In-situ capture, amplification and sequencing method of RNA target sequence

Abstract

The invention discloses an in-situ capture, amplification and sequencing method of an RNA (Ribonucleic Acid) target sequence, which is characterized in that a lock-type probe with a gap is designed aiming at the RNA target sequence, the 5'end and the 3 'end of the lock-type probe are respectively complementarily hybridized with the upstream and downstream of the target sequence, and a middle gap corresponds to the target sequence. CDNA of a target sequence is generated through reverse transcription, and the cDNA is connected with the 5'end of the probe through DNA ligase to form annular DNA. And after rolling circle amplification, target sequence information is obtained through in-situ sequencing. According to the method, the experimental process is simplified, the detection sensitivity and specificity are improved, the method is suitable for various sample types, and an efficient tool is provided for spatial transcriptomics research.

Description

Technical Field

[0001] The present invention belongs to the technical field of spatial transcriptomics, and specifically relates to a method for in-situ capture, amplification, and sequencing of RNA target sequences. Background Art

[0002] Spatial transcriptomics technology is an important breakthrough in the biomedical field in recent years. By analyzing the spatial localization information of gene expression, it provides a new perspective for studying the complex spatial interaction mechanisms between cells. As a representative imaging-based method, in-situ sequencing technology can directly sequence RNA in cell or tissue samples to generate high-precision gene expression profile data. Its core technology relies on Rolling Circle Amplification (RCA). By efficiently amplifying the signal of target RNA molecules and combining flexible probe design strategies, it realizes high-precision sequencing of the target molecule's own sequence or specific probe tags. This technical framework not only supports large-scale in-situ gene expression profile analysis but also provides a powerful tool for transcriptome research.

[0003] The development of in-situ sequencing technology has given rise to a variety of method systems. Although the specific implementation paths are different, they generally rely on rolling circle amplification technology to significantly enhance the detection signal. According to the differences in sequencing targets, in-situ sequencing technology is mainly divided into two categories: one is to sequence the DNA probe tags corresponding to genes, mainly used for quantitative analysis of gene expression; the other is to sequence the sequence of the RNA molecule itself, which can not only achieve quantitative analysis of gene expression but also further analyze the variation of RNA sequences, such as mutations, splicing variations, etc. The latter shows great potential in fields such as gene perturbation screening, neuron tracing, tumor evolution, and mutation detection due to its ability to provide direct information on RNA sequences and has become a current research hotspot.

[0004] However, the existing technology still has some significant limitations in the capture, amplification and sequencing of RNA target sequences, which limits its breadth and effectiveness in practical applications. First, detection sensitivity is one of the main challenges facing in situ sequencing technology. Especially in the detection of low-abundance RNA target sequences, existing methods often find it difficult to take into account both specificity and efficiency, resulting in a low signal-to-noise ratio of the detection results, which directly affects the accuracy and reliability of the data. Secondly, the complexity of the operating process is also an important factor restricting the popularization of this technology. Traditional RNA in situ sequencing methods usually involve multiple steps, including reverse transcription of RNA, cyclization, amplification and sequencing of cDNA, etc. Each step requires precise control of experimental conditions, which not only increases the complexity and risk of failure of the experiment, but also places high demands on the technical level of the experimenter. In addition, the existing technology is still insufficient in the integration of spatial information, especially in high-throughput detection scenarios. How to effectively integrate a large amount of spatial data and perform precise analysis is still a technical problem that needs to be solved urgently.

[0005] In order to realize the in situ sequencing of RNA sequences, the prior art generally uses two main approaches to generate circularized DNA templates. The first approach is to use a special ligase (such as CircLigase) to directly self-circularize cDNA, and then use the complementary sequence of the reverse transcription primer as a primer for rolling circle amplification. This method is relatively direct to operate, but the circularization efficiency is significantly affected by the length of cDNA. For longer cDNA fragments, the circularization efficiency is low, thereby affecting the effect of subsequent amplification and sequencing. The second approach is to first obtain cDNA, then use a gapped padlock probe (Padlock Probe) to hybridize next to the target sequence, and then use DNA polymerase to use the 3' end of the padlock probe as a primer to perform polymerization reaction to fill the gap, and finally connect the cDNA extended to the 5' end of the padlock probe to the 5' end of the padlock probe by DNA ligase to form a circular DNA molecule. This method can effectively integrate cDNA fragments, but the steps are relatively cumbersome, and the dependence on probe design and experimental conditions is high, which increases the difficulty of operation.

[0006] In recent years, targeted RNA in situ direct sequencing technology, as an emerging spatial transcriptomics tool, has shown broad application prospects in many fields. For example, in tumor evolution and mutation detection, this technology can help researchers track the genetic variation of tumor cells and their spatial distribution. However, its application is still in its infancy, especially in terms of detection sensitivity, low-frequency mutation identification, and spatial information integration. In particular, in complex tissue samples, how to efficiently capture and sequence RNA target sequences while maintaining the integrity of spatial information has become a key bottleneck in the current development of the technology. Summary of the invention

[0007] The object of the present invention is to overcome the defects of the prior art and provide a method for in-situ capture, amplification and sequencing of RNA target sequences.

[0008] The technical solution of the present invention is as follows:

[0009] A method for in-situ capture, amplification and sequencing of RNA target sequences uses at least one padlock probe. Each padlock probe corresponds to an RNA target sequence with a length of at least 1 base. The padlock probe is a single-stranded DNA probe phosphorylated at the 5' end and containing natural or unnatural bases, including a 5' end sequence and a 3' end sequence complementary to the upstream and downstream sequences of the RNA target sequence, and an intermediate sequence not complementary to the RNA target sequence; specifically includes the following steps:

[0010] (1) Hybridize at least one padlock probe with at least one RNA target sequence in the sample to be tested;

[0011] (2) Use the 3' end sequence of the at least one padlock probe as a primer for reverse transcription to generate cDNA complementary to the RNA target sequence;

[0012] (3) Use a DNA ligase capable of ligating DNA with RNA as a template to ligate the 3' end of the cDNA with the phosphorylated 5' end of the padlock probe to form a circular DNA molecule;

[0013] (4) Use the circular DNA molecule in step (3) as a template for rolling circle amplification to obtain a rolling circle amplification product;

[0014] (5) Perform in-situ sequencing on the cDNA part complementary to the RNA target sequence in the rolling circle amplification product to obtain the sequence information of the RNA target sequence.

[0015] In a preferred embodiment of the present invention, the sample to be tested is selected from cultured cells, cells in tissues and cells in tissue sections.

[0016] In a preferred embodiment of the present invention, the intermediate sequence of the at least one padlock probe has a sequence complementary to the rolling circle amplification primer.

[0017] In a preferred embodiment of the present invention, the reverse transcription is carried out using RevertAid H Minus M-MuLV reverse transcriptase.

[0018] In a preferred embodiment of the present invention, the DNA ligase is SplintR Ligase.

[0019] In a preferred embodiment of the present invention, the rolling circle amplification is carried out using Equiphi29 DNA polymerase

[0020] In a preferred embodiment of the present invention, it further includes, after the rolling circle amplification, using a bridging splint probe and a fluorescence detection probe for hybridization to detect the rolling circle amplification product.

[0021] In a preferred embodiment of the present invention, the in situ sequencing is performed in a way of sequencing by synthesis.

[0022] More preferably, it further includes, before the in situ sequencing in step (5), pre-treating the rolling circle amplification product, and this pre-treatment includes washing with a formamide solution and DEPC-PBST.

[0023] Even more preferably, during the in situ sequencing process, multiple rounds of Hot reactions and Cold reactions are carried out to achieve multiple rounds of fluorescence signal acquisition.

[0024] The beneficial effects of the present invention are as follows:

[0025] 1. By directly integrating the cDNA obtained by reverse transcription into the padlock probe to form a circular DNA molecule, the present invention avoids the cumbersome steps of first reverse transcribing RNA into cDNA and then using the padlock probe to capture the target sequence on the cDNA and circularize it, thus significantly simplifying the operation process and reducing the experimental complexity.

[0026] 2. The present invention uses the rolling circle amplification technology to efficiently amplify the circular DNA molecule, greatly enhancing the detection signal, enabling the effective detection of low-abundance RNA target sequences, and thus improving the sensitivity of the method.

[0027] 3. Through specific hybridization design, the padlock probe in the present invention can accurately capture the target RNA target sequence, avoiding non-specific signal interference, and thus improving the specificity and reliability of the sequencing results.

[0028] 4. The present invention can perform in situ sequencing in cell or tissue samples, completely retaining the spatial localization information of RNA, which is helpful for in-depth study of the spatial distribution characteristics of gene expression and the variation of RNA sequences.

[0029] 5. The present invention is applicable to various sample types, including cultured cells, cells in tissues, and cells in tissue sections, expanding its application scope in spatial transcriptomics research and related fields. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 It is the schematic diagram of Example 1 of the present invention.

[0031] Figure 2This is the result diagram for the feasibility verification experiment of Example 1 of the present invention. Among them: a is the detected fluorescence image after filling and ligation under the condition of reverse transcriptase deficiency; b is the detected fluorescence image after filling and ligation under the condition of SplintR Ligase deficiency; c is the detected fluorescence image after filling and ligation in the complete system.

[0032] Figure 3 This is the schematic diagram of Example 2 and Example 3 of the present invention.

[0033] Figure 4 This is the result diagram of Example 2 of the present invention.

[0034] Figure 5 This is the result diagram of the experiment and mutation detection result of Example 3 of the present invention. Among them: a is the original fluorescence signal image of 5 rounds of barcodes and 3 rounds of mutation site sequencing; b is the pie chart of mutation frequency, showing the ratio of mutant type (red) to wild type (green) in the detection results of each mutation site; c is the bar chart of the decoding results of multi-site mutation detection. The abscissa corresponds to each mutation site, the ordinate represents the detection quantity of each mutation site, and different colors represent the mRNA sequences detected at each site. Specific implementation manners

[0035] The technical solutions of the present invention will be further described and illustrated below through specific implementation manners in combination with the accompanying drawings.

[0036] Example 1: Conduct technical feasibility verification on A549 cell slides (the principle is as Figure 1 shown)

[0037] (1) Sample preparation and pretreatment: The specific steps are as follows:

[0038] (1) Cell slides: First, sterilize the glass slides by burning them three times in the outer flame of an alcohol lamp. After treatment, place them in a 15-mm culture dish, and inject 15 mL of complete medium until the liquid surface completely covers the glass slides. Before cell digestion, discard the original medium, slowly add 2 mL of phosphate buffer solution (PBS) along the wall of the dish, shake and wash, and then aspirate and discard the waste liquid twice. Add an appropriate amount of trypsin (1 - 2 mL, enough to cover the bottom of the dish), incubate at 37 °C for 1 - 5 min, and terminate digestion when it is observed under a microscope that the cells shrink and become round, the edges are transparent, and they are not completely detached from the bottom of the dish. After discarding the trypsin, add 2 mL of complete medium to terminate the reaction, and pipette the cell suspension at the bottom of the dish. Drop the suspension evenly on the surface of the glass slide, let it stand for 15 min to allow the cells to settle, and then transfer it to the incubator. Observe the adherent state after 24 h, and enter the fixation process after confirming complete adhesion.

[0039] (2) Fixing the cell slides: Pre-warm 4% PFA and DEPC-PBS to room temperature in advance. Remove the culture medium in the petri dish in the fume hood, wash it twice with 20 mL of DEPC-PBS by shaking for 2 minutes each time to thoroughly remove the residual culture medium. Add 25 mL of 4% PFA and fix at room temperature for 30 minutes. After aspirating the fixing solution, wash it three times with DEPC-PBS (20 mL each time, 2 minutes each time). Dehydrate with 70%, 85%, and 100% gradient ethanol for 5 minutes each. After dehydration is completed, label the cell type, passage number, operation date, and information of the experimenter, and then seal and store it in a -80°C ultra-low temperature refrigerator.

[0040] (3) Pretreatment of cell samples: Take out the frozen cell slides from -80°C and let them recover to room temperature until the ice crystals completely melt. After rewarming, wash them three times with 0.1% DEPC-PBST (PBS containing 0.1% Tween-20) and air dry at room temperature. Use an immunohistochemistry pen to mark the target reaction area. After the liquid is completely dry, wash it three times again with 0.1% DEPC-PBST. When the reaction area is slightly wet, add 100 μL of 0.1 M HCl and treat for 5 minutes. Aspirate the liquid and repeat the washing three times. Keep the last washing solution until before the hybridization reaction to prevent the sample from drying.

[0041] (II) Probe design and synthesis: The specific steps are as follows:

[0042] (1) Design of nicking-fillable padlock probes: The nicking-fillable padlock probe consists of three key regions, namely the target sequence recognition region, the detection functional region, and the non-related sequence. Among them, the target sequence recognition regions are located at the 5' end and 3' end of the probe, each containing a 20-nucleotide (nt) sequence complementary to the target RNA. A gap with an adjustable length is designed in the middle, and this gap needs to correspond to a specific region of the target RNA. In this example, the length of the gap is set to 8 nt. The sequence of the detection functional region is designed to be reverse complementary to the circularization primer sequence. The non-related sequence ensures that it has only a very short overlap with the human genome sequence to avoid non-specific binding. In this example, GAPDH (human) is selected as the model gene, and the sequence of the nicking-fillable padlock probe gfPLP-GAPDH used for the corresponding target site is: 5′-agcttgacaaagtggtcgttaaaattcactcatcagtgcgtctatttagtggagccagtcactcacttaaaagccaaattcgttgtcatacc-3′ (Sequence number: SEQ ID NO.01).

[0043] (2) Probe synthesis: The probes were synthesized by Sangon Biotech Co., Ltd. After receiving the centrifuge tube containing the dry powder probes, first centrifuge at 4000 rpm for 60 s to precipitate the dry powder to the bottom of the tube. Subsequently, add an appropriate amount of sterile and enzyme-free water to adjust the probe concentration to 100 μM. After closing the tube cap, shake well and store at -20 °C for later use.

[0044] (3) Protocol for targeted RNA in situ direct sequencing technology: The specific steps are as follows:

[0045] (1) Hybridization of the nicking-fillable padlock probe with the target gene: Before the experiment starts, restore all reactants to room temperature. Add a hybridization reaction mixture with a final concentration of 6×SSC, 10% formamide, 5% PEG4000, and 0.1 μM nicking-fillable padlock probe to the sample. React in an incubator at 42 °C for 4 h to specifically hybridize the targeting sequence recognition region of the nicking-fillable padlock probe with the target RNA molecule in situ. After the hybridization is completed, rinse 3 times with 0.1% DEPC-PBST solution.

[0046] (2) Filling and ligation of the probe nicks: After completing the washing in the previous step, add 50 μL of the filling and ligation reaction solution to one group of samples. The final concentrations of each component in the system are 50 μM dNTP, 0.2 μg / μL BSA, 20% glycerol, 1 mM ATP, 6 mM MgCl2, 1×RT buffer, 1 U / μL RiboLock RNase inhibitor (Thermo), 1.5 U / μL SplintR Ligase (NEB), and 1.5 U / μL RevertAid H Minus M-MuLV Reverse Transcriptase (Thermo). Add the reaction solutions lacking SplintR Ligase (NEB) and lacking RevertAid H Minus M-MuLV Reverse Transcriptase (Thermo) to the other two groups respectively. React in an incubator at 42 °C for 1 h. After the reaction is completed, rinse 3 times with 0.1% DEPC-PBST solution.

[0047] (3) Hybridization of the rolling circle amplification primer: After discarding the washing solution, add the reaction solution to the three groups of samples. The final concentrations of the rolling circle amplification primer are 6×SSC, 10% formamide, 5% PEG4000, and 0.5 μM. The sequence of this amplification primer is 5′-ggctccactaaatagacgca-3' (Sequence No.: SEQ ID NO.02). Incubate at 42 °C for 30 min to hybridize the rolling circle amplification primer with gfPLP. After the incubation is completed, rinse 3 times with 0.1% DEPC-PBST solution.

[0048] (4) Rolling circle amplification: After completion of washing, discard the washing solution, and add 50 μL of a rolling circle amplification reaction solution containing 5% Glycerol, 0.2 μg / μL BSA, 5% PEG4000, 1×Equiphi29 polymerase buffer (Thermo), 1 mM DTT, 1 mM dNTPs, and 1 U / μL Equiphi29 DNA polymerase (Thermo) to the sample. First, incubate at 42 °C for 3 h, and then continue to incubate overnight in a 30 °C incubator. Before performing subsequent experiments, discard the reaction solution and rinse 3 times with 0.1% DEPC-PBST solution.

[0049] (4) Detection probe hybridization: The specific steps are as follows:

[0050] (1) Bridging splint probe hybridization: Add a reaction solution containing 6×SSC, 10% formamide, 5% PEG4000, and 0.5 μM bridging splint probe to the sample, and incubate at 42 °C for 30 min to enable the above-mentioned rolling circle amplification product to hybridize with the bridging splint probe. The bridging splint probe in this example is: 5′-aggaaatgagcttgacaaagagcgattataccaagcgcga-3' (SEQ ID NO.03). After completion of the reaction, rinse 3 times with 0.1% DEPC-PBST solution.

[0051] (2) Fluorescent detection probe hybridization: Add a reaction solution containing 6×SSC, 10% formamide, 5% PEG4000, and 0.1 μM fluorescent detection probe to the sample. Incubate at 37 °C for 30 min to enable the bridging splint probe to hybridize with the fluorescent detection probe. The fluorescent detection probe in this example is 5'-tcgcgcttggtataatcgct-3' (SEQ ID NO.04), and the 5′ end is labeled with a fluorescent group. After completion of the reaction, rinse three times with 0.1% DEPC-PBST. After completion of the fluorescent detection probe hybridization reaction, air-dry the cell sample. Finally, add 0.5 μg / mL DAPI to stain the cell nuclei. The sealed sample can be examined and photographed under a fluorescence microscope, and the detection results are as Figure 2 shown.

[0052] Example 2 Verification of the feasibility of a complete experimental protocol using synthetic sequencing method on A549 cell slides (the principle is as Figure 3 shown)

[0053] (1) Sample preparation and pretreatment: The specific steps are the same as those in Example 1.

[0054] (2) Protocol for targeted RNA in situ direct sequencing technology: The specific steps are as follows:

[0055] (1) Hybridization of the gap-filled padlock probe with the target gene: Before the experiment starts, restore all reactants to room temperature. Add a hybridization reaction mixture with a final concentration of 6×SSC, 10% formamide, 5% PEG4000, and 0.1 μM gap-filled padlock probe to the sample. The gap-filled padlock probe used in this example is SEQ ID NO.01. React in an incubator at 42 °C for 4 h to enable the target sequence recognition region of the gap-filled padlock probe to specifically hybridize with the target mRNA molecule in situ. After the hybridization is completed, rinse with 0.1% DEPC-PBST solution three times.

[0056] (2) Filling and ligation of the probe gap: After completing the washing in the previous step, add 50 μL of the filling and ligation reaction solution dropwise to the sample. The final concentrations of each component in the system are 50 μM dNTP, 0.2 μg / μL BSA, 20% Glycerol, 1 mM ATP, 6 mM MgCl2, 1×RT buffer, 1 U / μL RiboLock RNase inhibitor (Thermo), 1.5 U / μL SplintRLigase (NEB), and 1.5 U / μL RevertAid H Minus M-MuLV Reverse Transcriptase (Thermo). React in an incubator at 42 °C for 1 h. After the reaction is completed, rinse with 0.1% DEPC-PBST solution three times.

[0057] (3) Hybridization of the rolling circle amplification primer: After discarding the washing solution, add the reaction solution dropwise to the sample. The final concentrations of each component are 6×SSC, 10% formamide, 5% PEG4000, and 0.5 μM rolling circle amplification primer. Incubate at 42 °C for 30 min to enable the rolling circle amplification primer to hybridize with the gap-filled padlock probe. The rolling circle amplification primer used in this example is SEQ ID NO.02. After the incubation is completed, rinse with 0.1% DEPC-PBST solution three times.

[0058] (4) Rolling circle amplification: After completing the washing, discard the washing solution, and add a rolling circle amplification reaction solution containing a final concentration of 5% Glycerol, 0.2 μg / μL BSA, 5% PEG4000, 1×Equiphi29 polymerase buffer (Thermo), 1 mM DTT, 1 mM dNTPs, and 1 U / μL Equiphi29 DNA polymerase (Thermo) to the sample. First, incubate at 42 °C for 3 h, and then continue to incubate overnight in an incubator at 30 °C. Before conducting subsequent experiments, discard the reaction solution and rinse with 0.1% DEPC-PBST solution three times.

[0059] (3) Sequencing-by-synthesis multiple-round detection scheme: The specific steps are as follows:

[0060] (1) Pre-treatment before sequencing-by-synthesis detection: After completing the rolling circle amplification step, wash the sample with 65% formamide 1 - 3 times, 5 min each time, and then rinse the sample three times with 0.1% DEPC-PBST.

[0061] (2) Detection anchor hybridization: Add a hybridization reaction solution with final concentrations of 2×SSC, 20% formamide, 5% PEG4000, and 0.5 μM detection anchor to the sample. React in an incubator at 30 °C for 30 min to hybridize the detection anchor, which serves as a sequencing extension primer, to the rolling circle amplification product. The detection anchor sequence used in this example is: 5′-gccaaattcgttgtcatacc-3' (SEQ ID NO.05). After the reaction, discard the washing solution, first wash 3 times with 0.1% DEPC-PBST, then fix with 4% PFA for 10 min, and finally wash the sample once again with 0.1% DEPC-PBST.

[0062] (3) Hot reaction: Add a mixture containing final concentrations of 1 μM hot-dNTP, 0.02 U / μL sequencing DNA polymerase, 8% Glycerol, and 1× sequencing system buffer to the sample, and react in an incubator at 50 °C for 20 min.

[0063] (4) Cold reaction: Add a mixture containing final concentrations of 5 μM cold-dNTP, 0.02 U / μL sequencing DNA polymerase, 8% Glycerol, and 1× sequencing system buffer to the sample, and react in an incubator at 50 °C for 10 min. After the reaction, discard the reaction solution, wash the sample with TBST buffer (pH 6.5), then add 2× hybridization buffer (containing 4×SSC, 40% Formamide) dropwise onto the sample, and incubate at 30 °C for 15 min to stabilize the hybridization structure.

[0064] (5) Mounting and fluorescence imaging: After the hybridization stabilization reaction, wash the sample with TBST buffer (pH 6.5) 2 times, 5 min each time, to eliminate some fluorescence background. After the last wash, air-dry the sample, add 0.5 μg / mL DAPI to stain the cell nuclei. The mounted sample can be examined and photographed under a fluorescence microscope.

[0065] (6) CMR Reaction (Fluorescence & Blocking Group Removal): After completing fluorescence imaging, soak the cover glass in TBST buffer (pH 6.5) and then rinse it 3 times. Discard the last wash solution, and then add the prepared reaction solution dropwise onto the sample. The final concentrations of each component are 25 mM aqueous THPP solution, 50 mM Tris-HCl, 0.05% Tween 20, 0.2 M NaCl, and 5% PEG4000. Incubate at 50 °C for 20 min, 4 °C for 5 min, and 30 °C for 10 min in sequence. After the reaction, add hybridization buffer (containing 4×SSC and 40% Formamide), and incubate at 30 °C for 15 min to stabilize the hybridization structure again.

[0066] (7) Background Washing after Group Cleavage: The first wash solution after group cleavage contains 0.05% Tween20 and 0.2 M NaCl. The second wash solution contains 0.05% Tween 20 and 0.1 M NaCl. The third wash solution contains 0.05% Tween 20 and 5% PEG4000. Each wash is maintained in an incubator at 30 °C for 1 min.

[0067] (8) Multiple Detection Cycles: Repeat the operations in steps (3) to (7) to achieve multiple rounds of fluorescence signal acquisition, and repeat the detection rounds 8 times according to the target sequencing length.

[0068] (9) Multiple Round Data Integration: Align the fluorescence imaging results of each round through image analysis software, analyze the base sequence according to the sequencing time sequence, and finally clarify the continuous sequencing data of the target nucleic acid. The detection results are as Figure 4 shown.

[0069] Example 3: Multisite Mutation Detection on H1299 Cell Smears (The principle is as Figure 3 shown)

[0070] (I) Sample Preparation and Pretreatment: The specific steps are the same as those in Example 1.

[0071] (II) Protocol for Targeted RNA In Situ Direct Sequencing Technology: The specific steps are the same as those in Example 2. The specific sequences of the gap-filling padlock probes used in this example are shown in Table 1 below.

[0072] Table 1

[0073]

[0074]

[0075] (III) Multiple Detection Protocol for Sequencing While Synthesizing: The specific steps are as follows:

[0076] (1) Pre - treatment before sequencing by synthesis and sequencing detection: After completing the rolling circle amplification step, wash the sample with 65% formamide 1 - 3 times for 5 minutes each time, and then rinse the sample three times with 0.1% DEPC - PBST.

[0077] (2) Mutation site detection anchor hybridization: Add a hybridization reaction solution with final concentrations of 2×SSC, 20% formamide, 5% PEG4000, and 0.5 μM mutation site detection anchor to the sample. React in an incubator at 30°C for 30 minutes to hybridize the detection anchor, which acts as a sequencing extension primer, to the rolling circle amplification product. After the reaction, discard the washing solution. First, wash three times with 0.1% DEPC - PBST, then fix with 4% PFA for 10 minutes, and finally wash the sample once again with 0.1% DEPC - PBST. The specific sequences of the mutation site detection anchors used in this example are shown in Table 2 below.

[0078] Table 2

[0079] Serial number Name Sequence (5' to 3') SEQ ID NO.14 EGFR-G719-anchor aaaacaccgtgccgaacgcaccgga SEQ ID NO.15 BRAF-G469-anchor aaaaccactttcccttgtagactgt SEQ ID NO.16 NRAS-Q61-anchor aaaatctcatggcactgtactcttc SEQ ID NO.17 PIK3CA-H1047-anchor aaaattttgttgtccagccaccatg SEQ ID NO.18 KRAS-G12-anchor aaaacgtcaaggcactcttgcctac SEQ ID NO.19 KRAS-Q61-anchor aaaacctcattgcactgtactcctc SEQ ID NO.20 EGFR-S768-anchor aaaagcacacgtgggggttgtccac SEQ ID NO.21 EGFR-T790-anchor aaaagcagccgaagggcatgagctg

[0080] (3) Hot reaction: Add a mixture containing final concentrations of 1 μM hot - dNTP, 0.02 U / μL sequencing DNA polymerase, 8% Glycerol, and 1× sequencing system buffer to the sample and react in an incubator at 50°C for 20 minutes.

[0081] (4) Cold reaction: Add a mixture containing final concentrations of 5 μM cold - dNTP, 0.02 U / μL sequencing DNA polymerase, 8% Glycerol, and 1× sequencing system buffer to the sample and react in an incubator at 50°C for 10 minutes. After the reaction, discard the reaction solution, wash the sample with TBST buffer (pH 6.5), and then add 2× hybridization buffer (containing 4×SSC, 40% Formamide) dropwise to the sample and incubate at 30°C for 15 minutes to stabilize the hybridization structure.

[0082] (5) Mounting treatment and fluorescence imaging: After the hybridization stabilization reaction, wash the sample with TBST buffer (pH 6.5) two more times for 5 minutes each time to eliminate some fluorescence background. After the last wash, air - dry the sample, add 0.5 μg / mL DAPI to stain the cell nuclei. The mounted sample can be examined and photographed under a fluorescence microscope.

[0083] (6) CMR Reaction (Fluorescence & Blocking Group Removal): After completing fluorescence imaging, soak the coverslip in TBST buffer (pH 6.5), then rinse it 3 times. Discard the last wash solution, and then add the prepared reaction solution dropwise onto the sample. The final concentrations of each component are 25 mM THPP aqueous solution, 50 mM Tris-HCl, 0.05% Tween 20, 0.2 M NaCl, and 5% PEG4000. Incubate at 50 °C for 20 min, 4 °C for 5 min, and 30 °C for 10 min in sequence. After the reaction, add hybridization buffer (containing 4×SSC, 40% Formamide), and incubate at 30 °C for 15 min to stabilize the hybridization structure again.

[0084] (7) Background Washing after Group Cleavage: The first wash solution after group cleavage contains 0.05% Tween20 and 0.2 M NaCl. The second wash solution contains 0.05% Tween 20 and 0.1 M NaCl. The third wash solution contains 0.05% Tween 20 and 5% PEG4000. Each wash is maintained in a 30 °C incubator for 1 min.

[0085] (8) Multiple Detection Cycles: Repeat the operations in steps (3) to (7) to achieve multiple rounds of fluorescence signal acquisition, and repeat the detection rounds according to the target sequencing length.

[0086] (9) Elution of the Detection Anchor for Mutation Sites: After completing the filling detection of the target nucleic acid sequence, elute the detection anchor for the mutation site. The concentrations of each component in the elution solution added to the sample are 2×SSC, 5% SSD, 50% formamide, and 0.001 M EDTA. Incubate in a 37 °C incubator for 10 min, repeat 3 times, and complete the stripping of the detection anchor for the mutation site.

[0087] (10) Hybridization of the Detection Anchor for Barcodes: Add a hybridization reaction solution with final concentrations of 2×SSC, 20% formamide, 5% PEG4000, and 0.5 μM detection anchor for barcodes to the sample. React in a 30 °C incubator for 30 min. After the reaction, discard the wash solution. First, wash 3 times with 0.1% DEPC-PBST, then fix with 4% PFA for 10 min, and finally wash the sample once again with 0.1% DEPC-PBST. In this example, the specific sequence of the detection anchor for barcodes used is: 5′-atcagtcgcgcttggtataatcgct-3' (SEQ ID NO.22)

[0088] (11) Multiple-round detection loop: Repeat the operations in steps (3) to (7) to achieve multiple-round fluorescence signal acquisition, and repeat the detection rounds 3 - 8 times according to the barcode length.

[0089] (IV) Data quality control and barcode recognition process: Based on the fluorescence imaging data generated by multiple-round sequencing, data quality control and target sequence analysis are achieved through the following steps:

[0090] (1) Sequencing data decoding and preprocessing: Image data parsing: Decode the multiple-round fluorescence imaging data through a customized image processing method to generate an original data set containing base sequences, base quality scores, and spatial coordinates; Barcode structure division: According to the predefined coding rules, parse the first 5 bases of the sequencing sequence as the probe barcode (pos_barcode), and define the 6th - 8th bases as the mutant cDNA sequence (mut_cDNA); Quality assessment and correction: Quantitatively evaluate the base quality of each round based on the Phred quality score, set a dynamic quality threshold (Q≥20), mark the bases below the threshold as "N", and perform three iterative filtrations to eliminate low-confidence data.

[0091] (2) Barcode quality control and matching: Primary filtration: Eliminate the entries containing "N" in the mutant cDNA sequence (mut_cDNA), and retain the sequence data with clear mutation sites; Secondary filtration: Perform secondary filtration on the entries with a proportion of ambiguous bases (N) in the probe barcode (pos_barcode) exceeding 50%, reducing background noise interference; Dynamic threshold optimization: Establish a round-specific quality threshold according to the base quality distribution of multiple-round sequencing, and screen the data with a high-quality round proportion ≥80% for subsequent analysis; Precise matching: Compare the quality-controlled probe barcode (pos_barcode) with the pre-constructed barcode database to screen valid data.

[0092] (3) Reverse complementary sequence conversion and amino acid decoding: Sequence reverse complementary conversion: Convert the mutant cDNA sequence (mut_cDNA) into a reverse complementary sequence to generate the original mRNA sequence (mut_mRNA); Codon - amino acid mapping: Based on the standard genetic codon table, convert the mut_mRNA sequence into the corresponding amino acid type and single-letter abbreviation according to the triplet codon rule; Data integration and output: Associate mutation site information, spatial coordinates, amino acid type, and gene name to generate a structured data set and store it in an analyzable standard format. The final experimental results and mutation detection results are as Figure 5 shown.

[0093] As described above, it is only the preferred embodiment of the present invention, so the scope of implementation of the present invention cannot be limited thereby. That is, equivalent changes and modifications made according to the scope of the present invention patent and the content of the specification should still fall within the scope covered by the present invention.

Claims

1. An in-situ capture, amplification, and sequencing method for RNA target sequences, characterized in that: At least one padlock probe is adopted, and each padlock probe corresponds to an RNA target sequence with a length of at least 1 base. The padlock probe is a single-stranded DNA probe phosphorylated at the 5'-end and containing natural or unnatural bases, and includes a 5'-end sequence and a 3'-end sequence complementary to the upstream and downstream sequences of the RNA target sequence, as well as an intermediate sequence not complementary to the RNA target sequence; specifically, the following steps are included: (1) Hybridize at least one padlock probe with at least one RNA target sequence in the sample to be tested; (2) Use the 3'-end sequence of the at least one padlock probe as a primer for reverse transcription to generate cDNA complementary to the RNA target sequence; (3) Use a DNA ligase capable of ligating DNA with RNA as a template to ligate the 3'-end of the cDNA with the phosphorylated 5'-end of the padlock probe to form a circular DNA molecule; (4) Perform rolling circle amplification using the circular DNA molecule in step (3) as a template to obtain a rolling circle amplification product; (5) Perform in-situ sequencing on the cDNA part complementary to the RNA target sequence in the rolling circle amplification product to obtain the sequence information of the RNA target sequence.

2. The in-situ capture, amplification and sequencing method of an RNA target sequence according to claim 1, characterized in that: The sample to be tested is selected from cultured cells, cells in tissues, and cells in tissue sections.

3. The in-situ capture, amplification and sequencing method of an RNA target sequence according to claim 1, characterized in that: The intermediate sequence of the at least one padlock probe has a sequence complementary to the rolling circle amplification primer.

4. The in-situ capture, amplification and sequencing method of an RNA target sequence according to claim 1, characterized in that: The reverse transcription is carried out using RevertAid H Minus M-MuLV reverse transcriptase.

5. The in-situ capture, amplification and sequencing method of an RNA target sequence according to claim 1, characterized in that: The DNA ligase is SplintR Ligase.

6. The in-situ capture, amplification and sequencing method of an RNA target sequence according to claim 1, characterized in that: The rolling circle amplification is carried out using Equiphi29 DNA polymerase.

7. The in-situ capture, amplification and sequencing method of an RNA target sequence according to claim 1, characterized in that: It also includes hybridizing with a bridging splint probe and a fluorescence detection probe after the rolling circle amplification to detect the rolling circle amplification product.

8. The in-situ capture, amplification and sequencing method for an RNA target sequence according to claim 1, characterized in that: The in-situ sequencing is carried out in a sequencing-by-synthesis manner.

9. The in-situ capture, amplification and sequencing method of an RNA target sequence according to claim 8, characterized in that: It also includes pre-treating the rolling circle amplification product before the in-situ sequencing in step (5), and the pre-treatment includes washing with a formamide solution and DEPC-PBST.

10. The in-situ capture, amplification and sequencing method of an RNA target sequence according to claim 9, characterized in that: During the in-situ sequencing process, multiple rounds of Hot reactions and Cold reactions are carried out to achieve multiple rounds of fluorescence signal acquisition.

Images