Development and application of molecular marker for rapeseed oil content related gene BnaLTP3.A02

Abstract

The application discloses development and application of a rapeseed oil content related gene BnaLTP3.A02 molecular marker and belongs to the technical field of molecular biology. The BnaLTP3.A02 gene is screened based on whole genome correlation and serves as a key gene in a QTL (qeOC.A02.1) for regulating rapeseed oil content. The BnaLTP3.A02 gene is developed to be related to the rapeseed oil content molecular marker, and experiments find that the rapeseed oil content can be detected by using the molecular marker, so that the rapeseed variety with high oil content can be selected and bred, and the process of rapeseed high oil content breeding is accelerated.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of molecular biology, in particular to the development and application of a molecular marker of a rapeseed oil content related gene BnaLTP3.A02. BACKGROUND

[0002] It is reported that the increase of 1% of the oil content of rapeseed is equivalent to the increase of 2.3%-2.5% of the yield, which indicates that increasing the oil content of seeds is one of the most effective means to increase the oil yield. At present, there are more than one hundred genes related to the oil content of rapeseed that have been identified, but there are still few cases of using these genes related to the oil content to increase the oil content of rapeseed. Therefore, it is particularly important to use the genes related to the oil content that have been mined to breed rapeseed with high oil content.

[0003] With the continuous progress of science and technology, the wide application of genome sequencing and molecular marker technology. In the breeding of rapeseed, more and more researches on molecular markers and QTLs related to important quality traits such as oleic acid, linoleic acid, linolenic acid, erucic acid and glucosinolate are carried out. Yang Yanyu obtained F2 generation separation population by crossing non-erucic high-oleic parent HOP and non-erucic low-oleic parent Xiangyou 15, and constructed a genetic map by using SSR markers, and found two QTLs related to oleic acid content located on A5 and C5 linkage groups respectively, which can explain 59% and 16% of the phenotypic variation respectively, and the QTL located on A5 linkage group is related to FAD2 gene. Javidfar et al. obtained a RAPD marker UBC2830 fragment associated with oleic acid content, which can explain 43% of the contribution rate of oleic acid content, and the SCAR marker obtained by further conversion can be used for marker-assisted selection of high-oleic and breeding. Wang et al. investigated the seed coat color trait of 520 rapeseed materials, and then carried out genome-wide association study (GWAS) by using SNPs molecular markers, and the results showed that three SNPs located on chromosomes A05, A09 and C05 were significantly related to seed acid detergent lignin content, and were 9.27 kb, 14.22 kb and 20.86 kb away from the key genes (BnaA.PAL4, BnaA.CAD2 / BnaA.CAD3 and BnaC.CCR1) controlling seed coat color respectively. Zhou et al. took BnaC.TT2.a as a candidate gene, and analyzed the correlation between single base polymorphism of 83 germplasm resources and seed coat color and seed fatty acid, and the results showed that four linked SNPs in BnaC.TT2.a were significantly associated with total fatty acid, and the InDel deletion mutation at position 738 was significantly related to seed coat color and seed fatty acid, that is, BnaC.TT2.a plays an important role in regulating the seed coat color and seed oil content of rapeseed. However, there is no report on the development of molecular markers related to BnaLTP3.A02 gene and the oil content of Brassica napus. SUMMARY

[0004] The purpose of the present application is to provide the development and application of rapeseed oil content related gene BnaLTP3.A02 molecular marker to solve the problems existing in the prior art, and to screen the candidate gene BnaLTP3.A02 by genome-wide association analysis, and to develop the molecular marker related to the oil content of Brassica napus based on the gene. The developed molecular marker can be used to detect the high and low oil content of Brassica napus, so as to realize the assisted selection and breeding of high oil content varieties and accelerate the breeding process of Brassica napus with high oil content.

[0005] In order to achieve the above purpose, the present application provides the following scheme:

[0006] The application provides a molecular marker related to oil content of Brassica napus, the molecular marker comprising a molecular marker I and a molecular marker II, a nucleotide sequence of the molecular marker I being shown as SEQ ID NO. 1, and a nucleotide sequence of the molecular marker II being shown as SEQ ID NO. 2, wherein the molecular marker I is related to high oil content of Brassica napus, and the molecular marker II is related to low oil content of Brassica napus.

[0007] The application further provides a primer pair for amplifying the molecular marker, the primer pair comprising a primer pair I for amplifying the molecular marker I and a primer pair II for amplifying the molecular marker II, wherein a nucleotide sequence of the primer pair I is shown as SEQ ID NO. 3-4, and a nucleotide sequence of the primer pair II is shown as SEQ ID NO. 5-6.

[0008] The application further provides a kit comprising the primer pair.

[0009] The application further provides application of the molecular marker or the primer pair or the kit in identification of oil content of Brassica napus.

[0010] The application further provides application of the molecular marker or the primer pair or the kit in assisted breeding of Brassica napus.

[0011] The application further provides application of the molecular marker or the primer pair or the kit in screening of high-oil-content Brassica napus varieties.

[0012] The application further provides a method for identifying oil content of Brassica napus, comprising the steps of taking genomic DNA of Brassica napus to be tested as a template, performing PCR amplification by using the primer pair, and identifying oil content of Brassica napus according to a position of an electrophoretic band of an amplification product.

[0013] Preferably, the method for identification is as follows: if a 297 bp electrophoretic band is amplified by using the primer pair I shown as SEQ ID NO. 3-4, but no band is amplified by using the primer pair II shown as SEQ ID NO. 5-6, then the Brassica napus to be tested is identified as a high-oil-content Brassica napus variety; if a 432 bp electrophoretic band is amplified by using the primer pair II shown as SEQ ID NO. 5-6, but no band is amplified by using the primer pair I shown as SEQ ID NO. 3-4, then the Brassica napus to be tested is identified as a low-oil-content Brassica napus variety.

[0014] The application discloses the following technical effects:

[0015] 1) The application locates and screens the candidate gene BnaLTP3.A02 through whole genome association analysis, the gene BnaLTP3.A02 has a greater impact on the oil content of Brassica napus, plays a key regulatory role in the accumulation of oil in the seeds of Brassica napus, and can be used for regulatory network construction and molecular marker assisted breeding, and is suitable for large-scale popularization and application.

[0016] 2) Haplotype analysis based on BnaLTP3.A02 and the design of corresponding molecular markers can detect the oil content of Brassica napus, and can assist in the selection and breeding of high-oil-content varieties, and accelerate the process of high-oil-content breeding of Brassica napus.

[0017] 3) The molecular markers developed by the application can be applied to the identification of Brassica napus oil content varieties, and have the advantages of accurate results, simple and fast, low cost, and not affected by the environment. BRIEF DESCRIPTION OF DRAWINGS

[0018] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the drawings needed in the embodiments will be briefly introduced as follows. Obviously, the drawings in the following description are only some embodiments of the present application, and other drawings can be obtained by those skilled in the art without creative labor on the basis of these drawings.

[0019] Figure 1 The results of whole genome association analysis and gene QTL positioning (multi-year multi-point GWAS positioning) ;

[0020] Figure 2 The results of different haplotype oil content analysis;

[0021] Figure 3 Different rapeseed variety molecular marker gel electrophoresis map; Marker is a standard DNA molecule, 1-7 is the amplification product of HapA haploid molecular marker, and 8-15 is the amplification product of HapB haploid molecular marker. DETAILED DESCRIPTION

[0022] Now a variety of exemplary embodiments of the present application will be described in detail, which should not be considered as limiting the present application, but should be understood as a more detailed description of certain aspects, characteristics and embodiments of the present application.

[0023] It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the present application. Additionally, for a range of values of, for example, concentration, intensity, or molecular weight, an intermediate value of the range can be specifically recited; the inclusion of an intermediate value for a range of values of, for example, concentration, intensity, or molecular weight, is specifically claimed as disclosed herein. The upper and lower limits of such ranges can independently be included or excluded in the ranges, unless otherwise indicated herein, in the examples, or otherwise indicated by context.

[0024] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present application, the preferred methods and materials are described. All patents, patent applications, and publications mentioned herein are incorporated by reference for the disclosure and description thereof to the extent that such incorporation does not conflict with the explicit teachings of this specification. Although the foregoing application has been described in some detail by way of illustration and example for purposes of clarity and understanding, it is readily apparent to those of ordinary skill in the art in this field that various changes and modifications can be contrary to or depart from the scope and spirit of the application, as described above and claimed below. This description is intended to cover any and all adaptations or variations of the application and should not be limited to the specific embodiments set forth herein.

[0025] Various modifications and variations of the described compositions and methods of the application will be apparent to those skilled in the art from the foregoing description and teachings. Other embodiments of the application will be apparent to those skilled in the art from consideration of the specification and practice of the application disclosed herein. For example, any of the

[0026] As used herein, the terms "comprises", "comprising", "includes", "including", "has", "having", "contains", "containing", or variations thereof, are intended to be open-ended terms that mean inclusion, but not limited to, the listed material or step.

[0027] A research group of the present application used 505 Brassica napus association populations for multi-year and multi-point observation of oil content phenotype, and used GWAS technology to locate a major QTL (qeOC.A02.1) on A02 chromosome, which contributed 7.94% to the variation of total oil content. Subsequently, the LD information in the QTL interval was analyzed, and it was predicted that the BnaLTP3.A02 gene was a key gene involved in the regulation of Brassica napus seed oil content in the QTL, so BnaLTP3.A02 was a gene with important application value in Brassica napus breeding practice. Subsequently, the present application developed a molecular marker related to Brassica napus seed oil content for the gene, and verified the association between the molecular marker and Brassica napus seed oil content. The following specific examples further illustrate the above scheme.

[0028] Example 1

[0029] I. Planting of association populations and determination of oil content

[0030] 505 accessions of Brassica napus were planted in the experimental field of Oilseed Rape Engineering Technology Research Center of Huazhong Agricultural University in 2012-2013, 2013-2014, 2015-2016, 2016-2017 and 2017-2018, in the experimental field of Anhui Academy of Agricultural Sciences in 2016-2017 and 2017-2018, and in the experimental field of Sichuan Academy of Agricultural Sciences in 2016-2017. Each accession was planted in two rows, with 10 plants reserved in each row, a plant spacing of 21 cm, and a row spacing of 30 cm. Field management was carried out according to the local field management method.

[0031] At harvest, 8 single plants with uniform growth were selected from each row, and the whole plants were hung in the natural drying room for natural shade drying. Then the whole plants were threshed, and after removing impurities, about 5 grams of seeds were taken from each single plant. The seed oil content was measured using the Foss NIRSystems 5000 near-infrared instrument (Reference: Tang S, Zhao H, Lu S, et al. Genome and transcriptome-wide association studies provide insights into the genetic basis of natural variation of seed oil content in Brassica napus. Molecular Plant, 2021, 14:470-482).

[0032] II. Analysis of genomic resequencing data

[0033] The Brassica napus reference genome B. napus v4.1 was downloaded from the BnIR database (https: / / yanglab.hzau.edu.cn / ). The reads were aligned to the reference genome using the "mem -M -k 32 -t 4" code in the BWA software, the repeated results were removed using the SAM tool, and the sequence variations of the associated population were identified using the Genome Analysis Toolkit (GATK v3.6). SNPs with alignment quality less than 20 or sequencing depth less than 50 were filtered out, and finally a total of 11,700,689 SNPs were identified.

[0034] III. Genome-wide association analysis

[0035] 1. In the genome-wide association analysis, the linear mixed model provided by the FaST-LMM software package was used, 11,700,689 SNP markers were used, and the phenotype value (i.e., oil content) was used to identify QTL sites related to oil content in the whole genome (P < 0.001). Figure 1 ).

[0036] 2. A major QTL site (qeOC.A02.1) for oil content was identified on chromosome A02 of Brassica napus, and the lead SNP and about 100 kb before and after the lead SNP were defined as the QTL interval.

[0037] 3. Multi-omics analysis was used (reference: Tang S, Zhao H, Lu S, et al. Genome and transcriptome-wide association studies provide insights into the genetic basis of natural variation of seed oil content in Brassica napus. Molecular Plant, 2021, 14:470-482), and the candidate gene was determined to be BnaLTP3.A02, so the gene was selected as the key candidate gene in the QTL interval for subsequent functional verification.

[0038] Four, haplotype identification of candidate gene BnaLTP3.A02 and development of molecular markers

[0039] 1. The promoter, 3'-UTR and coding region sequences of BnaLTP3.A02 were analyzed in the association population, and two haplotypes (HapA and HapB) were identified. The average oil content of HapA haplotype was 46.44%±1.91%, and the average oil content of HapB haplotype was 45.69%±1.82%. The phenotypic difference in oil content between the two haplotypes was significant (P<0.05). Figure 2 ).

[0040] 2. Based on the sequences of the two haplotypes of BnaLTP3.A02 gene, related molecular markers were designed and developed, and the nucleotide sequences of the molecular markers are as follows:

[0041] HapA (SEQ ID NO. 1):

[0042] TGTCAGCTGTTCACAGATTTCGTATGAATTTTTACACATGATATCTATATGTTTGAATCTGAAAAATTTGCCGACTTCTAGATTAGTAGGATTAGATTAGTAGGATTTAGACCTGAATTGGCTATTAACCAAATTAAAATAAAGCATTAGACTGTGATTAGGAGTTTAATATGAATTATATAATATTTTATTTACAGATTTTTTTAATTGTCTGCATAATTTAAATGTACAAGTAAACCTCCATGCATTATCTATTATGTTTCTTTTTTTTGTAA CAGCATTAGCTATTATGTAC GC.

[0043] HapB (SEQ ID NO. 2):

[0044] GGTCAGCTGTTCACGGATTTT GTATGAATTTTTACACATGATATCTATATGTTTGAATCTGAAAAATTTACCGACTTCTAGATTAGTAGGATTAGATTAGTAGATTTAGACCTGAATTGGCTATTAACCAAATTAAAATAAAGCATTAGACTGTGATTAGGAGTTTATGATGAATTATATAATATTTTATTTACAGATTTTTTTTTAATTGTGTGCATAATTTAAATGTACAAGTAAACCTCCATGCATTATCTATTATGTTTCTTTTTTTGTAACAGCGTTAGCTATTATGTACGTTTAAGAAACAATACTTTATAAGAGAAAAATCTAGTAAACCTCCATGCATTTTGCTATTATGTACTTTCAAGCAACAATGCTATATAAGAGAAAAGCCTTTATGTCTTTCAGATAT GTAGTAAAGCTGGCCATTCC.

[0045] Note: In the above sequences, the underlined part is the primer of the molecular marker designed and developed.

[0046] The primer designed for the HapA haplotype molecular marker (SEQ ID NO. 1):

[0047] 7120D-F (SEQ ID NO. 3): 5'-TGTCAGCTGTTCACAGATTTC-3';

[0048] 7120D-R (SEQ ID NO. 4): 5'-GCGTACATAATAGCTAATGCTG-3'.

[0049] Primer designed for HapB haplotype molecular marker (SEQ ID NO. 2):

[0050] 7120G-F (SEQ ID NO. 5): 5'-GGTCAGCTGTTCACGGATTTT-3';

[0051] 7120G-R (SEQ ID NO. 6): 5'-GGAATGGCCAGCTTTACTAC-3'.

[0052] Example 2 Identification of Brassica napus plant genotypes using molecular markers

[0053] The Brassica napus plants to be tested were genotyped using the molecular markers of Example 1, wherein the Brassica napus plants to be tested were haplotype materials with extreme oil content phenotypes selected from the 505 Brassica napus plants in Example 1, wherein the materials numbered 1-7 were Brassica napus materials with high oil content, and the materials numbered 8-15 were Brassica napus materials with low oil content.

[0054] The identification process was as follows:

[0055] (1) CTAB method was used to extract Brassica napus leaf DNA

[0056] a. Take 1 cm of young leaves of each plant 2 into a 2 mL centrifuge tube, add steel balls, add 250 μL of 2% CTAB, grind on a sample grinder for 5 min, then add 500 μL of CTAB to the centrifuge tube;

[0057] b. Water bath in a 65°C water bath for 60 min, shake every 15 min;

[0058] c. After the homogenate is cooled to room temperature, add a solution of chloroform and isoamyl alcohol mixed at a volume ratio of 24:1 to the centrifuge tube, mix gently for 15 min, then centrifuge at 12000 rpm for 10 min;

[0059] d. Arrange the centrifuge tubes in order on the operation board, and aspirate the supernatant into a new 1.5 mL centrifuge tube, the aspiration volume is 500 μL;

[0060] e. Add 50 μL of potassium acetate solution to the supernatant, then add 500 μL of ice ethanol, cover the centrifuge tube cap, shake gently a few times, mix the ice ethanol and the supernatant thoroughly, and then place in the refrigerator at -20°C for 20-30 min to precipitate the genomic DNA;

[0061] f. Centrifuge the centrifuge tube after standing at 12000 rpm for 6 min, discard the supernatant, add 500 μL of 75% ethanol and stand for 5 min, discard the supernatant, repeat once, and the precipitate is the genomic DNA;

[0062] g. Place the centrifuge tube containing the DNA in a fume hood to dry, and the genomic DNA of each plant is obtained;

[0063] h. Add 200 μL of ddH2O to the dried centrifuge tube containing the DNA for DNA dissolution, and store at -20°C after dissolution.

[0064] (2) PCR amplification of molecular markers

[0065] The genomic DNA of the Brassica napus plants to be tested obtained by the CTAB method described above was used as a template, and the molecular marker primers (SEQ ID NO. 3-4 or SEQ ID NO. 5-6) designed in Example 1 were used for PCR amplification. The PCR amplification was a 10 μL reaction system, and each reaction system specifically included: 2x Taq Plus Master Mix (Vazyme) 5 μL, DNA template 2 μL, 10 μM forward primer 0.25 μL, 10 μM reverse primer 0.25 μL, ultrapure water 2.5 μL.

[0066] The PCR reaction program was: 94°C pre-denaturation for 5 min, 1 cycle; 94°C denaturation for 30 s, 56°C or 58°C annealing for 30 s, 72°C extension for 1 min, a total of 35 cycles; 72°C extension for 5 min, 1 cycle; and finally 4°C storage.

[0067] (3) Amplification product and electrophoresis analysis

[0068] The amplification products of all Brassica napus plants to be tested were electrophoresed on a 1.5% agarose gel, stained with nucleic acid dye ethidium bromide, and then imaged under ultraviolet light to obtain the genotype information of the samples to be tested, and the results are shown in Figure 3The results show that all high-oil-content Brassica napus (46.44%±1.91%) germplasm DNA templates can be amplified with the primers shown in SEQ ID NO. 3-4 (7120D) to obtain a band of about 297 bp (numbered 1-7), but cannot be amplified with the primers shown in SEQ ID NO. 5-6 (7120G); all low-oil-content Brassica napus (45.69%±1.82%) germplasm DNA templates can be amplified with the primers shown in SEQ ID NO. 5-6 (7120G) to obtain a band of about 432 bp (numbered 8-15), but cannot be amplified with the primers shown in SEQ ID NO. 3, 4 (7120D), indicating that the molecular marker developed in the application can effectively distinguish high-oil-content and low-oil-content Brassica napus germplasm.

[0069] The above-described embodiments are only to describe the preferred modes of the present application, and do not limit the scope of the present application, and various modifications and improvements to the technical solutions of the present application made by those skilled in the art without departing from the design spirit of the present application shall fall within the protection scope determined by the claims of the present application.

Claims

1. A molecular marker associated with oil content in Brassica napus, characterized in that, The molecular marker comprises a molecular marker I and a molecular marker II, the nucleotide sequence of the molecular marker I is shown as SEQ ID NO. 1, and the nucleotide sequence of the molecular marker II is shown as SEQ ID NO. 2, wherein the molecular marker I is related to low oil content of Brassica napus, and the molecular marker II is related to high oil content of Brassica napus.

2. A primer pair for detecting the molecular marker associated with oil content in Brassica napus according to claim 1, characterized in that, The primer pair comprises a primer pair I for amplifying the molecular marker I and a primer pair II for amplifying the molecular marker II, wherein the nucleotide sequences of the primer pair I are shown as SEQ ID NO. 3-4, and the nucleotide sequences of the primer pair II are shown as SEQ ID NO. 5-6.

3. A kit for detecting the molecular marker associated with oil content in Brassica napus as claimed in claim 1, characterized in that, It comprises the primer pair of claim 2.

4. Use of a primer pair according to claim 2 or a kit according to claim 3 for the identification of oil content in Brassica napus, characterized in that, If a 297 bp electrophoretic band is amplified by the primer pair I shown as SEQ ID NO. 3-4, but no band is amplified by the primer pair II shown as SEQ ID NO. 5-6, the Brassica napus to be tested is identified as a high-oil-content Brassica napus variety; if a 432 bp electrophoretic band is amplified by the primer pair II shown as SEQ ID NO. 5-6, but no band is amplified by the primer pair I shown as SEQ ID NO. 3-4, the Brassica napus to be tested is identified as a low-oil-content Brassica napus variety.

5. Use of a primer pair according to claim 2 or a kit according to claim 3 for oil content assisted breeding of Brassica napus, characterized in that, If a 297 bp electrophoretic band is amplified by the primer pair I shown as SEQ ID NO. 3-4, but no band is amplified by the primer pair II shown as SEQ ID NO. 5-6, the Brassica napus to be tested is identified as a high-oil-content Brassica napus variety; if a 432 bp electrophoretic band is amplified by the primer pair II shown as SEQ ID NO. 5-6, but no band is amplified by the primer pair I shown as SEQ ID NO. 3-4, the Brassica napus to be tested is identified as a low-oil-content Brassica napus variety.

6. Use of a primer pair according to claim 2 or a kit according to claim 3 for screening high oil content Brassica napus varieties, characterized in that, If a 297 bp electrophoretic band is amplified by the primer pair I shown as SEQ ID NO. 3-4, but no band is amplified by the primer pair II shown as SEQ ID NO. 5-6, the Brassica napus to be tested is identified as a high-oil-content Brassica napus variety; if a 432 bp electrophoretic band is amplified by the primer pair II shown as SEQ ID NO. 5-6, but no band is amplified by the primer pair I shown as SEQ ID NO. 3-4, the Brassica napus to be tested is identified as a low-oil-content Brassica napus variety.

7. A method for identifying Brassica napus plants for oil content, characterized in that, It comprises the steps of taking the genomic DNA of the Brassica napus to be tested as a template, performing PCR amplification by using the primer pair of claim 2, and identifying the oil content of the Brassica napus according to the electrophoretic band position of the amplification product; The identified method is: if a 297 bp electrophoretic band is amplified by primer pair I shown in SEQ ID NO. 3-4, but primer pair II shown in SEQ ID NO. 5-6 cannot amplify a band, then the to-be-tested Brassica napus is identified as a high-oil-content rapeseed variety; if a 432 bp electrophoretic band is amplified by primer pair II shown in SEQ ID NO. 5-6, but primer pair I shown in SEQ ID NO. 3-4 cannot amplify a band, then the to-be-tested Brassica napus is identified as a low-oil-content rapeseed variety.

Images