SNP (Single Nucleotide Polymorphism) site and application thereof

By screening the SNP sites at position 2132138 of chromosome 10 of bee, and developing detection methods and primer pairs, the problem of long trait evaluation of the fourth dorsal plate of bee was solved, and the cultivation of high-quality bee varieties was achieved efficiently breeding.

CN120330338APending Publication Date: 2025-07-18GUIZHOU PROVINCIAL MODERN AGRI DEV RES INST (GUIZHOU PROVINCIAL MODERN RURAL DEV RES CENT GUIZHOU PROVINCIAL RES INST OF RURAL ECONOMIC & SOCIAL DEV GUIZHOU PROVINCIAL AGRI PROD PROCESSING RES INST) +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510242521.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-03-03
Publication Date
2025-07-18

AI Technical Summary

Technical Problem

The existing technology is difficult to effectively judge and utilize the long traits of the fourth back plate of Chinese bees, which affects the evaluation of honey collection efficiency of bees and the cultivation of high-quality bee varieties.

Method used

By screening out the SNP site at position 2132138 of chromosome 10 (polymorphism is C/T), KASP primer pairs were developed for detection, and the combination kit was used to identify the long traits of the fourth dorsal plate of bee and achieving molecular marker-assisted breeding.

Benefits of technology

The accurate identification of the long traits of the fourth back plate of bee are achieved, and bee varieties with high honey collection efficiency can be selected to improve the efficiency and quality of bee breeding.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120330338A_ABST
    Figure CN120330338A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of animal breeding, in particular to an SNP site and application thereof. The SNP site is located at the 2132138 site of a No.10 chromosome of bees, and the polymorphism is C / T. The SNP locus related to the fourth backboard length character of the bees is obtained through screening on the basis of a whole genome association analysis result of bee sample data. Based on the detection result of the SNP site, the fourth backboard length character of the bees can be judged, and then the honey collecting efficiency of the bees is judged. The SNP locus provided by the invention can be applied to cultivation of high-quality bee varieties, and has important value in bee breeding.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of animal breeding, and particularly relates to an SNP locus and its application. Background Art

[0002] Apis cerana cerana ( Apis cerana , hereinafter referred to as "A. c. cerana") is a bee resource with important ecological and economic value, and has also formed rich local resource types in diverse geographical environments, showing different morphological characteristics, biological characteristics and production performances. Various genetic characteristics of the bee colony will affect its production performance, including honey yield, disease resistance, foraging ability, etc. Excellent bee populations often have higher productivity. Therefore, effectively evaluating the morphological traits of A. c. cerana is an important means to explore, protect, identify and utilize bee species resources, and is also a necessary method for evaluating the performance of bee species in beekeeping production.

[0003] Molecular markers are an effective tool that can be used for the improvement of bee populations. Developing molecular markers related to bee morphology is beneficial to the cultivation of high-quality bee varieties. The length of the fourth tergite is one of the important morphological traits of bees. The fourth tergite is located on the abdomen of bees, and the honey sac of bees is also located on the abdomen of bees. The length of the fourth tergite indirectly reflects the honey collection ability and efficiency of bees. Developing molecular markers related to the trait of the fourth tergite length is beneficial to the cultivation of high-quality bee species. Summary of the Invention

[0004] In order to solve the problems existing in the prior art, the present invention provides an SNP locus and its application.

[0005] In a first aspect, the present invention provides an SNP locus. Based on the genome version PRJNA738447, the SNP locus is located at position 2132138 of chromosome 10 of bees, and the polymorphism is C / T.

[0006] Further, the SNP locus is located at position 301 of the nucleotide sequence shown in SEQ ID NO.1, and the polymorphism is C / T.

[0007] The nucleotide sequence shown in SEQ ID NO1 is as follows: GACTTTGCGCTATATTAAATCTATTAAAAAATGTCTAAATGTGCGTTTACTTTTAATTAAAAATTTCATCAATATTTATCAAATCTTATGAACTTTTTGTCATTATATTTTTCTTTTATATTTTATTTTATGCTCATTCTATTCATTTTATCTTATATACCATTTTTTGCTTGTTAGATTTACAAATATAAAATATTTGTTGTTATCCATAAAAGTATTAGTCTCGTACGCTTGTTATTTACAATTTTCCTGGTGAAAATAAATCTTTCTCTTCGATTTATTTCATTTTATGTTTGATTCTACTTTTACATAAAAATAATCGAATAAATATTTGAATTATTTTTAATAACTTTTTTGCGCAATAACTAATTTGAAATTTTTTATTATTTTTTTAATAACTATTAATGTTAACAAATGTGAAATACATATATTTAAAAATAGACTCAATAATAATAATTTTAAATTAATTAACAATATTCGCGATTTTATATTTTTCCTTTTTTTTATTCTTTTATACATTGTTTTTAATAGTATTTTTATTTAAGTTTTATCGAATATTGATTTTTCTTTTATAAAAGAATTTAAGTTGATGTACAAGTAT。

[0008] In a second aspect, the present invention provides a KASP primer pair for amplifying the aforementioned SNP locus, comprising: F1: 5'-TTTCATTTTATGTTTGATTCC-3', F2: 5'-TTTCATTTTATGTTTGATTCT-3', R: 5'-ATTTCAAATTAGTTATTGCGCAAAAA-3'.

[0009] Further, the F1 and F2 respectively carry different fluorescent labels (also known as fluorescent tags), and the fluorescent labels include one or more of FAM, TET, HEX, ROX, Cy3, Cy5, Alexa Fluor, SYBR Green, DAPI, FITC or Texas Red.

[0010] For example, F1 is linked to GAAGGTGACCAAGTTCATGCT (FAM) at the 5' end, and F2 is linked to GAAGGTCGGAGTCAACGGATT (HEX) at the 5' end.

[0011] In a third aspect, the present invention further provides a kit, which includes the SNP sites as described above, or the primer pairs as described above.

[0012] In a fourth aspect, the present invention provides the use of the SNP sites as described above, or the primer pairs as described above, or the kit as described above in any of the following: i) Identifying the length trait of the fourth tergite of bees, ii) Breeding bees with high honey collection ability, iii) Improving the germplasm resources of bees, iv) Molecular marker-assisted breeding of bees.

[0013] Furthermore, the use includes: For the test bees to be detected, detecting the polymorphism of the SNP sites as described above, and judging the length trait of the fourth tergite of the test bees according to the detection results.

[0014] Furthermore, the detection includes one or more of gene sequencing, PCR, or probe detection.

[0015] Furthermore, judging the length trait of the fourth tergite of the test bees according to the detection results includes: For the polymorphism of the SNP sites as described above, bees with a detection result of C / C have a shorter fourth tergite length compared to bees with detection results of T / T and T / C.

[0016] The internal organs in the abdomen of bees have a honey sac. During the process of collecting nectar, bees first suck the nectar into their bodies and store it in the honey sac in the abdomen of the bees, then fly back to the hive, spit out the nectar, and finally brew it into honey. The size of the honey sac or the size of the bee's abdomen directly determines the amount of nectar that the bee can bring back at one time. The dorsal and ventral plates, including the fourth tergite, are the exoskeleton indicators that make up the bee's abdomen, and their size is directly used to judge the size of the bee's abdomen. Bees with a larger fourth tergite have a larger abdomen, can carry more nectar at one time, and have a higher honey collection efficiency.

[0017] The present invention has the following beneficial effects: Based on the data of the length of the fourth tergite of the Chinese honeybee, a SNP locus was screened through genome-wide association analysis. This SNP locus is related to the trait of the length of the fourth tergite of honeybees. By detecting this SNP locus, the identification of the trait of the length of the fourth tergite of honeybees can be achieved. The SNP locus provided by the present invention can be used for the breeding of honeybees with a specific length trait of the fourth tergite, and further for molecular marker-assisted breeding of honeybees to cultivate high-quality honeybee varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] In order to more clearly illustrate the technical solutions in the present invention or the prior art, the following will briefly introduce the drawings required for the implementation examples or the description of the prior art. Obviously, the drawings in the following description are some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.

[0019] Figure 1 It is the comparison result of the trait of the length of the fourth tergite of honeybees with different genotypes of the SNP locus Chr10_2132138 provided in Example 2 of the present invention. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0020] To make the objectives, technical solutions, and advantages of the present invention clearer, the following will clearly and completely describe the technical solutions in the present invention with reference to the drawings in the present invention. Obviously, the described embodiments are some, but not all, of the embodiments of the present invention. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts fall within the scope of protection of the present invention.

[0021] For the experimental methods involved in the following embodiments, if not specifically defined, conventional experimental methods in the art can be used, such as referring to the experimental manuals in the art or the manufacturer's instructions.

[0022] For the experimental materials and reagents involved in the following embodiments, if not specifically defined, they can all be commercially purchased.

[0023] Example 1 The present invention provides a method for screening SNP loci and the screened SNP loci, including the following processes: 1. The present invention is based on 110 samples of Apis cerana cerana, and detects the length of its fourth tergite. After dissecting the above worker bees, genomic DNA of the thoracic tissue of the worker bees is extracted, and then a library construction is carried out using the Truseq Nano DNA HT kit (Illumina, USA). The DNA is randomly fragmented into fragments of 350 bp, and after end repair, adding a polyA tail, adding sequencing adapters, amplification, purification and other steps, a DNA library is obtained. The insert size of the library is quality inspected using Agilent 2100, and the effective concentration of the library is accurately quantified using the qPCR method. After the quality meets the standard, the DNA library construction is completed.

[0024] 2. Genome sequencing, alignment and SNPs identification: After the sample library construction is successful, the sample library is subjected to genome sequencing based on the Illumina HiseqPE150 platform (Illumina, USA). During the sequencing process, low-quality reads are deleted to ensure the result quality [quality control standard: delete reads containing more than 10% unknown nucleotides, delete reads containing adapter sequences, and delete reads with low-quality (phred quality < 5) base content exceeding 50% of the length]. Finally, each single bee sample generates more than 4.5 G of high-quality paired-end reads clean reads, and Q20 and Q30 are above 90% and 85% respectively.

[0025] 3. The obtained high-quality paired-end reads clean reads are aligned to the reference genome Apis cerana (Genbank accession number: PRJNA738447) using the BWA 0.7.8 software. The alignment results are de-duplicated using the SAMTOOLS 1.15 software, and the average alignment rate of the population samples is guaranteed to be above 95%, and the average sequencing depth of the genome is above 20X.

[0026] 4. The Bayesian model in the SAMTOOLS 1.15 software is used to detect population SNPs, and high-quality SNPs are screened according to the quality control standard [delete SNPs with a sequencing error rate > 1% (Q20 quality control), delete SNPs with an interval of less than 5 bases between adjacent SNP sites, and delete SNPs with a coverage depth exceeding 1 / 3 to 5 times the average depth]. The detected SNPs are annotated using the ANNOVAR 20130520 software to identify exon regions, intron regions, alternative splicing sites, regions upstream and downstream of genes, gene spacer regions, and distinguish synonymous mutation SNPs and non-synonymous mutation SNPs.

[0027] 5. Genome-wide association analysis: Genome-wide association studies (GWAS) were carried out based on the mrMLM 1.3 software to clarify the association between the fourth tergite length trait and SNPs loci. The quality control standard for SNPs was referred to MAF > 5%, and the multi-locus random mixed linear model was selected for the model.

[0028] Table 1 Association between the fourth tergite length phenotype of bees and SNPs

[0029] Finally, multiple SNPs loci related to the fourth tergite length trait were obtained in the present invention. Among them, the locus Chr10_2132138 (located at the 2,132,138th position on chromosome 10 of bees, with polymorphism C / T) was relatively significant. Based on this locus, a molecular marker was developed, which was located at the 301st position of the nucleotide sequence shown in SEQ ID NO.1, with polymorphism C / T.

[0030] Example 2 1. In the present invention, 107 Chinese honeybee samples were selected to carry out verification work to verify the effect of the SNPs loci involved in Example 1. Specifically, these 107 Chinese honeybees were sequenced, and the fourth tergite length of 107 bees was measured using a microscopic measurement system to obtain the fourth tergite length data and SNP data of 107 bees; grouping was carried out according to the genotype types at the SNPs loci, and SPSS 16.0 software was used to perform a significant difference analysis on the fourth tergite length data of different groups to compare whether there were differences in the fourth tergite length among different genotypes.

[0031] Finally, as shown in Figure 1 , Table 2 and 3, 10 Chinese honeybees showed the C / C genotype, 26 Chinese honeybees showed the T / C genotype, and 71 Chinese honeybees showed the T / T genotype. Through Student-Newman-Keuls, Tukey HSD, LSD, and Duncan data analysis, the C / C genotype, T / C genotype, and T / T genotype showed significant differences (P < 0.05). The fourth tergite length of Chinese honeybees with the C / C genotype was significantly smaller than that of Chinese honeybees with the T / T genotype and T / C genotype.

[0032] Table 2 Comparison of the fourth tergite length of individuals with different genotypes at the Chr10_2132138 locus in Chinese honeybees

[0033] * indicates P < 0.05, with significant differences.

[0034] Table 3 Comparison of the fourth tergite length of individuals with different genotypes at the Ch10_2132138 locus in Chinese honeybees

[0035] Based on the above correlation relationship, the genotype of the Chr10_2132138 locus can be detected by gene sequencing, and then it can be determined whether the genotype of the bee at this locus is C / C, C / T or T / T. According to the identification result, it can be obtained whether the length of the fourth tergite of the bee is long or short. Based on the relationship between this locus and the bee traits, when actually breeding bee varieties, bees with a specific length of the fourth tergite can be selected, and then bee varieties with high honey collection efficiency can be cultivated.

[0036] 2. The present invention provides a KASP primer pair, including: F1: 5'-TTTCATTTTATGTTTGATTCC-3', F2: 5'-TTTCATTTTATGTTTGATTCT-3', R: 5'-ATTTCAAATTAGTTATTGCGCAAAAA-3'.

[0037] F1 is ligated with GAAGGTGACCAAGTTCATGCT (FAM fluorescent linker) at the 5' end, and F2 is ligated with GAAGGTCGGAGTCAACGGATT (HEX fluorescent linker) at the 5' end.

[0038] Before actual detection, the primer pair is labeled with a fluorescent dye, and then after PCR amplification and fluorescence detection, the polymorphism of the SNP locus Chr10_2132138 can be judged according to the fluorescence level detection results of the FAM and HEX fluorescence channels.

[0039] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those of ordinary skill in the art should understand that they can still modify the technical solutions recorded in the foregoing embodiments, or perform equivalent replacements on some of the technical features; and these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A SNP locus, characterized in that, Based on the genome version PRJNA738447, the SNP locus is located at position 2,132,138 on chromosome 10 of the honeybee, and the polymorphism is C / T.

2. A SNP locus, characterized in that, The SNP locus is located at position 301 of the nucleotide sequence shown in SEQ ID NO.1, and the polymorphism is C / T; The nucleotide sequence shown in SEQ ID NO1 is as follows: GACTTTGCGCTATATTAAATCTATTAAAAAATGTCTAAATGTGCGTTTACTTTTAATTAAAAATTTCATCAATATTTATCAAATCTTATGAACTTTTTGTCATTATATTTTTCTTTTATATTTTATTTTATGCTCATTCTATTCATTTTATCTTATATACCATTTTTTGCTTGTTAGATTTACAAATATAAAATATTTGTTGTTATCCATAAAAGTATTAGTCTCGTACGCTTGTTATTTACAATTTTCCTGGTGAAAATAAATCTTTCTCTTCGATTTATTTCATTTTATGTTTGATTCTACTTTTACATAAAAATAATCGAATAAATATTTGAATTATTTTTAATAACTTTTTTGCGCAATAACTAATTTGAAATTTTTTATTATTTTTTTAATAACTATTAATGTTAACAAATGTGAAATACATATATTTAAAAATAGACTCAATAATAATAATTTTAAATTAATTAACAATATTCGCGATTTTATATTTTTCCTTTTTTTTATTCTTTTATACATTGTTTTTAATAGTATTTTTATTTAAGTTTTATCGAATATTGATTTTTCTTTTATAAAAGAATTTAAGTTGATGTACAAGTAT.

3. A KASP primer pair for amplifying the SNP locus recited in claim 1 or 2, characterized in that, Including: F1: 5'-TTTCATTTTATGTTTGATTCC-3', F2: 5'-TTTCATTTTATGTTTGATTCT-3', R: 5'-ATTTCAAATTAGTTATTGCGCAAAAA-3'.

4. A kit, characterized in that, Including the SNP locus described in claim 1 or 2, or the primer pair described in claim 3.

5. Use of the SNP locus described in claim 1 or 2, or the primer pair described in claim 3, or the kit described in claim 4 in any of the following: i) Identifying the length trait of the fourth tergite of the honeybee, ii) Cultivating honeybees with high honey collection ability, iii) Improving the germplasm resources of honeybees, iv) Molecular marker-assisted breeding of honeybees.

6. The application according to claim 5, wherein The said application includes: For the bees to be tested, detect the polymorphism of the SNP loci as described in claim 1 or 2, and judge the fourth tergite length trait of the bees to be tested according to the detection results.

7. The application according to claim 6, characterized in that, The detection includes one or more of gene sequencing, PCR, or probe detection.

8. The application according to claim 6 or 7, characterized in that, The judgment of the fourth tergite length trait of the bees to be tested according to the detection results includes: Regarding the polymorphism of the SNP loci as described in claim 1, bees with a detection result of C / C have a shorter fourth tergite length compared to bees with detection results of T / T and T / C.