infected by pathogens is increased.

Description

Technical Field

[0001] The present invention relates to the field of biological medicine or food additives, and particularly to a Cathelicidin-1 protein and its applications. Background Art

[0002] With the widespread use of antibiotics, there have emerged an increasing number of multi-drug resistant bacteria, and the medical and health problems caused by them have become increasingly serious. The potential of traditional antibiotics has been exhausted and they cannot overcome the continuously developing multi-drug resistance of pathogenic bacteria. Therefore, there is an urgent need to discover and develop new treatment methods to overcome the widely reported phenomenon of antibiotic tolerance.

[0003] Infection by fish pathogens is a serious problem. Among them, zebrafish, as a model animal, its infection situation has attracted much attention. Fish pathogen infections are mainly divided into non-infectious diseases and infectious diseases. Infectious diseases pose a serious threat to the health of zebrafish and may trigger large-scale outbreaks or infections. Zebrafish may be infected by a variety of bacteria, such as Aeromonas veronii, Aeromonas hydrophila, Mycobacterium, etc. These bacteria can cause diseases such as fish tuberculosis and septicemia, causing serious harm to the health of zebrafish.

[0004] Antimicrobial peptides (AMPs) are a class of small peptides. Most of these small peptides are composed of 10-50 amino acid residues, rich in arginine, lysine, and histidine residues, and overall show a net positive charge. They are amphiphilic, containing hydrophobic and hydrophilic regions, and they play a key role in the innate immunity of the host against various pathogens including bacteria and fungi.

[0005] Cathelicidin-1 is an antimicrobial peptide isolated and identified from chickens by Xiao et al. in 2006. It is composed of 26 amino acids, has broad-spectrum antibacterial activity, can effectively inhibit the growth of a variety of bacteria, and also has good salt tolerance. It still has good antibacterial activity after treatment with 150 mM NaCl.

[0006] However, at present, the main sources of the antimicrobial peptide Cathelicidin-1 are natural extraction and chemical synthesis, with high costs and it is difficult to be put into practical applications. Summary of the Invention

[0007] In view of the technical problems existing in the prior art, the present invention provides a method for preparing Cathelicidin-1 protein or Cathelicidin-1 fermentation broth, comprising: obtaining a yeast strain capable of secreting Cathelicidin-1 protein; inoculating the yeast strain into a specific liquid medium; and fermenting the yeast strain to obtain Cathelicidin-1 fermentation broth; the fermentation broth contains Cathelicidin-1 protein; wherein, the pH of the specific medium is 6-7.4, the inoculation amount of the yeast strain in the specific medium is 0.005-0.02 OD / mL, and the fermentation temperature of the yeast is 28-33 °C.

[0008] The preparation method as described above, wherein the pH of the specific medium is 6.6.

[0009] The preparation method as described above, wherein the inoculation amount of the yeast strain in the specific medium is 0.01 OD / mL.

[0010] The preparation method as described above, wherein the fermentation temperature of the yeast is 30.3 °C.

[0011] The preparation method as described above, wherein the fermentation time of the yeast is 1-7 days; preferably 2-6 days; more preferably 3-4 days; further preferably 3 days.

[0012] A method for activating and / or enhancing the immune system of fish, comprising: administering a certain amount of Cathelicidin-1 protein or Cathelicidin-1 fermentation broth obtained by any of the above-mentioned preparation methods to the fish.

[0013] A method for preventing and / or treating pathogen infections in fish, comprising: administering a certain amount of Cathelicidin-1 protein or Cathelicidin-1 fermentation broth obtained by any of the above-mentioned preparation methods to the fish.

[0014] The method as described above, wherein the fish is zebrafish.

[0015] The method as described above, wherein the pathogen is Aeromonas veronii, Escherichia coli, Vibrio parahaemolyticus, Salmonella, Vibrio alginolyticus, Aeromonas schubertii or Pseudomonas aeruginosa.

[0016] Use of the Cathelicidin-1 protein or Cathelicidin-1 fermentation broth prepared by the above-described preparation method as a fish feed additive, wherein the amino acid sequence of the Cathelicidin-1 protein is: the amino acid sequence shown in SEQ ID NO.1; or the amino acid sequence with several amino acids added to and / or deleted from the N-terminus and / or C-terminus of the amino acid sequence shown in SEQ ID NO.1; or the amino acid sequence with several amino acids added, deleted or substituted on the amino acid sequence shown in SEQ ID NO.1.

[0017] In this application, a recombinant Pichia pastoris strain that can secrete the antimicrobial peptide Cathelicidin-1 is edited by genetic engineering. Subsequently, the antibacterial activity of the yeast fermentation broth containing the antimicrobial peptide is detected, and the antibacterial spectrum of the antimicrobial peptide fermentation broth is drawn. After determining its antibacterial effect, the fermentation conditions of the recombinant strain are optimized through response surface optimization experiments in order to obtain the best antibacterial effect. Then, through in-vivo experiments on zebrafish, a series of indexes such as immune-related enzyme activities are measured to identify its feasibility as an antibacterial additive for fish feed. Finally, the antibacterial mechanism of the antimicrobial peptide fermentation broth is preliminarily explored by PI staining combined with fluorescence observation and transmission electron microscopy to observe cell morphology. This application provides a reference for the development of new feed antibacterial additives.

[0018] The preparation method of the antimicrobial peptide Cathelicidin-1 protein or Cathelicidin-1 fermentation broth in this application is simple and has a high yield, which can significantly improve the immunity of fish and increase the survival rate of fish under pathogen infection. Brief Description of the Drawings

[0019] Next, the preferred embodiments of the present invention will be further described in detail with reference to the drawings, wherein:

[0020] Figure 1 It is an agarose gel electrophoresis diagram of the PCR amplification of Cathelicidin-1 according to an embodiment of the present invention; wherein, the M lane represents DL5000 DNA Marker; the 1 lane represents the Cathelicidin-1 gene;

[0021] Figure 2 It is a map of the pGAPZαA empty vector (A) and the pGAPZαA-Cathelicidin-1 recombinant vector (B) according to an embodiment of the present invention;

[0022] Figure 3 It is an agarose gel electrophoresis diagram of plasmid digestion verification according to an embodiment of the present invention, wherein the M lane represents DL5000 DNA Marker; the 1 lane represents the undigested plasmid; the 2 lane represents the digested plasmid;

[0023] Figure 4 It is the agarose gel electrophoresis pattern of the recombinant strain of antibacterial peptide Cathelicidin-1 identified by PCR according to an embodiment of the present invention; wherein, the M lane represents DL5000 DNA Marker; the 1st lane represents the positive control; the 2nd lane represents the negative control; the 3rd - 9th lanes represent the positive clones;

[0024] Figure 5 It is the agarose gel electrophoresis pattern of the recombinant yeast strain pGAPZαA-Cathelicidin-1 identified by PCR according to an embodiment of the present invention; wherein, the M lane represents DL5000 DNA Marker; the 1st lane represents the positive control; the 2nd lane represents the positive clone;

[0025] Figure 6 It is the comparison diagram of the sequencing results according to an embodiment of the present invention; wherein, Figure 6 A represents the start codon end of the open reading frame of the Cathelicidin-1 gene; Figure 6 B represents the stop codon end of the open reading frame of the Cathelicidin-1 gene;

[0026] Figure 7 It is the detection of the expression of excreted proteins in the fermentation broth by SDS-PAGE gel electrophoresis according to an embodiment of the present invention; wherein the M lane represents the small molecule protein Maker; the 1st lane represents the fermentation broth of the recombinant strain with empty plasmid; the 2nd lane represents the fermentation broth of the Cathelicidin-1 recombinant strain; the 3rd lane represents the fermentation broth of the ParasinⅠ recombinant strain;

[0027] Figure 8 It is the result of detecting the target excreted antibacterial peptide in the fermentation broth by Western Blot according to an embodiment of the present invention; wherein M: small molecule protein Maker; 1: fermentation broth of the recombinant strain with blank plasmid; 2: fermentation broth of the Cathelicidin-1 recombinant strain; 3: fermentation broth of the ParasinⅠ recombinant strain;

[0028] Figure 9 It is the change curve of the protein content in the fermentation broth at different fermentation times according to an embodiment of the present invention; different letters represent significant differences from each other (P < 0.05), the same below;

[0029] Figure 10 It is the bar graph of the antibacterial activity of the fermentation broth at different fermentation times according to an embodiment of the present invention;

[0030] Figure 11 It is the antibacterial curve of the Cathelicidin-1 fermentation broth against Aeromonas veronii according to an embodiment of the present invention;

[0031] Figure 12 The antibacterial curve of Cathelicidin-1 fermentation broth against Pseudomonas aeruginosa according to an embodiment of the present invention;

[0032] Figure 13 The antibacterial curve of Cathelicidin-1 fermentation broth against Vibrio parahaemolyticus according to an embodiment of the present invention;

[0033] Figure 14 The antibacterial curve of Cathelicidin-1 fermentation broth against pathogenic Escherichia coli according to an embodiment of the present invention;

[0034] Figure 15 The antibacterial curve of Cathelicidin-1 fermentation broth against Vibrio alginolyticus according to an embodiment of the present invention;

[0035] Figure 16 The antibacterial curve of Cathelicidin-1 fermentation broth against Cellulomonas schubertii according to an embodiment of the present invention;

[0036] Figure 17 The antibacterial curve of Cathelicidin-1 fermentation broth against Salmonella according to an embodiment of the present invention;

[0037] Figure 18 The time-killing curves of different antimicrobial peptides and antibiotics according to an embodiment of the present invention;

[0038] Figure 19 The response surface diagram and contour map of the antibacterial activity of Cathelicidin-1 fermentation broth according to an embodiment of the present invention. The functional relationship between antibacterial activity and pH and inoculum size (A); The functional relationship between antibacterial activity and inoculum size and temperature (B); The functional relationship between antibacterial activity and temperature and pH (C);

[0039] Figure 20 The optimization result of the antibacterial zone analysis by response surface method for Cathelicidin-1 fermentation broth according to an embodiment of the present invention;

[0040] Figure 21 The optimization result of the SDS-PAGE analysis by response surface method according to an embodiment of the present invention; wherein, M: small molecule protein Maker; 1: before optimization of Cathelicidin-1 fermentation broth; 2: after optimization of Cathelicidin-1 fermentation broth; 3: before optimization of ParasinⅠ fermentation broth; 4: after optimization of ParasinⅠ fermentation broth;

[0041] Figure 22is the remaining antibacterial activity of the fermentation broth after simulated gastric juice treatment according to an embodiment of the present invention, where "*": P < 0.05; "**": P < 0.01;

[0042] Figure 23 is the survival curve of zebrafish under different treatments according to an embodiment of the present invention;

[0043] Figure 24 is the bar chart of SOD (A) and AKP / ALP (B) enzyme activity detection according to an embodiment of the present invention; different letters represent significant differences from each other (P < 0.05), the same below;

[0044] Figure 25 is the bar chart of lysozyme enzyme activity detection according to an embodiment of the present invention;

[0045] Figure 26 is the bar chart of IgM content detection according to an embodiment of the present invention; and

[0046] Figure 27 is the observation of the cell membrane integrity of Aeromonas veronii after treatment with different fermentation broths by PI staining according to an embodiment of the present invention; where, A - B: the treatment group with empty vector fermentation broth; C - D: the treatment group with Cathelicidin - 1 fermentation broth;

[0047] Figure 28 is the observation of the cell morphology of Aeromonas veronii after treatment with fermentation broth by TEM according to an embodiment of the present invention; where, A - B: the treatment group with empty vector fermentation broth; C - D: the treatment group with Cathelicidin - 1 fermentation broth;

[0048] Figure 29 is the effect of different volumes of fermentation broth on the biofilm formation of Aeromonas veronii according to an embodiment of the present invention; different letters represent significant differences from each other (P < 0.05), the same below; and

[0049] Figure 30 is the effect of different volumes of fermentation broth on the formed biofilm of Aeromonas veronii. Detailed implementation manners

[0050] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings in the embodiments of the present invention. Obviously, the described embodiments are some, but not all, of the embodiments of the present invention. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts shall fall within the protection scope of the present invention.

[0051] In the following detailed description, reference is made to the various specification drawings that form a part of the present application and illustrate specific embodiments of the present application. In the drawings, like reference numerals describe generally similar components in different figures. The specific embodiments of the present application are described in sufficient detail below to enable those of ordinary skill in the relevant art and technology to implement the technical solutions of the present application. It should be understood that other embodiments may also be utilized or changes may be made to the embodiments of the present application.

[0052] As used herein, "antimicrobial peptide" refers to antimicrobial peptide, also known as AMP. It originally referred to a class of basic polypeptide substances with antibacterial activity induced in insects, with a molecular weight of about 2000 - 7000 and consisting of 20 - 60 amino acid residues. Most of these active polypeptides have characteristics such as strong basicity, thermal stability, and broad-spectrum antibacterial properties. In the years following 1980, polypeptides with antibacterial activity were successively discovered and isolated from bacteria, fungi, amphibians, insects, higher plants, mammals, and even humans.

[0053] Antimicrobial peptides have functions and effects such as anti-infection, anti-inflammation, immune regulation, promoting wound healing, and inhibiting the growth of tumor cells. Further, studies have shown that antimicrobial peptides play an anti-infection role by interfering with bacterial cell wall synthesis or destroying its structural integrity, thereby inhibiting the growth of pathogens. It is applicable to the treatment of infectious diseases caused by various bacteria. It can be administered by oral, injection, etc.; Antimicrobial peptides can directly neutralize endotoxins and induce macrophages to produce inflammatory mediators, thereby playing an anti-inflammatory role. It has a certain therapeutic effect on autoimmune diseases, etc.; Antimicrobial peptides can stimulate the body to produce natural killer cells and T lymphocytes, enhancing the body's immunity; Antimicrobial peptides can accelerate blood circulation around the wound, promote cell proliferation and tissue repair. It is applicable to improving the situation of non-healing chronic wounds accompanied by infection; Antimicrobial peptides can interfere with the tumor cell signaling pathway, blocking its growth and spread. It may have an adjuvant therapeutic effect on certain types of cancer.

[0054] Cathelicidin is an endogenous antimicrobial polypeptide substance produced by the body of humans (or other mammals). Further, it is a small AMP secreted by macrophages, which is a cationic peptide and has an amphiphilic structure with an α-helix, β-sheet, or elongated conformation.

[0055] As used herein, "Cathelicidin-1" is an antimicrobial peptide isolated and identified by Xiao et al. from chickens in 2006. It consists of 26 amino acids, has broad-spectrum antibacterial activity, can effectively inhibit the growth of a variety of bacteria, and also has good salt tolerance. It still has good antibacterial activity after treatment with 150 mM NaCl.

[0056] In some embodiments, the amino acid sequence of Cathelicidin-1 is as shown in SEQ ID NO.1, or as follows: RVKRVWPLVIRTVIAGYNLYRAIKKK;

[0057] The nucleotide sequence of Cathelicidin-1 is as shown in SEQ ID NO.2, or as follows:

[0058] CGAGTAAAGCGAGTTTGGCCACTCGTCATACGAACCGTCATAGCCGGATACAACCTCTACCGGGCCATAAAGAAGAAG.

[0059] In some embodiments, the gene primer sequences for cloning Cathelicidin-1 contain specific restriction enzyme sequences at both ends. Further,

[0060] The Cathelicidin-1-F sequence is as shown in SEQ ID NO.3, or as follows:

[0061] CCGGAATTCCGAGTAAAGCGAGTTTGGCC;

[0062] The Cathelicidin-1-R sequence is as shown in SEQ ID NO.4, or as follows:

[0063] TGCTCTAGAGCACCTTGAAAGTACAAGTTTTCCTTC.

[0064] "ParasinⅠ" mentioned herein is another antimicrobial peptide discovered by the inventors. The activity of antimicrobial peptide ParasinⅠ was verified synchronously in this application and can be used as a positive control for antimicrobial peptide Cathelicidin-1.

[0065] "Yeast" as mentioned herein refers to yeast, which is a eukaryotic cell and has the ability to serve as a heterologous system for recombinant protein expression. The yeast expression system includes two commonly used expression systems, namely the Saccharomyces cerevisiae expression system and the methylotrophic yeast expression system. As the most widely used yeast expression system currently, the methylotrophic yeast expression system is most commonly used in the genus Pichia, which can use methanol as a carbon and energy source. In addition, there are also the genera Hansenula and Torulopsis, etc.

[0066] As used herein, "Pichia pastoris" is also known as Pichia. As an engineered methylotrophic microorganism, Pichia pastoris can use methanol as the sole carbon source. One of the main advantages of using Pichia pastoris as a protein production host is its ability to secrete large amounts of correctly folded, post-translationally modified, and biologically functional recombinant proteins into the culture medium.

[0067] All currently used Pichia pastoris strains are derived from the original Y-11430 strain, and the differences among the strains are mainly manifested in the genotype differences, including wild type, auxotrophy, and protease deficiency.

[0068] GS115 is an improved Pichia pastoris. Different from the Y-11430 strain (wild type) (not used for protein expression), GS115 is the most widely used yeast strain for protein expression. Since the GS115 strain has two alcohol oxidase encoding genes (AOX1 and AOX2), when methanol is present in the environment, these two genes will be induced to express and a large amount of AOX enzyme will be synthesized, so it can utilize methanol.

[0069] Although both AOX1 and AOX2 can express AOX enzyme, AOX1 can produce more AOX enzyme and has a higher translation level. Therefore, when AOX1 is knocked out or silenced, the yeast growth rate will be significantly slowed down, and this phenotype is the slow methanol utilization type (MutS, such as the KM71 type of Pichia pastoris). On the contrary, knocking out AOX2 does not affect the growth of yeast, and the growth rate is comparable to that of the methanol utilization type (Mut+). However, if both genes are knocked out simultaneously, the strain cannot grow in the methanol medium (Mut-). Some Pichia pastoris strains, such as KM7121, MC100-3, and MC101-1, do not detect the AOX gene, and they cannot use methanol as a carbon source and cannot grow in the presence of methanol.

[0070] As used herein, "Escherichia coli" refers to Escherichia coli (E. coli), also known as Escherichia coli, which is a species of the genus Escherichia in the family Enterobacteriaceae and was discovered by the German-Austrian pediatrician Theodor Escherich in 1885. Escherichia coli is a Gram-negative, facultatively anaerobic, rod-shaped bacterium of the genus Escherichia coli with blunt ends, motile, and non-spore-forming, and is mainly parasitic in the large intestine of humans and animals. Escherichia coli is a conditional pathogen that can cause gastrointestinal infections or various local tissue and organ infections such as the urinary tract in humans and various animals under certain conditions.

[0071] According to the experimental requirements, researchers improved Escherichia coli to obtain various Escherichia coli with different genotypes, such as those with basic functions, improved transformation efficiency of ultra-long plasmids, improved plasmid stability in cells, high-speed growth / division, high-throughput cloning, etc. The competent cells prepared from various Escherichia coli can be used interchangeably and are all applicable to this application. Common genotypes of Escherichia coli or Escherichia coli competent cells include: DH5α, deoR, recA, endA, hsdR, supE, gyrA, relA, dam / dcm, mcrA / mcrBC / mrr, recBCD, lacIq, DE3, pLysS, lon, ompT, gor, etc. In some embodiments, the Escherichia coli competent cells used in this application are DH5α.

[0072] "DH5α" as mentioned in this article refers to a mutagenized strain of Escherichia coli, which mainly shows a lack of immunity to foreign DNA. It is a strain used in genetic engineering and lacks certain immune mechanisms compared to normal strains. For example, it is sensitive to Ampicillin, Zeocin, Kanamycin, etc. Its predecessor was the Escherichia coli cell line MG1655 isolated from a patient in 1920 and then modified.

[0073] "Competent state" as mentioned in this article refers to competent cells, which are cells induced by physical and chemical methods to absorb DNA molecules in the surrounding environment and make them in a physiological state suitable for taking up and accommodating foreign DNA. The main principle is to make the cell permeability larger through treatment. Intuitively, some pores appear on the cell membrane surface to facilitate the entry of foreign genes or vectors into the competent cells. Due to the fluidity of the cell membrane, these pores will be repaired by the cell itself. In this application, the cells can be Escherichia coli, yeast, etc. Correspondingly, the competent cells can be Escherichia coli competent cells, yeast competent cells, such as Pichia pastoris competent cells. Competent cells can be prepared by oneself or purchased directly.

[0074] "Inoculum size" as mentioned in this article refers to the amount of bacteria inoculated in a unit volume of culture medium. Among them, 0.01 OD / mL means that in each milliliter of culture medium, the optical density (OD) value of the inoculated bacteria is 0.01.

[0075] According to an embodiment of this application, the method for preparing Pichia pastoris competent cells includes:

[0076] ① Randomly pick a single colony from the YPD solid medium activated with Pichia pastoris into the liquid YPD medium, and place it in a constant temperature incubator at 150 rpm and 30 °C for about 24 h.

[0077] ② Add 1 mL of the bacterial solution to 100 mL of liquid YPD medium and culture it under the same culture conditions for 3 - 5 h until the OD 600 is 0.6 - 0.8, and then incubate it on ice for 30 min.

[0078] ③ Divide 100 mL of the bacterial solution equally into two pre-chilled 50 mL centrifuge tubes, centrifuge at 4000 rpm at 4°C for 10 min. Discard the bacterial solution, retain the precipitate, add 20 mL of pre-chilled 1 mol / L sorbitol solution, gently pipette to completely dissolve the precipitate, and then centrifuge under the same conditions.

[0079] ④ Repeat step ③ to completely discard all the bacterial solution, add 200 μL of sorbitol solution and 60% glycerol in a 1:1 ratio, then resuspend the cells completely, and aliquot into pre-chilled 1.5 mL centrifuge tubes, 60 μL per tube, to obtain Pichia pastoris competent cells.

[0080] In experiments or industrial applications, there are many methods to transform DNA into competent cells, such as electroporation, chemical transformation, heat shock transformation, etc. This application does not limit the transformation methods for Escherichia coli competent cells and yeast competent cells.

[0081] In some embodiments, the electroporation method means that when an electric current passes through the cell, temporary pores will be formed on the cell membrane, and the negatively charged plasmid DNA will be passively moved in this electric potential field, pass through the pores on the cell membrane, and enter the cell.

[0082] In some embodiments, the chemical transformation method means that after normal Escherichia coli cells are mixed with CaCl2 solution, many Ca 2+ (calcium ions) attach to the cell membrane surface. The positively charged calcium ions help to guide and assist the negatively charged DNA plasmid to bind to the cell membrane. When the plasmid DNA passes through the membrane and enters the cell, the positively charged calcium ions also well mask the negative charge of the DNA, making the process through the hydrophobic phospholipid layer easier. The method to make the plasmid enter the cell is a brief heat shock at 42°C.

[0083] In some embodiments, the heat shock transformation method for Escherichia coli competent cells includes:

[0084] (1) Mix Escherichia coli DH5α competent cells with 3 μL of a specific plasmid solution or ligation product, and pipette to mix well.

[0085] (2) Place the competent cells mixed with the plasmid on a metal bath or water bath that has been preheated to 42°C and process for 40 - 50 s.

[0086] (3) After heat shock transformation, add 1 mL of antibiotic-free LB liquid medium to a 1.5 mL EP tube containing competent cells, and pipette up and down 2 - 3 times to mix evenly. Then incubate at 37 °C for 1 h.

[0087] (4) Take out the EP tube containing competent cells, centrifuge at 6000 rpm for 5 min, then discard the supernatant medium and retain about 100 μL of the medium.

[0088] (5) Pipette up and down the remaining medium to resuspend all the bacteria evenly. Then use a pipette to transfer the bacterial liquid onto a solid LB medium plate containing 25 μg / mL bleomycin and spread it evenly. Incubate the plate upside down in a 37 °C incubator for 12 - 18 h.

[0089] It should be noted that except for the heat shock operation, all other steps of this experiment should be carried out in a laminar flow hood. To ensure the efficiency of heat shock transformation, the step of resuspending the bacteria after heat shock needs to be carried out quickly.

[0090] In some embodiments, the electrotransformation method of Pichia pastoris competent cells includes:

[0091] ① Mix 500 ng of a specific plasmid with yeast competent cells, and then incubate on ice for 30 min.

[0092] ② Transfer the competent cells mixed with the plasmid into a pre-chilled electroporation cuvette, wipe off the water mist on the cuvette body, and quickly place it in the electroporator. Set the electroporator mode to "Fungi", press the electroporation button, then quickly take out the electroporation cuvette and put it back on ice.

[0093] ③ Add 1 mL of antibiotic-free YPD liquid medium to the electroporation cuvette, gently pipette up and down, aspirate all the liquid, and then incubate at 30 °C for 1 h.

[0094] ④ Centrifuge at 4000 rpm for 10 min, discard the supernatant, add 100 μL of YPD liquid medium to resuspend the bacteria, and then spread it on a YPD solid medium containing 100 μg / mL bleomycin. After air-drying, place it in a 30 °C incubator and culture for 48 h.

[0095] ⑤ Take out the solid medium, randomly pick several single colonies and add them to a YPD liquid medium containing 100 μg / mL bleomycin. Incubate at 150 rpm and 30 °C for 48 h, extract the yeast genome, perform PCR verification, and sequence the PCR products. If the sequencing results are correct, it indicates that the specific plasmid has been transformed into Pichia pastoris.

[0096] The YPD liquid medium mentioned in this article is a medium containing 1% Yeast Extract, 2% Peptone, and 2% Dextrose (glucose).

[0097] The YPD solid medium mentioned in this article is a medium containing 1% Yeast Extract, 2% Peptone, 2% Dextrose (glucose), and 2% agar powder.

[0098] The LB liquid medium mentioned in this article is prepared by adding 1.2 g of agar according to the ratio of containing 0.5 g of yeast extract, 1 g of NaCl, and 1 g of peptone in every 100 mL.

[0099] The LB solid medium mentioned in this article is prepared according to the ratio of containing 0.5 g of yeast extract, 1 g of NaCl, and 1 g of peptone in every 100 mL.

[0100] The agarose gel mentioned in this article is approximately 1% agarose gel. The preparation method is to weigh 0.2 g of agarose using a weighing balance, add it to 20 mL of 0.5× (or 1×) TAE buffer solution to dissolve, then heat it using an electric heating furnace to dissolve the agarose, and let it stand to cool for later use.

[0101] The Pichia pastoris GS115 and Escherichia coli DH5α mentioned in this article are bacteria self-preserved in the laboratory and can also be directly purchased from the market.

[0102] The Aeromonas veronii, pathogenic Escherichia coli, Vibrio parahaemolyticus, Salmonella, Vibrio alginolyticus, Aeromonas schubertii, Pseudomonas aeruginosa, etc. mentioned in this article are all common foodborne pathogenic bacteria. Some of these bacteria can cause diseases in humans, livestock, and fish, and currently antibiotics are usually used for treatment. Of course, those skilled in the art should understand that there are far more pathogenic bacteria encountered in life than this. From the experimental data of this application, it can also be known that the antibacterial peptide Cathelicidin-1 of this application can inhibit or kill far more pathogenic bacteria than the several listed. Therefore, the several listed pathogenic bacteria should not limit the scope of use of the antibacterial peptide of this application.

[0103] Among them, foodborne pathogenic bacteria refer to a large group of bacteria that can cause diseases in humans with food as a carrier. These bacteria may directly or indirectly contaminate food and water sources, and after human oral infection, they may cause the prevalence of intestinal infectious diseases, food poisoning, and livestock and poultry infectious diseases. In addition to those listed above, common foodborne pathogenic bacteria also include: Staphylococcus aureus, Cronobacter sakazakii, Shigella, etc.

[0104] Aeromonas veronii can infect aquatic animals including fish, causing symptoms such as skin ulcers, organ hemorrhage, and severe ascites. For humans, it can cause gastroenteritis, peritonitis, septicemia, and wound infections, especially threatening the elderly, children, and people with low immunity. Aeromonas veronii has strong pathogenicity and is mainly transmitted through water bodies, food, etc. After infection, it can cause acute or chronic symptoms, and even lead to death in severe cases.

[0105] Escherichia coli (E. coli) is a common intestinal pathogen and was initially considered to be part of the normal intestinal flora. However, certain special serotypes of E. coli are pathogenic to humans and animals, especially infants and young livestock. Pathogenic E. coli is transmitted through contaminated drinking water, food, etc. Its pathogenic substances include endotoxin, capsule, adhesin, and exotoxin, etc., which can damage the intestinal mucosa and cause infection.

[0106] Vibrio parahaemolyticus is a Gram-negative bacterium belonging to the genus Vibrio. It is a halophilic bacterium widely present in seawater and is a common foodborne pathogen. The pathogenic substances of Vibrio parahaemolyticus mainly include thermostable direct hemolysin (TDH) and TDH-related hemolysin (TRH), which have hemolytic activity, enterotoxin, and lethal effects.

[0107] Salmonella is a common foodborne pathogen widely present in nature. It can cause various forms of salmonellosis, posing a threat to human and animal health. After Salmonella infection, it can cause symptoms such as diarrhea, fever, and abdominal colic. In severe cases, it can lead to complications such as septicemia and meningitis. Salmonella is mainly transmitted through contaminated food, water sources, etc. The feces of infected people can also become a source of infection.

[0108] Vibrio alginolyticus is a microorganism of the genus Vibrio, widely distributed in the natural environment. It is a Gram-negative bacterium with aerobic properties. Vibrio alginolyticus plays an important role in microbial classification and research. However, its pathogenicity is relatively low and usually does not directly cause human diseases.

[0109] Aeromonas schubertii is a pathogenic bacterium that causes fish diseases, especially with a relatively high incidence and lethality rate in snakehead fish (raw fish). Fish infected with Aeromonas schubertii will show symptoms such as bleeding on the body surface, swollen and red anus, and dark red gill filaments. In severe cases, there will be a large number of white spots on the liver and kidneys, enlarged gallbladder, and empty intestines, etc. For the prevention and treatment of Aeromonas schubertii disease, it mainly includes measures such as reasonable feeding, regular disinfection, and timely treatment. By improving the breeding environment and management level, the incidence and mortality rate of this disease can be effectively reduced.

[0110] The zebrafish mentioned in this application was purchased from the Wenbifeng breeding base of Hainan Baolu Aquatic Science and Technology Co., Ltd., and its weight is about 0.3 g.

[0111] In some embodiments, the antibiotics involved in this application, such as ampicillin, bleomycin, and kanamycin, are all purchased from the Solarbio brand. The reagents for preparing the culture medium, such as yeast extract, peptone, etc., are purchased from the Oxoid brand. Agar powder, etc., are purchased from the Biosharp brand. Other reagents, such as sorbitol, glucose, sodium chloride, sodium hydroxide, hydrochloric acid, isoamyl alcohol, trichloroacetic acid, absolute ethanol, etc., are purchased from Xilong Science.

[0112] In some embodiments, the enzymes and kits involved in this application, Fast T4 DNA Ligase / Buffers are produced by Monad; Restriction enzymes and / buffers are produced by NEB; 2×Phanta Max Master Mix, 2×Rapid Taq Master Mix, FastPure Gel DNA Extraction Mini Kit, FastPure PlasmidMini Kit are produced by Vazyme; the fish lysozyme (LZM) ELISA kit is produced by Jiangsu Enzyme Label Bio Co., Ltd.; the FishIgM ELISA KIT is produced by Shanghai Yuanju Biotechnology Center; the superoxide dismutase (SOD) test kit, alkaline phosphatase (AKP / ALP) test kit are produced by Suzhou Keming Biotechnology Co., Ltd.

[0113] The SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis) mentioned in this article is a commonly used technique for separating proteins and polypeptides in a sample according to the molecular weight of the proteins. SDS (sodium dodecyl sulfate) binds non-covalently to the protein, denatures it, and makes it carry a negative charge, thus eliminating the original charge difference of the protein and making its migration rate only depend on the molecular weight of the protein.

[0114] The TCA (trichloroacetic acid) method mentioned in this article refers to a commonly used chemical treatment method, mainly used to remove proteins in samples, and is often used in the pretreatment of biological samples, especially in the detection of activated sludge and metabolite analysis.

[0115] The "response surface method" mentioned in this article is a method that uses a polynomial function to approximate the implicit limit state function through a series of deterministic experiments. Specifically, in this application, through the combination of statistical methods and mathematical methods, it is used to optimize the relationship between multiple variables and responses in biological experiments. Through reasonable experimental design and statistical analysis, the response surface method can establish a mathematical model to describe the functional relationship between factors and responses, thereby assisting in identifying and optimizing the settings of influencing factors to achieve the best experimental results.

[0116] Its principle is: by reasonably selecting experimental points and iterative strategies, to ensure that the polynomial function can converge to the failure probability of the true implicit limit state function in terms of failure probability. When the nonlinear degree of the true limit state function is not large, the linear response surface has a high approximation accuracy.

[0117] This application relates to a method for preparing Cathelicidin-1 protein or Cathelicidin-1 fermentation broth, including: obtaining a yeast strain that can secrete Cathelicidin-1 protein; inoculating the yeast strain into a specific liquid medium; and fermenting the yeast strain to obtain Cathelicidin-1 fermentation broth; the fermentation broth contains Cathelicidin-1 protein; wherein, the pH of the specific medium is 6 - 7.4, the inoculation amount of the yeast strain in the specific medium is 0.005 - 0.02 OD / mL, and the temperature for fermenting the yeast is 28 - 33 °C.

[0118] In some embodiments, the pH of the specific medium is 6.6. In some embodiments, the inoculation amount of the yeast strain in the specific medium is 0.01 OD / mL. In some embodiments, the temperature for fermenting the yeast is 30.3 °C.

[0119] In some embodiments, the fermentation time of the yeast is 1 - 7 days; preferably 2 - 6 days; more preferably 3 - 4 days; further preferably 3 days.

[0120] This application relates to a method for activating and / or enhancing the immune system of fish, including: administering a certain amount of Cathelicidin-1 protein or Cathelicidin-1 fermentation broth obtained by any of the above-mentioned preparation methods to the fish.

[0121] The present application further relates to a method for preventing and / or treating pathogen infections in fish, comprising: administering a certain amount of Cathelicidin-1 protein or the Cathelicidin-1 fermentation broth obtained by any of the above-described preparation methods to the fish.

[0122] In some embodiments, the fish is a zebrafish.

[0123] In some embodiments, the pathogens are Aeromonas veronii, Escherichia coli, Vibrio parahaemolyticus, Salmonella, Vibrio alginolyticus, Aeromonas schubertii or Pseudomonas aeruginosa.

[0124] In some embodiments, the present application also relates to the use of the Cathelicidin-1 protein or the Cathelicidin-1 fermentation broth prepared by the above-described preparation method as a fish feed additive, wherein the amino acid sequence of the Cathelicidin-1 protein is: the amino acid sequence shown in SEQ ID NO.1; or the amino acid sequence with several amino acids added or subtracted at the N-terminus and / or P-terminus of the amino acid sequence shown in SEQ ID NO.1; or the amino acid sequence with several amino acids added, deleted or converted on the amino acid sequence shown in SEQ ID NO.1.

[0125] The technical solutions of the present application will be described in detail below through specific examples. Those skilled in the art should understand that the following description is only exemplary and does not limit the technical solutions of the present application.

[0126] Example 1 Construction of Recombinant Yeast Strains and Expression of Antimicrobial Peptides

[0127] 1. Amplification of the target gene

[0128] First, the full-length sequence of the gene Cathelicidin-1 was obtained by gene synthesis. Among them, the full-length sequence of Cathelicidin-1 is shown in SEQ ID NO.2.

[0129] Subsequently, corresponding restriction enzyme sites were introduced at the 5' and 3' ends of the target gene Cathelicidin-1 by PCR amplification. Among them, the 5' primer is shown in SEQ ID NO.3, and the 3' primer is shown in SEQ ID NO.4. The length of the Cathelicidin-1 gene sequence is 123bp. The PCR products were separated by agarose gel electrophoresis, and it can be seen that there is a band corresponding to the full length of Cathelicidin-1 at about 120bp, indicating that the amplification of the Cathelicidin-1 gene was successful. Figure 1 It can be seen that there is a band corresponding to the full length of Cathelicidin-1 at about 120bp, indicating that the amplification of the Cathelicidin-1 gene was successful.

[0130] 2. Construction of the recombinant vector

[0131] To facilitate the detection of the antimicrobial peptide expressed in Pichia pastoris (P. pastoris), pGAPZαA was selected as the vector. As Figure 2 shown in A, the protein expressed by it has an α-factor secretion signal peptide of Saccharomyces cerevisiae at the N-terminus, enabling the expressed antimicrobial peptide to be secreted into the fermentation broth. The GAP promoter of pGAPZαA is a constitutive promoter, different from the AOX promoter that requires methanol induction for expression. It can express foreign proteins without adding harmful inducers, ensuring the biosafety of the fermentation broth.

[0132] First, the pGAPZαA empty vector was double-digested with the restriction endonucleases XbaⅠ and EcoRⅠ, and the digested plasmid was purified and recovered. As Figure 3 shown, the digested plasmid (lane 2) migrated slower than the undigested plasmid (lane 1), indicating that the vector had been successfully digested. Then, the target gene was also double-digested with the same restriction endonucleases, and the digested product was purified and recovered. Subsequently, the digested plasmid and the digested target gene were ligated respectively by a ligase to construct the secretory expression vector pGAPZαA-Cathelicidin-1 (as Figure 2 shown in B).

[0133] 3. Amplification of the recombinant plasmid

[0134] The obtained recombinant vectors were respectively heat-shock transformed into E. coli DH5α competent cells. Positive clones were screened by resistance, and single colonies on the resistance plate were randomly selected for colony PCR verification. The electrophoresis results showed that the positive clones of the antimicrobial peptide Cathelicidin-1 could amplify a band of about 120 bp (as Figure 4 shown in lanes 3 - 9), which was consistent with the size of the Cathelicidin-1 gene, proving that the recombinant plasmid was successfully constructed and had been amplified in Escherichia coli.

[0135] 4. Construction of recombinant yeast strains

[0136] In this example, the secretory expression vector pGAPZαA-Cathelicidin-1 and the empty vector pGAPZαA were respectively transformed into Pichia pastoris. Among them, the transformation method is not limited to the technical solution of this application. In this example, the expression vectors were respectively introduced into Pichia pastoris by electroporation.

[0137] In Pichia pastoris, the two vectors will integrate into the yeast chromosome and replicate along with the replication of the yeast chromosome. Therefore, the recombinant strains have high genetic stability. However, when the circular plasmid integrates into the chromosome, it will break at random positions. Therefore, the circular recombinant plasmid needs to be linearized before transformation.

[0138] The recombinant vector was linearized using the restriction endonuclease BamH I, and then the linearized product was purified and recovered. Those skilled in the art should understand that the use of BamH I here is only an exemplary experimental method, rather than a limitation on the technical solution of this application, the method of linearizing the expression vector, and the specific restriction endonuclease.

[0139] The linearized recombinant vectors were electrotransformed into P. pastoris GS115 competent cells respectively to obtain the control strain transformed with the empty vector pGAPZαA and the recombinant strain of Cathelicidin-1.

[0140] Through the resistance YPD solid medium containing 50 mg·L -1 bleomycin, the positive clones of the Cathelicidin-1 recombinant strain were screened. The candidate positive clone colonies were picked and transferred to 5 mL of YPD liquid medium containing 50 mg·L -1 bleomycin and cultured for 24 h. The genomic DNA was extracted using a yeast genomic DNA extraction kit for PCR verification. The PCR results showed that using the extracted genomic DNA as a template, the genomic DNA of the recombinant strain of the antimicrobial peptide gene Cathelicidin-1 could amplify a target product of approximately 500 bp (as Figure 5 shown).

[0141] The PCR product was purified and recovered and sent to Hainan Nanshan Biotechnology Co., Ltd. for sequencing. The sequencing results showed that the nucleotide sequence of the amplified band was completely consistent with the nucleotide sequence of the target band, and there were no point mutations such as base substitutions in the coding region from the start codon to the stop codon, indicating that the recombinant vector had been integrated into the yeast genome (as Figure 6 A- Figure 6 B shown).

[0142] 5. Exogenous verification of exocrine antimicrobial peptides

[0143] The recombinant yeast was transferred to YPD medium for fermentation for 72 h. The fermentation broth was collected by centrifugation and concentrated by the TCA method. First, the overall protein expression in the secreted supernatant was detected by SDS-PAGE gel electrophoresis, and then the expression of the exocrine target antimicrobial peptide was detected by Western Blot. After the gel was stained with Coomassie Brilliant Blue, it was observed.

[0144] According to an embodiment of the present application, the method for SDS-Page analysis includes: using the strain with successful sequencing at 0.015 OD 600Inoculate into YPD liquid medium at an initial concentration of / mL respectively, culture at 30 °C and 180 rpm for 48 h. Centrifuge at 5000 rpm for 10 min, filter the obtained fermentation broth through a 0.22 μm filter membrane, then concentrate the protein by the TCA method, and dissolve it with 20 μL of protein loading buffer. Prepare a 15% SDS-Page gel according to the kit, add samples to the loading wells in turn, perform electrophoresis at a constant voltage of 200 V for 40 min, place it in Coomassie Brilliant Blue staining solution and treat for 4 h, then place it in the decolorizing solution and decolorize for 12 h.

[0145] From Figure 7 It can be seen that compared with the recombinant strain transfected with the empty plasmid, there is an obvious protein enrichment band in the fermentation broth of the recombinant strain expressing the antimicrobial peptide at about 9 kDa, which is close to the expected size of the target antimicrobial peptide. Western Blot detection was performed with an anti-His antibody, indicating that the antimicrobial peptide Cathelicidin-1 was successfully expressed in the form of extracellular secretion ( Figure 8 ).

[0146] Example 2 Determination of the antibacterial activity of Cathelicidin-1-Pichia pastoris fermentation broth

[0147] 1. Determination of antibacterial spectrum

[0148] Using 0.3 g / mL commercial antimicrobial peptide cecropin as the positive control and the fermentation broth of the recombinant strain with the empty vector as the negative control, compare the antibacterial effects of each fermentation broth by the antibacterial zone determination method.

[0149] In some embodiments, the antibacterial zone determination method includes: inoculating the activated single colonies of different pathogenic bacteria into LB liquid medium at an initial concentration of 0.02 OD 600 / mL respectively, culture at 37 °C and 150 rpm, spread the initial bacterial amount of 5×10 6 CFU / mL on the plate, then place the Oxford cup on the plate, set three biological replicates, incubate upright for 12 h, and measure the diameter of the antibacterial zone using a vernier caliper.

[0150] As can be seen from Table 1 below, for Vibrio alginolyticus and Pseudomonas aeruginosa, there is no significant difference in the inhibitory effects between the Cathelicidin-1 antimicrobial peptide fermentation broth and cecropin; for Aeromonas veronii, Vibrio parahaemolyticus and Aeromonas schubertii, the antimicrobial peptide Cathelicidin-1 shows better antibacterial effects than cecropin; for Escherichia coli and Salmonella, cecropin has the best antibacterial effect, which is better than the antimicrobial peptide Cathelicidin-1. Compare the diameters of the antibacterial zones of the Cathelicidin-1 antimicrobial peptide fermentation broth against various indicator bacteria.

[0151] Table 1 Antibacterial spectrum table

[0152]

[0153] Note: Through Tukey's test, the same letter marked in the same row indicates no significant difference (P>0.05).

[0154] In this example, it was found that it had the best inhibitory effect on Aeromonas veronii. Therefore, Aeromonas veronii was selected as the indicator bacterium for the subsequent experiments of this application.

[0155] 2. Determine the optimal fermentation time of the Cathelicidin-1-Pichia pastoris recombinant strain

[0156] In this example, the extracellular protein content at different fermentation times was determined by the BCA method, and the antibacterial effect of the fermentation broth on Aeromonas veronii was determined by the antibacterial circle method. From Figure 9 it can be seen that the extracellular protein content of the antibacterial peptide Cathelicidin-1 recombinant strain was higher than that of the empty vector recombinant strain from the 2nd day to the 7th day, and the content was the highest on the 3rd day. From Figure 10 it can be seen that the antibacterial activity of the fermentation broth of the antibacterial peptide Cathelicidin-1 recombinant strain also reached the highest on the 3rd day. Therefore, the optimal fermentation time of the antibacterial peptide Cathelicidin-1 recombinant strain is 3 days.

[0157] 3. Determine the antibacterial curve of the fermentation broth

[0158] In this example, different pathogenic bacteria at 10 7 CFU / ml were first added to 96-well microplates, and then 50, 100, 150, and 200 μL of the Cathelicidin-1 fermentation broth fermented for 3 days were added respectively, and then supplemented with LB liquid medium to 200 μL to make the volume fractions of the fermentation broth 25%, 50%, 75%, and 100% respectively. The fermentation broth of the empty vector recombinant strain with the same volume fraction was used as a control, cultured at 30 °C and 150 rpm, and three biological replicates were set for each sample. OD 600 was recorded every 3 h, observed for 24 h, and the antibacterial curve was plotted. When the OD 600 value increases, it indicates that the pathogenic bacteria have not been completely inhibited and are still replicating and proliferating.

[0159] (1) Aeromonas veronii

[0160] From Figure 11 it can be seen that the antibacterial peptide Cathelicidin-1 fermentation broth has a relatively significant inhibitory effect on the growth of Aeromonas veronii. When the added volume fraction reaches 25%, the growth of bacteria can be completely inhibited.

[0161] (2) Pseudomonas aeruginosa

[0162] It can be seen from Figure 12 that the fermentation broth of the antimicrobial peptide Cathelicidin-1 has a relatively significant inhibitory effect on Pseudomonas aeruginosa. When the added volume fraction reaches 50%, the growth of the bacteria can be completely inhibited.

[0163] (3) Vibrio parahaemolyticus

[0164] It can be seen from Figure 13 that the fermentation broth of the antimicrobial peptide Cathelicidin-1 has a relatively significant inhibitory effect on Vibrio parahaemolyticus. When the added volume fraction reaches 50%, it has an obvious inhibitory effect; when the added volume fraction is 100%, the growth of Vibrio parahaemolyticus can be completely inhibited.

[0165] (4) Pathogenic Escherichia coli

[0166] It can be seen from Figure 14 that the fermentation broth of the antimicrobial peptide Cathelicidin-1 has a relatively significant inhibitory effect on pathogenic Escherichia coli. When the added volume fraction reaches 25%, it can show a significant inhibitory effect on pathogenic Escherichia coli. When the addition is 75%, the growth of pathogenic Escherichia coli can be completely inhibited.

[0167] (5) Vibrio alginolyticus

[0168] It can be seen from Figure 15 that when the added volume fraction of the fermentation broth of the antimicrobial peptide Cathelicidin-1 reaches 50%, it can show a significant inhibitory effect and can completely inhibit the growth of Vibrio alginolyticus.

[0169] (6) Aeromonas schubertii

[0170] It can be seen from Figure 16 that when the added volume fraction of the fermentation broth of the antimicrobial peptide Cathelicidin-1 reaches 50%, it can show a significant inhibitory effect and can completely inhibit the growth of Aeromonas schubertii.

[0171] (7) Salmonella

[0172] It can be seen from Figure 17 that when the added volume fraction of the fermentation broth of the antimicrobial peptide Cathelicidin-1 reaches 25%, it can show a significant inhibitory effect; when the added volume fraction reaches 50%, the growth of Salmonella can be completely inhibited.

[0173] 4. Determination of the bactericidal curve of the fermentation broth

[0174] In this example, first, 10 7Aeromonas veronii at a concentration of CFU / ml was mixed with the fermentation broth of antimicrobial peptide Cathelicidin-1 and other auxiliary solutions. Samples were taken at 1, 2, 4, 8, and 16 h for plate counting, and finally, a bactericidal curve was plotted.

[0175] It can be seen from Figure 18 that kanamycin can kill 99.9% of Aeromonas veronii in about 4 hours, the fermentation broth of antimicrobial peptide Cathelicidin-1 can kill 99.9% of Aeromonas veronii in about 8 hours, while the fermentation broth of antimicrobial peptide ParasinⅠ and cecropin cannot completely kill Aeromonas veronii even at the maximum experimental observation time of 16 hours, and the fermentation broth of the empty vector recombinant strain has no bactericidal effect. Generally speaking, although the bactericidal activity of antimicrobial peptide Cathelicidin-1 is slightly inferior to that of kanamycin, it is better than antimicrobial peptide ParasinⅠ and cecropin.

[0176] Example 3 Optimization experiment by response surface methodology

[0177] 1. Optimization of fermentation conditions of recombinant strain of antimicrobial peptide Cathelicidin-1 by response surface methodology

[0178] In this example, the effects of inoculum size, pH, and temperature on the antibacterial activity of the fermentation broth of the recombinant strain of antimicrobial peptide Cathelicidin-1 were investigated. The obtained data were analyzed using software, and the following relationship model was obtained:

[0179] Y = 19.31 + 0.79X1 - 1.35X2 + 0.54X3 - 1.34X1X2 + 0.24X1X3 - 0.58X2X3 - 5.44X1 2 - 3.91X2 2 - 5.69X3 2

[0180] Among them, Y represents the diameter of the inhibition zone of the fermentation broth against Aeromonas veronii; X1 represents the inoculum size, X2 represents the pH, and X3 represents the temperature.

[0181] Table 2 Box-Behnken variance analysis

[0182] Source Adj SS DF Adj MS F value P value Significance Model 392.74 9 43.64 29.93 <0.0001 ** <![CDATA[X1 - Inoculum volume]]> 4.95 1 4.95 3.39 0.1081 NS <![CDATA[X2-pH]]> 14.55 1 14.55 9.98 0.0159 ** <![CDATA[X3 - Temperature]]> 2.31 1 2.31 1.59 0.2484 NS <![CDATA[X1X2]]> 7.18 1 7.18 4.93 0.0619 NS <![CDATA[X1X3]]> 0.24 1 0.24 0.16 0.6999 NS <![CDATA[X2X3]]> 1.36 1 1.36 0.93 0.3668 NS <![CDATA[X1 2 > 124.44 1 124.44 85.35 <0.0001 ** <![CDATA[X2 2 > 64.26 1 64.26 44.07 0.0003 ** <![CDATA[X3 2 > 136.51 1 136.51 93.63 <0.0001 ** Residual 10.21 7 1.46 Lack of Fit 8.18 3 2.73 5.39 0.0687 NS Pure Error 2.03 4 0.51 Cor Total 402.95 16

[0183] *: P < 0.05; **: P < 0.01; NS: Lack of fit term (Not significant); R 2 = 0.9747, AdjR 2 = 0.9421, PredR 2 = 0.6673,

[0184] C.V. % = 9.87, Adeq Precisior = 13.186.

[0185] As can be seen from Table 2, the P - value of the lack - of - fit term > 0.05, which is not significant, indicating that the experimental error is small; the coefficient of determination R 2 value is 0.9747, indicating that 97.47% of the data fits the model. The results of variance analysis show that the linear term of inoculum size, the quadratic term of pH, and the quadratic term of temperature have extremely significant effects on the antibacterial activity of the fermentation broth of antimicrobial peptide Cathelicidin - 1 (P < 0.01); the linear term of pH has a significant effect on the antibacterial activity of the fermentation broth of antimicrobial peptide Cathelicidin - 1 (P < 0.05); other factors have no significant effect on the antibacterial activity of the fermentation broth.

[0186] From Figure 19 A, Figure 19 B, it can be seen that when pH and temperature are constant, with the increase of inoculum size, the antibacterial activity first increases and then decreases, and reaches the maximum value at an inoculum size of about 0.01 OD / mL; combining Figure 19 A, Figure 19 C, when temperature and inoculum size are constant, with the increase of pH, the antibacterial activity also shows a trend of first increasing and then decreasing. When pH is about 6.6, the diameter of the inhibition zone reaches the maximum value; finally, from Figure 19 B, Figure 19 C, it can be seen that when pH and inoculum size are constant, the antibacterial activity also shows a trend of first increasing and then decreasing with the increase of temperature, indicating that when the strain is cultured at 29 - 31 °C, the antibacterial activity of the fermentation broth is the largest.

[0187] 2. Verification of the results of response surface optimization

[0188] In some embodiments, the process of optimizing fermentation conditions by the response surface method includes: based on the Box - Behnken Design response surface method, the key factors that may affect the antibacterial activity of the fermentation broth: inoculum size, temperature, and pH. The inoculum sizes are 0.005 OD / mL, 0.01 OD / mL, and 0.015 OD / mL respectively, the temperatures are 25 °C, 30 °C, and 35 °C respectively, and the pH values are 5, 7, and 9. According to the Box - Behnken method, 17 groups of experiments are generated. The strain is cultured under different culture conditions for 72 h, then centrifuged to collect the supernatant fermentation broth and filtered through a membrane, and the obtained fermentation broth is subjected to the inhibition zone experiment.

[0189] According to the optimization results of the response surface method, the fermentation broth of antimicrobial peptide Cathelicidin - 1 has the best antibacterial activity at an initial inoculum size of 0.01 OD / mL, pH = 6.6, and temperature of 30.3 °C. The optimal diameter of the inhibition zone is 19.42 mm. After experimental verification, the diameter of the inhibition zone is 19.05 mm (as Figure 20As shown, the coincidence rate was 98.1%. Through SDS-PAGE, the concentration changes of the corresponding protein bands were observed (as Figure 21 shown), and Image J was used for gray-scale analysis, and it was found that the expression level of the antimicrobial peptide Cathelicidin-1 was significantly increased after optimized culture.

[0190] Example 4 Potential Application of Antimicrobial Peptide Fermentation Broth as an Antimicrobial Feed Additive

[0191] In this example, the potential application value of the antimicrobial peptide fermentation broth as an antimicrobial feed additive was explored through the following experiments.

[0192] First, verify the stability of the antibacterial activity of the antimicrobial peptide fermentation broth in the gastric juice environment, that is, in the presence of low pH and protease.

[0193] In some embodiments, the method for treating the fermentation broth under simulated gastric juice conditions includes: inoculating the recombinant yeast strain into YPD liquid medium at an initial concentration of 0.015 OD 600 / mL, culturing at 30 °C and 180 rpm for 48 h. Centrifuge at 5000 rpm for 10 min, filter the obtained fermentation broth through a 0.22 μm filter membrane, transfer it to a 500 mL beaker, measure and record the initial pH value, then slowly add hydrochloric acid while stirring until the pH = 2, then add pepsin at a mass fraction of 1 g / L, treat for 3 h, and adjust the pH back to the initial value with 1 mol / L NaOH solution for subsequent experiments.

[0194] It can be seen from Figure 22 that in the simulated gastric juice environment, for the antimicrobial peptide Cathelicidin-1 fermentation broth, although the antibacterial activity decreased significantly, most of the antibacterial activity was still retained, and the stability was about 82.7%.

[0195] Secondly, through the zebrafish challenge protection experiment, determine the promoting effect of the antimicrobial peptide fermentation broth as a potential antimicrobial additive on enhancing the resistance of zebrafish to Aeromonas veronii infection. When the antimicrobial peptide fermentation broth is added or not added to the conventional feed of zebrafish, on the one hand, compare the mortality rate of zebrafish after being infected with Aeromonas veronii.

[0196] In some embodiments, the zebrafish challenge and the detection of the immune enzyme activity of zebrafish after challenge include: selecting zebrafish with similar body sizes, dividing them into four groups, with 20 zebrafish in each group, namely the blank control group, the blank plasmid fermentation broth group, the antimicrobial peptide one fermentation broth group, and the antimicrobial peptide two fermentation broth group. The blank control group is fed with feed without any treatment, and the other three groups are fed with a mixed feed in which the fermentation broth and the feed are mixed at a ratio of 1:1 for 14 d. Subsequently, pick a single colony of wild-type Aeromonas veronii into LB liquid medium, culture at 30 °C and 150 rpm for 12 h, and according to 1 OD600 The bacterial solution contains 2×10 8 After calculating and collecting the bacterial cells according to CFU and configuring them into a 2×10 7 CFU / mL bacterial solution, it was resuspended with sterilized 0.9% normal saline to configure an injection solution with a concentration of 5×10 7 CFU / mL, and a zebrafish intraperitoneal injection challenge experiment was carried out at an injection volume of 10 μL / g body weight.

[0197] The zebrafish at 1 d, 3 d, 5 d, and 7 d after challenge were homogenized using a homogenizer, and the enzyme activity was detected according to the instructions of the superoxide dismutase (SOD) test kit (Suzhou Keming Biotechnology Co., Ltd.) and the alkaline phosphatase (AKP / ALP) test kit (Suzhou Keming Biotechnology Co., Ltd.).

[0198] In some embodiments, the method for measuring the immune protection rate of the fermentation broth against zebrafish includes: when the zebrafish are cultured to about 0.3 g, they are grouped into 20 per group, namely a blank control group, a blank plasmid fermentation broth group, an antimicrobial peptide I fermentation broth group, and an antimicrobial peptide II fermentation broth group. The blank control group is fed with feed without any treatment, and the other three groups are fed with a mixed feed in which the fermentation broth and the feed are mixed at a ratio of 1:1 for 14 d. A single colony of wild-type Aeromonas veronii was picked into a liquid LB medium and cultured at 30 °C and 150 rpm for 12 h, and according to 1 OD 600 The bacterial solution contains 2×10 8 After calculating and collecting the bacterial cells according to CFU and configuring them into a 2×10 7 CFU / mL bacterial solution, it was resuspended with sterilized 0.9% normal saline to configure an injection solution with a concentration of 5×10 7 CFU / mL, and a zebrafish intraperitoneal injection challenge experiment was carried out at an injection volume of 10 μL / g body weight. Observe for 7 d, record the number of dead fish in each group every day, and calculate the cumulative mortality rate.

[0199] It can be seen from Figure 23 that there is no significant difference in the protection rate between the treatment group with the addition of the empty vector fermentation broth and the blank control group without any treatment; while the fermentation broth treatment groups with the mixing of the antimicrobial peptides Cathelicidin-1 and ParasinⅠ in the feed can effectively improve the survival rate of zebrafish, and the survival rates reach 90% and 95% respectively.

[0200] On the other hand, comparing the immune responses of the zebrafish body after being infected with Aeromonas veronii, it can be seen from Figure 24 A that on the 1st day after challenge, the SOD enzyme activity of the treatment groups with the antimicrobial peptide Cathelicidin-1 fermentation broth and the antimicrobial peptide ParasinⅠ fermentation broth was significantly increased compared with the treatment group with the empty vector fermentation broth and the blank control group, while there was no significant difference at the subsequent time points; fromFigure 24 As can be seen from Figure B, the treatment group with the fermentation broth of antibacterial peptide Cathelicidin-1 significantly increased the enzyme activities of AKP / ALP on days 3, 5, and 7. The fermentation broth of antibacterial peptide ParasinⅠ significantly increased the enzyme activities of AKP / ALP on days 5 and 7. This indicates that the addition of the fermentation broth of antibacterial peptides can enhance the expression of SOD and AKP / ALP in zebrafish when facing pathogen invasion, so as to promote the killing of pathogens.

[0201] As can be seen from Figure 25 Figure C, on the 3rd day after virus challenge, the lysozyme enzyme activity of the fermentation broth of antibacterial peptide Cathelicidin-1 was significantly higher than that of the empty vector fermentation broth treatment group, the blank control group, and the antibacterial peptide ParasinⅠ treatment group. On the 5th day after virus challenge, the lysozyme enzyme activity level of the blank control group was higher than that of the fermentation broth treatment group of antibacterial peptides, indicating that feeding the feed mixed with the fermentation broth of antibacterial peptides can accelerate the response of fish to pathogen infection.

[0202] In some embodiments, the method for detecting the IgM content of zebrafish includes: using a fish immunoglobulin M (IgM) enzyme-linked immunosorbent assay (ELISA) kit for determination. The specific operation steps refer to the instruction manual.

[0203] As can be seen from Figure 26 Figure D, on the 1st and 3rd days after virus challenge, the IgM of the treatment groups with the fermentation broth of antibacterial peptide Cathelicidin-1 and the fermentation broth of antibacterial peptide ParasinⅠ was significantly higher than that of the empty vector fermentation broth treatment group and the blank control group. Moreover, the improvement level of the treatment group with the fermentation broth of antibacterial peptide Cathelicidin-1 was significantly higher than that of the treatment group with the fermentation broth of antibacterial peptide ParasinⅠ, and there was no significant difference at subsequent time points. This indicates that adding the fermentation broth of antibacterial peptides to the feed within the first 5 days after virus challenge can increase the response intensity of the innate immunity of fish, better play the role of clearing pathogens, and ultimately improve the survival rate of fish. Generally speaking, adding the fermentation broth of antibacterial peptide Cathelicidin-1 to the feed may activate the immune system of fish, respond to pathogens faster when facing pathogen infection, so as to reduce the harm of pathogens to fish.

[0204] In summary, the fermentation broth of antibacterial peptides has great potential as an antibacterial feed additive.

[0205] Example 5 Antibacterial Mechanism of Fermentation Broth

[0206] 1. Destruction of Cell Membrane by Fermentation Broth

[0207] In this embodiment, in combination with the current research progress on antimicrobial peptides, the antibacterial mechanism of the fermentation broth containing antimicrobial peptide Cathelicidin-1 was initially explored, which mainly includes the following two aspects: on the one hand, it acts on the cell membrane of the target pathogen, causing defects, and then leading to the leakage of cytoplasm, resulting in cell death; on the other hand, it acts on the biofilm of the pathogen, making it more easily killed.

[0208] First, PI staining was used to preliminarily detect the cell membrane of Aeromonas veronii treated with the fermentation broth of antimicrobial peptide Cathelicidin-1 to determine the possibility of cell membrane damage. The PI dye will penetrate the damaged cell membrane and bind to deoxynucleotides, emitting red light under the excitation light. However, if the cell membrane is intact, the PI dye cannot enter the cell to bind to deoxynucleotides and thus cannot emit light.

[0209] In some embodiments, the method for observing cell membrane damage by PI staining includes: picking a single colony of wild-type Aeromonas veronii into an LB liquid medium and culturing it at 30 °C and 150 rpm for 12 h. Take 108 bacteria and place them in a 1.5 mL EP tube, centrifuge at 6000 rpm for 10 min, discard the supernatant, add different fermentation broths and treat for 1 h. Then, centrifuge at 6000 rpm for 10 min again, discard the supernatant, add 1 mL of 10 μg / mL PI dye, stain for 30 min, add 1 mL of sterile water to wash and resuspend, centrifuge at 6000 rpm for 10 min, add 1 mL of sterile water to wash and resuspend again, take 20 μL and drop it onto a glass slide, place a coverslip, and observe using a fluorescence microscope.

[0210] From Figure 27 it can be seen that Aeromonas veronii treated with the fermentation broth of the empty plasmid recombinant strain was rarely stained by PI, indicating that the cell membrane of the bacteria was basically intact; while Aeromonas veronii treated with the fermentation broth of antimicrobial peptide Cathelicidin-1 showed a large amount of red light in the fluorescence field of view, indicating that the cell membrane of the bacteria was generally damaged, and it was speculated that the fermentation broth might damage the cell membrane.

[0211] To further clarify the damage of the antimicrobial peptide fermentation broth to the cell membrane of Aeromonas veronii, the cell morphology of Aeromonas veronii treated with the fermentation broth of antimicrobial peptide Cathelicidin-1 was observed by TEM.

[0212] In some embodiments, the method for observing cell membrane damage by TEM includes: picking a single colony of wild-type Aeromonas vickers into a liquid LB medium, culturing at 30°C and 150rpm for 12h. Taking 108 bacteria and placing them in a 1.5mL EP tube, then centrifuging at 6000rpm for 10min, discarding the supernatant, adding different fermentation broths for treatment for 1h, then centrifuging at 6000rpm for 10min again, discarding the supernatant, adding 1mL of sterile water for washing and resuspending, centrifuging at 6000rpm for 10min, and then adding 1mL of sterile water for washing and resuspending, using a pipette to take 10μL and drop it on a copper foil, air-drying naturally, and then loading for observation.

[0213] Depend on Figure 28 It can be seen that the cell membrane of Aeromonas veronii treated with the fermentation liquid of the empty vector recombinant strain is intact, and the flagella are clearly visible; while the cell membrane of the bacteria treated with the fermentation liquid of the antimicrobial peptide 1 is obviously damaged, and the extracellular structure of the bacteria is also damaged. The above experimental results show that the fermentation liquid of the antimicrobial peptide Cathelicidin-1 does damage the cell membrane of Aeromonas veronii.

[0214] 2. Effect of fermentation broth on biofilm

[0215] Another aspect of the role of antimicrobial peptides is the impact on biofilms, which refer to organized bacterial groups attached to the surface of objects and wrapped by bacterial extracellular macromolecules. It is also an important factor in the resistance of bacteria to antibiotics and the inability to be completely killed. First, Aeromonas veronii, which can produce biofilms, was used as the research object to explore the effects of antimicrobial peptides Cathelicidin-1 and Parasin I fermentation broth on the ability of Aeromonas veronii to form biofilms. By adding different volumes of fermentation broth to achieve different volume fractions, the formed biofilm was detected after 24 hours of culture.

[0216] In some embodiments, the biofilm assay method comprises: picking a single colony of wild-type Aeromonas vermifuge into LB liquid culture medium, culturing at 30° C. and 150 rpm for 12 hours. 7 Add bacteria with CFU / ml into a 96-well microtiter plate, add 100μL of fermentation broth, transfer blank plasmid yeast fermentation broth and 50μg / mL of kanamycin as controls, and culture at 30℃ for 48h. Aspirate the culture medium, add 200μL 1×PBS, wash twice, and dry. Add 100μL of anhydrous methanol to each well for 20 minutes, then aspirate the methanol and let it air dry naturally. Add 100μL of 1% crystal violet and stain at room temperature for 15 minutes. Wash off the crystal violet staining solution and wash twice with clean water. Add 100μL of 33% glacial acetic acid solution to each well and incubate at 37℃ for 30 minutes to dissolve the crystal violet. Detect OD with an enzyme reader 590 Numerical values. Plotted using Graphpad.

[0217] It can be seen from Figure 29 that when the volume fraction of the fermentation broth of the antimicrobial peptide Cathelicidin-1 reaches 50%, the formation of Aeromonas veronii biofilm can be significantly inhibited. As the volume fraction of the fermentation broth increases, the inhibitory effect on biofilm formation becomes more obvious. For the fermentation broth of the antimicrobial peptide ParasinⅠ, a significant inhibitory effect is observed only when the volume fraction reaches 75%, but its inhibitory effect is also positively correlated with the volume fraction of the fermentation broth. This experiment shows that the fermentation broth of antimicrobial peptides can inhibit the formation of Aeromonas veronii biofilm.

[0218] Secondly, it is explored whether the fermentation broths of the antimicrobial peptides Cathelicidin-1 and ParasinⅠ have an impact on the already formed biofilm of Aeromonas veronii. First, Aeromonas veronii is cultured for 48 h to form a sufficient amount of biofilm, and then fermentation broths with different volume fractions are added for treatment. After 24 h, the biofilm content is detected. It can be seen from Figure 30 that compared with the treatment group of the fermentation broth of the empty plasmid recombinant strain, the fermentation broth of the antimicrobial peptide Cathelicidin-1 significantly destroys the already formed biofilm of Aeromonas veronii; the fermentation broth of the antimicrobial peptide ParasinⅠ also significantly destroys the biofilm, but the effect is not as obvious as that of the fermentation broth of the antimicrobial peptide Cathelicidin-1. Based on the above experiments, it is proved that the mechanism of action of the fermentation broth of antimicrobial peptides is, on the one hand, to damage the bacterial cell membrane; on the other hand, to affect the bacterial biofilm, which is manifested not only in inhibiting the formation of biofilm but also in destroying the already formed biofilm.

[0219] The above embodiments are only for illustrating the present invention and are not intended to limit the present invention. Those of ordinary skill in the relevant technical fields can make various changes and modifications without departing from the scope of the present invention. Therefore, all equivalent technical solutions should also fall within the scope of the disclosure of the present invention.

Claims

1. Method for preparing cathelicidin-1 protein or cathelicidin-1 fermentation broth, comprising: Obtaining a yeast strain capable of secreting cathelicidin-1 protein; Inoculating the yeast strain into a specific liquid medium; And Fermenting the yeast strain and obtaining cathelicidin-1 fermentation broth; The fermentation broth contains cathelicidin-1 protein; Wherein, the pH of the specific medium is 6 - 7.4, the inoculation amount of the yeast strain in the specific medium is 0.005 - 0.02 OD / mL, and the temperature for fermenting the yeast is 28 - 33 °C.

2. The preparation method according to claim 1, wherein the pH of the specific medium is 6.

6.

3. The preparation method according to claim 1, wherein the inoculation amount of the yeast strain in the specific medium is 0.01 OD / mL.

4. The preparation method according to claim 1, wherein the temperature for fermenting the yeast is 30.3 °C.

5. The preparation method according to claim 1, wherein the fermentation time of the yeast is 1 - 7 days; preferably 2 - 6 days; more preferably 3 - 4 days; further preferably 3 days.

6. A method for activating and / or enhancing the immune system of fish, comprising: Administering a certain amount of cathelicidin-1 protein or cathelicidin-1 fermentation broth obtained by the preparation method according to any one of claims 1 - 5 to fish.

7. A method for preventing and / or treating pathogen infections in fish, comprising: Administering a certain amount of cathelicidin-1 protein or cathelicidin-1 fermentation broth obtained by the preparation method according to any one of claims 1 - 5 to fish.

8. The method according to claim 7, wherein the fish is zebrafish.

9. The method according to claim 7, wherein the pathogen is Aeromonas veronii, Escherichia coli, Vibrio parahaemolyticus, Salmonella, Vibrio alginolyticus, Aeromonas schubertii or Pseudomonas aeruginosa.

10. Application of cathelicidin-1 protein or cathelicidin-1 fermentation broth prepared by the preparation method according to claim 1 as a fish feed additive, wherein the amino acid sequence of the cathelicidin-1 protein is: the amino acid sequence shown in SEQ ID NO.1; or the amino acid sequence with several amino acids added and / or deleted at the N-terminus and / or P-terminus of the amino acid sequence shown in SEQ ID NO.1; or the amino acid sequence with several amino acids added, deleted or converted on the amino acid sequence shown in SEQ ID NO.1.

Images