Method for rapidly detecting enzyme activity of gamma-glutamyl hydrolase based on liquid chromatography-mass spectrometry

Through liquid phase tandem mass spectrometry and γ-polyglutamate substrate combined with sodium acetate buffer and high-temperature inactivation, the accuracy of γ-glutamyl hydrolase enzyme enzyme enzyme activity detection was solved, and rapid and sensitive enzyme activity determination was achieved.

CN120334378APending Publication Date: 2025-07-18VITO DIAGNOSTICS CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202410060596.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2024-01-16
Publication Date
2025-07-18

AI Technical Summary

Technical Problem

Existing detection methods cannot accurately determine the enzyme activity of γ-glutamyl hydrolase. Conventional methods have problems such as low sensitivity, narrow linear range and low precision, which cannot meet the needs of fast and accurate detection.

Method used

The liquid phase tandem mass spectrometry was used, and γ-polyglutamate was used as the enzymatic substrate. The optimized reaction system was 0.25mol/L sodium acetate buffer, combined with the 100℃ water bath inactivation method to achieve enzyme activity detection.

Benefits of technology

The rapid and accurate detection of γ-glutamyl hydrolase enzyme activity is achieved, which improves the detection sensitivity and quantitative accuracy, and is suitable for evaluating organ status and disease development.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120334378A_ABST
    Figure CN120334378A_ABST
Patent Text Reader

Abstract

The method for rapidly detecting the enzyme activity of the gamma-glutamyl hydrolase based on liquid chromatography-mass spectrometry is provided for the first time, the reaction time is short, operation is easy, the detection result is accurate, sensitivity is high, and the method has wide application prospects; a substrate of an enzyme catalysis reaction is screened and researched, a substrate capable of ensuring the rapid and stable enzyme catalysis rate is found, and the detection accuracy and the reliability of a detection result are remarkably improved; an appropriate reaction system is found for enzyme activity test, and the detection sensitivity and the quantitative accuracy are improved by performing the enzyme activity test under the system; the inactivation method is improved, the inactivation effect of heating and inactivating in a water bath at 100 DEG C is optimal, the obtained chromatogram has good peak pattern, the separation degree of a product chromatographic peak and an impurity chromatographic peak is high, the interference is small, and the quantification is more accurate.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of biological sample detection, and particularly relates to a method for rapidly detecting the activity of γ-glutamyl hydrolase based on liquid chromatography-mass spectrometry. Background Art

[0002] γ-glutamyl hydrolase (GGH) is located at ch8q12.23-13.1, with a full-length gene of 24 kb and a full-length coding region of 957 bp. It contains 318 amino acids, and the molecular mass of the expressed protein is 37 kDa, containing 4 potential asparagine-linked glycosylation sites. It is predicted that there is a leader sequence composed of 24 N-terminal amino acid residues in front of it, and this sequence can regulate its entry into the endoplasmic reticulum. The GGH that enters the endoplasmic reticulum becomes an active protease after processing. This gene has been identified in many organisms, including humans, rats, mice, Drosophila melanogaster (GenBank NP_730119), Anopheles gambiae (GenBank XP_316706), Arabidopsis thaliana, and soybean. γ-glutamyl hydrolase (GGH) is a lysosomal enzyme that regulates the biosynthesis of folic acid in cells and also plays an important role in the pharmacological metabolism of folic acid antagonists such as methotrexate and pemetrexed. It also participates in an important link in amino acid metabolism, hydrolyzing γ-glutamine into glutamate and carbamic acid.

[0003] In practical applications, by detecting the activity of γ-glutamyl hydrolase in serum or urine, the development of certain diseases can be understood, the function status of organs such as the liver and kidneys can be judged, and clinical treatment and drug monitoring can be guided. Increased GGH activity has been found in MTX (methotrexate)-resistant rat hepatoma cells, human soft tissue sarcoma cell lines with intrinsic resistance to MTX, and human primary acute myeloid leukemia cells. Therefore, as an important indicator for clinical diagnosis, a rapid and accurate method for detecting GGH enzyme activity is urgently needed at present.

[0004] In the previous exploration of the present invention, common methods for detecting enzyme activity such as ultraviolet spectrophotometry and chemical analysis were used. Due to the low content of glutamate, the hydrolysis product of γ-glutamyl hydrolase, the common methods for detecting enzyme activity could not accurately determine its activity. At present, there is no liquid chromatography-tandem mass spectrometry method for measuring the activity of GGH enzyme, but there are methods for measuring the activity of other enzymes. For example, the literature "Quantification of Galactose-1-Phosphate Uridyltransferase Enzyme Activity by Liquid Chromatography-Tandem Mass Spectrometry" provides a method for measuring the activity of GALT enzyme by liquid chromatography-tandem mass spectrometry. The sample is purified and separated by reversed-phase ion-pair chromatography, and the enzyme product is detected by MS / MS (mass spectrometry) at the mass transition. Another example is the literature "Rapid Determination of CYP2C9 Enzyme Activity by Ultra-High Performance Liquid Chromatography-Tandem Mass Spectrometry", which provides an in vitro enzyme incubation tolbutamide system of ultra-high performance liquid chromatography-triple quadrupole mass spectrometry for rapid determination of the in vitro activity of CYP2C9 gene polymorphism. However, due to the differences in the biochemical properties of the detection objects, the above methods cannot be applied to the method for measuring the activity of GGH enzyme in the present invention, and further research and development on the method for detecting the activity of GGH enzyme are still needed.

[0005] Therefore, there is an urgent need to develop a method for rapidly and accurately detecting the activity of γ-glutamyl hydrolase. Summary of the Invention

[0006] Based on the deficiencies of the prior art, the present invention provides a method for rapidly detecting the activity of γ-glutamyl hydrolase based on liquid chromatography-mass spectrometry. By constructing a GGH recombinant expression plasmid (pColdV-MBP-GGH recombinant plasmid), exploring the purification conditions and system for purifying GGH recombinant enzyme by affinity chromatography, and applying the liquid chromatography-tandem mass spectrometry platform, a simple, rapid and accurate method for detecting the activity of GGH enzyme is developed with γ-polyglutamic acid as the substrate. This patent realizes for the first time the measurement of GGH enzyme activity by liquid chromatography-tandem mass spectrometry.

[0007] On the one hand, the present invention provides a method for rapidly detecting the activity of γ-glutamyl hydrolase based on liquid chromatography-mass spectrometry, and the detection of the activity of γ-glutamyl hydrolase uses γ-polyglutamic acid as the enzymatic hydrolysis substrate.

[0008] The following reaction occurs during the enzyme activity measurement process of the present invention:

[0009]

[0010] The nucleophile of Cys-110 in the active center of γ-glutamy hydrolase attacks the γ-carbonyl of the glutamic acid-γ-glutamic acid bond in γ-polyglutamic acid to form a thioacyl enzyme intermediate, then releases the amine component, and finally forms glutamic acid.

[0011] It should be noted that the meaning of enzyme activity is the ability of an enzyme to catalyze a chemical reaction. In the present invention, it can be measured by the amount of the product glutamic acid catalyzed by a unit enzyme per unit time. In this invention patent, using a liquid chromatography-tandem mass spectrometry platform, with γ-polyglutamic acid as the substrate, adding purified γ-glutamy hydrolase with a known concentration, measuring the concentration of glutamic acid at different times and constructing a concentration curve, the enzyme activity of γ-glutamy hydrolase per unit time can be obtained.

[0012] Since γ-glutamy hydrolase acts as a lysosomal enzyme, regulates folic acid biosynthesis, and can enzymatically hydrolyze folic acid antagonists such as methotrexate and pemetrexed, and participates in amino acid metabolism, capable of hydrolyzing γ-glutamine into glutamic acid and carbamic acid, therefore, in conventional methods, folic acid, methotrexate, γ-glutamine, etc. are often used as enzymatic hydrolysis substrates for measuring the enzyme activity of γ-glutamy hydrolase. However, experiments show that for these conventionally selected substrates, the decomposition rate is slow and the decomposition is unstable, resulting in problems such as low sensitivity, narrow linear range, and low precision in enzyme activity determination, and it is impossible to accurately measure the enzyme activity of γ-glutamy hydrolase.

[0013] In the previous research of the present invention, various substrates were tested, but the vast majority of substrates could not be used to measure the enzyme activity of GGH because there was steric hindrance between their decomposition sites and the GGH enzyme protein, resulting in a slow and unstable decomposition rate. Through a large amount of theoretical research and experimental demonstration, the present invention found a substrate suitable for measuring the enzyme activity of GGH, namely γ-polyglutamic acid, which can significantly increase the reaction rate of the enzyme-catalyzed reaction, ensure the stability of the enzyme-catalyzed reaction and substrate decomposition, and make the detection results accurate and reliable.

[0014] Polyglutamic acid (PGA) is polymerized from D-glutamic acid and L-glutamic acid through amide bonds. Due to different polymerization methods, polyglutamic acid mainly has two configurations: α-polyglutamic acid (α-PGA) polymerized through α-amide bonds and γ-polyglutamic acid (γ-PGA) polymerized through γ-amide bonds, with a molecular weight of 10 - 10000 kDa. Among them, α-PGA is mostly synthesized by chemical methods, while γ-PGA is mostly synthesized by biological methods.

[0015] Currently, γ-polyglutamic acid is commonly used in agricultural production as part of soil fertilizers to provide functions such as moisture retention. The present invention first applies it to the method for measuring the enzyme activity of γ-glutamy hydrolase as an enzymatic hydrolysis substrate and first proposes a method for detecting the enzyme activity of γ-glutamy hydrolase by liquid chromatography-mass spectrometry.

[0016] Further, the method includes the steps of:

[0017] (1) Pretreatment: The sample to be tested undergoes an enzymatic reaction in a reaction system.

[0018] (2) Liquid chromatography - mass spectrometry detection.

[0019] Further, the sample to be tested in step (1) is purified γ - glutamyl hydrolase.

[0020] In practical applications, serum or urine can be used as the sample to be tested in the present invention for detection, and enzyme activity data can be obtained quickly to evaluate the conditions of organs such as the kidney and the development of diseases, etc.

[0021] Further, the reaction system in step (1) includes sodium acetate buffer, enzymatic hydrolysis substrate, and internal standard.

[0022] The present invention optimizes the reaction system for the enzymatic reaction. Conventional methods for measuring enzyme activity use PBS buffer to prepare the reaction system. The experiments of the present invention prove that although PBS buffer has beneficial effects on the measurement of the enzyme activity of most enzymes, it has poor effects in the measurement of the enzyme activity of γ - glutamyl hydrolase in the present invention. The chromatographic response of the product glutamic acid is low, the product chromatographic peak overlaps with the impurity peak, and the quantification is inaccurate.

[0023] Through a large number of experiments, the present invention has found the reaction system that is most beneficial to the measurement of the enzyme activity of γ - glutamyl hydrolase, that is, using 0.25 mol / L sodium acetate buffer as the reaction system. At this time, the response of the product glutamic acid in the chromatogram is high, which is ten times that of the product glutamic acid chromatographic response under PBS buffer. The sensitivity is high, the detection result is more accurate and reliable, and the product chromatographic peak and the impurity peak are significantly separated, improving the accuracy of quantification.

[0024] The present invention believes that the above reason may be that sodium acetate, as a volatile buffer salt, provides a weakly acidic environment, which is beneficial to the activity of γ - glutamyl hydrolase, and its compatibility with chromatography and mass spectrometry is high, without inhibiting its response and not generating matrix effects during detection.

[0025] Preferably, the concentration of sodium acetate in the reaction system in step (1) is 0.25 mol / L.

[0026] Further, the internal standard in the reaction system in step (1) is L - glutamate - 2,4,4 - [d3], and the reaction system also includes bovine serum albumin.

[0027] Further, the volume ratio of the sample to be tested to γ - polyglutamic acid in step (1) is 1:1.

[0028] Furthermore, the enzymatic reaction in step (1) is carried out in a 37°C water bath, sampled for inactivation, and after centrifugation, the supernatant is taken for liquid chromatography - mass spectrometry (LC - MS) detection; the inactivation methods include any one of inactivation with 10% trichloroacetic acid, inactivation with acetonitrile, inactivation with 10% hydrochloric acid, and inactivation by 100°C water bath.

[0029] The present invention has studied the inactivation methods of enzymatic reactions and found that inactivation by 100°C water bath for 10 minutes has the best effect, manifested in better chromatographic peak shapes, higher responses of the product glutamic acid, non - trailing chromatographic peaks, fewer impurity peaks, etc. The better response of the product glutamic acid and good peak shapes improve the detection sensitivity and the accuracy of enzyme activity determination.

[0030] The principle of inactivation by 100°C water bath mainly includes three aspects: namely, heat energy causes the destruction of protein structure; heat energy promotes protein oxidation; heat energy accelerates protein degradation. Inactivation by high - temperature water bath does not introduce additional high - concentration chemical reagents, and no additional matrix effect or solvent effect will be generated during mass spectrometry detection, with better chromatographic peak shapes, higher responses of the product glutamic acid, non - trailing chromatographic peaks, and fewer impurity peaks.

[0031] Preferably, the enzymatic reaction in step (1) is carried out in a 37°C water bath for 30 minutes. During this period, 100 μl is taken every 5 minutes and transferred to a 100°C water bath for 10 minutes for inactivation. After centrifugation, the supernatant is taken for LC - MS detection.

[0032] On the other hand, the present invention provides a use of an enzymatic hydrolysis substrate for improving the accuracy of detecting γ - glutamyl hydrolase enzyme activity by liquid chromatography - mass spectrometry, and the enzymatic hydrolysis substrate is γ - polyglutamic acid.

[0033] The beneficial effects of the present invention are as follows:

[0034] 1. The present invention first proposes a method for rapid detection of γ - glutamyl hydrolase enzyme activity based on liquid chromatography - mass spectrometry, with short reaction time, simple operation, accurate detection results, high sensitivity, and broad application prospects;

[0035] 2. The substrates of enzymatic reactions have been screened and studied, and a substrate that can ensure a fast and stable enzymatic reaction rate has been found, significantly improving the detection accuracy and the reliability of detection results;

[0036] 3. A suitable reaction system for GGH enzyme activity testing has been found, that is, a 0.25 mol / L sodium acetate buffer reaction system. Under this system, the enzymatic reaction is more complete, improving the detection sensitivity and the accuracy of quantification;

[0037] 4. The inactivation method has been improved, and it has been found that inactivation by heating in a 100°C water bath has the best inactivation effect, with good chromatogram peak shapes, high separation degree between product chromatographic peaks and impurity chromatographic peaks, little interference, and more accurate quantification. Description of the Drawings

[0038] Figure 1 : Chromatogram of the product glutamic acid and its internal standard

[0039] Figure 2 : Standard curve of GGH enzyme activity

[0040] Figure 3 : Curve of the measured value of GGH enzyme activity and the time of the enzymatic reaction

[0041] Figure 4 : Chromatogram inactivated with 10% trichloroacetic acid

[0042] Figure 5 : Chromatogram inactivated with acetonitrile

[0043] Figure 6 : Chromatogram inactivated with 10% hydrochloric acid

[0044] Figure 7 : Chromatogram inactivated by water bath at 100 °C

[0045] Figure 8 : Chromatogram using 1xPBS buffer

[0046] Fig. 9 : Chromatogram using 0.25 mol / L sodium acetate buffer

[0047] Fig.10 : Curve of the measured value of GGH enzyme activity and the amount of GGH enzyme added Detailed Embodiments

[0048] The present invention will be further described in detail below in conjunction with embodiments. It should be noted that the following embodiments are intended to facilitate the understanding of the present invention and do not impose any limitations on it. The reagents not specifically mentioned in this embodiment are all known products and are obtained by purchasing commercially available products.

[0049] Example 1: Method for detecting the activity of γ-glutamyl hydrolase by liquid chromatography-mass spectrometry

[0050] 1. Self-made γ-glutamyl hydrolase

[0051] Using the self-made γ-glutamyl hydrolase as the analyte for the development of the enzyme activity detection method, the specific method is as follows:

[0052] 1.1 Construction of the GGH expression vector

[0053] The gene malE encoding MBP derived from E. coli was synthesized and ligated to the plasmid pUC57. pUC57-MBP and the vector pColdV were digested with XbaI / HindIII restriction endonucleases. The digested products were recovered by gel electrophoresis and ligated overnight at 16°C to construct the recombinant plasmid pColdV-MBP. The GGH cDNA was amplified by PCR from the cDNA of HepG2 cells. The upstream primer was designed with an NdeI restriction site at the 5′ end and the downstream primer was designed with an SmaI restriction site at the 5′ end and a 6xHis expression tag sequence using SnapGene software. The DNA fragment and the pColdV-MBP vector were digested with NdeI / SmaI, and then the target fragment was inserted into the pColdV-MBP vector using T4 DNA ligase. After transformation, screening, and amplification in E. coli DH5α, the recombinant plasmid was obtained. After sequencing analysis, the positive clone pColdV-MBP-GGH was obtained, and the sequence is shown in SEQ ID NO.1.

[0054] 1.2 Induced expression

[0055] Inoculate a single clone of E. coli BL21(DE3) transformed with pColdV-MBP-GGH into a 250 ml Erlenmeyer flask containing 50 ml of LB liquid medium (ampicillin resistant), and culture it overnight at 37°C with shaking at 200 rpm. The next day, inoculate the bacterial solution into a 2 L conical flask containing 1.5 L of LB liquid medium (ampicillin resistant) at an inoculation amount of 1%, and culture it at 37°C with shaking at 200 rpm until the OD 600 reaches 0.4 - 0.6. Add IPTG to a final concentration of 1 mmol / L, and culture it overnight at 18°C with shaking at 200 rpm. Centrifuge the bacterial solution at 8000 rpm for 10 min, and discard the supernatant.

[0056] 1.3 Purification

[0057] Add lysis buffer to the collected bacteria, and use a high-pressure cell disruptor to disrupt the cells at 700 bar until the cell suspension becomes non-viscous. After disruption, centrifuge at 4°C and 12000 rpm for 30 min, take the supernatant and filter it through a 0.45 μm filter membrane, and load the filtrate onto the purification column. Primary purification (His-tag): First, equilibrate the column with 10 mmol / L imidazole, load the supernatant of the cell lysate filtrate onto the nickel column for binding, remove the impurity proteins with 10 mmol / L imidazole, and then elute the target protein with 500 mmol / L imidazole. Secondary purification (MBP tag): First, equilibrate the column with 10 ml of buffer, load the primary purification solution onto the MBP tag column for binding, remove the impurity proteins with the equilibration buffer, and then elute the target protein with 10 mmol / L maltose. Determine the protein concentration, then add 50% glycerol, 1 mg / ml BSA, and 10 mmol / L DTT, mix well, aliquot, and store at -80°C.

[0058] 2. Enzyme activity detection:

[0059] 2.1 Pre-treatment:

[0060] 2.1.1 Standard curve

[0061] Prepare 1mg / ml glutamate standard solution, dilute 1mg / ml glutamate to 3ug / ml, and obtain the highest concentration point S8a of the working calibration. Dilute in half with distilled water to obtain S7a~S1a. Take eight 1.5ml centrifuge tubes and add 4ul 1ug / mlL-glutamate-2,4,4-[d3] (purchased from Beijing Manhag Biotechnology Co., Ltd.), 92ul 0.25mol / L sodium acetate (purchased from Solarbio), 1ul GGH enzyme and 2ul 50mg / ml BSA (purchased from Shanghai Yuanye Biotechnology Co., Ltd.), and then add 1ul S1a-S8a accordingly, vortex for 30s, and obtain S1-S8. Place S1-S8 in a 37℃ water bath for 30min, then transfer to a 100℃ water bath for 10min to inactivate, centrifuge at 12000g for 5min, take 80μL supernatant, and detect on a liquid quality control machine.

[0062] 2.1.2 Sample

[0063] Take three centrifuge tubes and add 8ul 0.5mmol / ml γ-polyglutamic acid (purchased from Sigma-Aldrich) respectively, then add 32ul L-glutamic acid-2,4,4-[d3], 736ul sodium acetate and 16ul BSA respectively, add 8ul GGH respectively, and incubate in a 37℃ water bath for 30min. During this period, take 100ul every 5min and transfer it to a 100℃ water bath for 10min to inactivate. Centrifuge at 12000g for 5min, take 80μL supernatant, and detect on a liquid chromatography-mass spectrometer.

[0064] 2.2 Liquid chromatography conditions: The liquid chromatography used a chromatographic column Gemini C18, 3 μm, 100*3 mm; column temperature: 40°C; injection volume 1 μL; flow rate: 0 4 mL / min; mobile phases included: A: water containing 0.1% formic acid, B: acetonitrile, gradient elution:

[0065]

[0066]

[0067] 2.3 Mass spectrometry conditions:

[0068] Mass spectrometer: AB SCIEX Triple QuadTM 4500

[0069] Ion source parameters:

[0070] Ion Mode ESI Curtain Gas 35 IonSpray Voltage 5500 Temperature 650 lon Source Gas1 55 lon Source Gas2 55 Collision Gas 7 Scan type MRM

[0071] MRM parameters:

[0072] Compound Precursor ion (m / z) Product ion (m / z) Declustering voltage (volts) Collision energy (volts) GLU-1 148.000 130.000 30.000 12 000 GLU-2 148.000 102.000 30.000 16.000 GLU-3 148.000 84.000 30.000 20.000 L-GLU-d3-1 151.300 133.000 20.000 14.000 L-GLU-d3-2 151.300 105.000 20.000 16.000 L-GLU-d3-3 151.300 87.000 20.000 24.000

[0073] 3. Test Results and Analysis

[0074] The prepared γ-glutamyl hydrolase was tested for enzyme activity. The chromatogram of the product glutamic acid and its internal standard is as Figure 1 shown. The left figure is the chromatogram of the product glutamic acid, and the right figure is the chromatogram of the glutamic acid internal standard.

[0075] According to the results of the standard products, a standard curve can be established, as Figure 2 shown. The standard curve equation is Y = 0.00382x + 0.2721, and the R value is 0.9943. In the test of the prepared enzyme, only the results obtained by subjecting the purified enzyme to a hydrolysis experiment and then performing an on-machine test need to be substituted into the standard curve to obtain the product concentration at each time point. A curve is plotted based on the product concentration, as Figure 3 shown, and the enzyme activity data in the purified sample can be obtained.

[0076] Example 2: Substrate Screening Test for Enzyme Activity

[0077] Enzyme activity testing determines the efficiency of enzyme catalysis by detecting the products after the enzyme catalyzes the decomposition of the substrate, and reflects the numerical value of enzyme activity. In terms of substrate selection, the present invention selected five substrates, namely methotrexate, folic acid, 5-methyltetrahydrofolic acid, γ-glutamine, and γ-polyglutamic acid, as the substrates to be tested.

[0078] Four groups of GGH expressed and purified from the recombinant plasmid as in Example 1 were taken respectively, and tested in the same manner as in Example 1, with the difference that the substrate was changed and no internal standard was used. They were respectively put into the reaction system, and the content of the corresponding decomposed product in the system was tested every 5 minutes. The results are shown in Table 1.

[0079] Table 1: Different Substrates and Concentrations of Decomposed Products (ng / ml)

[0080]

[0081]

[0082] According to the above test results, when using methotrexate, folic acid, 5-methyltetrahydrofolic acid, and γ-glutamine as substrates, problems such as difficulty in enzyme-catalyzed decomposition of the substrate and extremely low decomposition rate will occur. Especially for γ-glutamine, GGH hardly decomposes γ-glutamine and is not suitable as a substrate for detecting the enzyme activity of GGH.

[0083] When γ-polyglutamic acid is used as the substrate for detecting GGH enzyme activity, the increase in product concentration is linearly related to time, indicating that the substrate enzymatic hydrolysis process is stable, suitable as the substrate for GGH enzyme activity detection, and the product concentration value obtained by decomposition is large, which is beneficial to improving the detection sensitivity.

[0084] During the test, it was also found that the decomposition rates of the above four substrates were different during multiple tests. Table 2 shows the product contents after decomposition after 30 min of enzymatic catalysis reaction in multiple parallel experiments.

[0085] Table 2: Product contents after decomposition after 30 min of enzymatic catalysis reaction in multiple parallel experiments (ng / ml)

[0086] Test 1 Test 2 Test 3 Methotrexate 27 50 18 Folic acid 54 21 38 5-Methyltetrahydrofolate 66 43 57 γ-Glutamine 14 6 11 γ-Polyglutamic acid 1373 1304 1350

[0087] According to the above tests, when methotrexate, folic acid, 5-methyltetrahydrofolic acid, and γ-glutamine are used as substrates, there will also be unstable substrate decomposition, which will lead to unstable test results and the enzyme activity values obtained by detection are not credible.

[0088] When γ-polyglutamic acid is used as the substrate, the catalytic decomposition rate of GGH on it is stable, and there is no obvious numerical difference between multiple experiments, indicating good accuracy of detection and reliable test results at this time.

[0089] The reason for the above phenomenon is that although GGH can mediate the decomposition of various substrates, due to the steric hindrance effect between the configuration of GGH enzyme and the spatial structure of most substrates, the decomposition rate is slow and the decomposition is unstable; but the present invention has found a substrate γ-polyglutamic acid that can ensure fast and stable decomposition rate, which enables the method of the present invention to be actually applied and improves the detection accuracy.

[0090] Example 3: Screening test of inactivation methods

[0091] The inactivation method is that after sampling, a method is needed to inactivate the enzyme in the reaction system sample to prevent it from continuing to undergo enzymatic catalysis reaction, and then perform liquid chromatography-mass spectrometry (LC-MS) test on the machine; therefore, the inactivation step only has a great impact on the test results before the test. For example, incomplete inactivation will lead to inaccurate quantitative results. Therefore, this example tests various inactivation methods and tries to find an inactivation method suitable for the enzyme activity test system of the present invention.

[0092] The enzymatic catalysis reaction system of the present invention is:

[0093]

[0094] Water bath at 37°C for 30 min. During this period, 50 μl is taken every 5 min, and the hydrolysis reaction of γ-glutamyl hydrolase on γ-polyglutamic acid is terminated by the following 4 methods respectively:

[0095] (1) Inactivation with 10% trichloroacetic acid: Add 50 μl of the reaction solution to 50 μl of 10% trichloroacetic acid, mix well, centrifuge at 15000 rpm for 10 min, take 80 μl of the supernatant, and detect by liquid chromatography - mass spectrometry;

[0096] (2) Inactivation with acetonitrile: Add 50 μl of the reaction solution to 150 μl of 10% acetonitrile, mix well, centrifuge at 15000 rpm for 10 min, take 80 μl of the supernatant, and detect by liquid chromatography - mass spectrometry;

[0097] (3) Inactivation with 10% hydrochloric acid: Add 50 μl of the reaction solution to 50 μl of 10% hydrochloric acid, mix well, centrifuge at 15000 rpm for 10 min, take 80 μl of the supernatant, and detect by liquid chromatography - mass spectrometry;

[0098] (4) Inactivation by water bath at 100 °C: Inactivate 100 μl in a water bath at 100 °C for 10 min, centrifuge at 15000 rpm for 10 min, take 80 μL of the supernatant, and detect by liquid chromatography - mass spectrometry.

[0099] When inactivated with 10% trichloroacetic acid, the response of the product glutamic acid in the detection result is low, the peak shape is poor, and the chromatogram is as shown in Figure 4 shown; when inactivated with acetonitrile, the response of the product glutamic acid in the detection result is low, there is tailing, and the chromatogram is as shown in Figure 5 shown; when inactivated with 10% hydrochloric acid, the product glutamic acid has serious tailing in the detection result, and the chromatogram is as shown in Figure 6 shown; while when inactivated by water bath at 100 °C, the response of the product glutamic acid is high, the peak shape is good, and the chromatogram is as shown in Figure 7 shown. Therefore, use a water bath at 100 °C to terminate the hydrolysis reaction of γ - glutamyl hydrolase on γ - polyglutamic acid.

[0100] Therefore, using a water bath at 100 °C to terminate the hydrolysis reaction of γ - glutamyl hydrolase on γ - polyglutamic acid can avoid interference from miscellaneous peaks, increase chromatographic response, make the quantitative result more accurate and reliable, and is the preferred method.

[0101] The principle of inactivation by water bath at 100 °C mainly includes three aspects: namely, heat energy causes the destruction of protein structure; heat energy promotes the oxidation of proteins; heat energy accelerates the degradation of proteins. Inactivation by high - temperature water bath does not introduce additional high - concentration chemical reagents, and no additional matrix effect or solvent effect will be generated during mass spectrometry detection. The chromatographic peak has a better shape, the response of the product glutamic acid is higher, the chromatographic peak does not tail, and there are fewer miscellaneous peaks.

[0102] Example 4: Screening test of the reaction system

[0103] In a conventional enzyme activity detection reaction system, PBS buffer is often used as the reaction system, which has a good effect in most enzyme activity detection methods. However, in the method for detecting the activity of γ-glutamyl hydrolase in the present invention, the effect is not good. The specific reaction system is as follows:

[0104]

[0105] The chromatogram of the detection result is as Figure 8 shown. The response of its product glutamate is low. Not only is there a large error in the detection, but also the quantitative range of the established standard curve is narrow and the sensitivity is low, which is not conducive to the detection of the activity of γ-glutamyl hydrolase. The possible reason is that phosphate enters the chromatogram and inhibits the chromatographic response.

[0106] Therefore, in this example, the reaction system was adjusted. 0.25 mol / L sodium acetate, borate buffer, and Tris buffer with the same volume were used as buffers respectively, and other conditions were the same as those in Example 1. The chromatographic responses of the product glutamate were tested respectively, and the results are shown in Table 3.

[0107] Table 3: Chromatographic responses of different buffers and glutamate

[0108] Buffer PBS Sodium acetate Borates Tris Chromatographic response 6000 74000 9000 11000

[0109] According to the above experiment, the detection effect of selecting 0.25 mol / L sodium acetate as the buffer is better. The chromatogram when using 0.25 mol / L sodium acetate buffer as the reaction system is as Fig. 9 shown. The response of its product glutamate is high, which is ten times that of the PBS buffer reaction system. This indicates that the quantitative result is more accurate and the detection sensitivity is higher.

[0110] The possible reason for the above conclusion is that sodium acetate buffer is a volatile buffer salt, which provides a weakly acidic environment, is beneficial to the activity of γ-glutamyl hydrolase, and has a high compatibility with chromatography and mass spectrometry, does not inhibit its response, and does not produce matrix effect during detection.

[0111] Furthermore, the concentration of sodium acetate in the reaction system was adjusted. Only the concentration of sodium acetate in the above sodium acetate reaction system was adjusted, and the others were the same. Tests were carried out according to the method of Example 1, and the chromatographic responses of the product glutamate were tested respectively. Some test results are shown in Table 4.

[0112] Table 4: Chromatographic responses of sodium acetate concentration (mol / L) and glutamate

[0113] concentration 0.05 0.10 0.25 0.50 0.75 1.00 Chromatographic response 48000 64000 74000 68000 65000 65000

[0114] According to the above experiments, when the concentration of sodium acetate in the reaction system is 0.25 mol / L, the chromatographic response of glutamic acid is the largest, the detection effect is the best at this time, the detection sensitivity is high, and the quantitative result is more accurate. Therefore, 0.25 mol / L sodium acetate buffer solution is preferably used as the reaction system.

[0115] Example 5: Effect of Different GGH Enzyme Dosages on Enzyme Activity

[0116] In order to explore the effect of different GGH enzyme dosages on enzyme activity, the following 5 reaction systems were prepared:

[0117] (1) 2 μl GGH reaction system (containing 0.25 μl GGH in every 100 μl system)

[0118]

[0119] (2) 4 μl GGH reaction system (containing 0.5 μl GGH in every 100 μl system)

[0120]

[0121] (3) 8 μl GGH reaction system (containing 1 μl GGH in every 100 μl system)

[0122]

[0123] (4) 16 μl GGH reaction system (containing 2 μl GGH in every 100 μl system)

[0124]

[0125] (5) 32 μl GGH reaction system (containing 4 μl GGH in every 100 μl system)

[0126]

[0127] The detection results are as Fig.10 shown, and the product formation amount has a linear relationship with the GGH enzyme dosage.

[0128] The present invention has been described in detail, but the above embodiments are exemplary. The specific features, structures, materials or characteristics described can be combined and combined in a suitable manner in any one or more embodiments. Based on the present invention, some modifications or improvements can be made, which are obvious to those skilled in the art. Therefore, these modifications, improvements, substitutions or variations made without departing from the spirit of the present invention all fall within the scope of protection required by the present invention.

[0129] Sequence Listing

[0130] SEQ ID NO.1

[0131] AAGGAATGGTGTGGCCGATTAATCATAAATATGAAAAATAATTGTTGCATCACCCGCCAATGCGTGGCTTAATGCACA

[0132] TCAAATTGTGAGCGGATAGCAATTTGATGTGCTAGCGCATATCCAGTGTAGTAAGGCAAGTCCCTTCAAGAGTTATCG

[0133] TTGATACCCCTCGTAGTGCATATTCCTTTAACGCTTCAAAATCTGTAAAGCACGCCATATCGCCGAAAGGCGCACTTA

[0134] ATTATTAAGAGGTAATACCATATGAGACCCCACGGCGACACCGCCAAGAAGCCCATCATCGGAATATTAATGCAAAAA

[0135] TGCCGTAATAAAGTCATGAAAAACTATGGAAGATACTATATTGCTGCGTCCTATGTAAAGTACTTGGAGTCTGCAGGT

[0136] GCGAGAGTTGTACCAGTAAGGCTGGATCTTACAGAGAAAGACTATGAAATACTTTTCAAATCTATTAATGGAATCCTT

[0137] TTCCCTGGAGGAAGTGTTGACCTCAGACGCTCAGATTATGCTAAAGTGGCCAAAATATTTTATAACTTGTCCATACAG

[0138] AGTTTTGATGATGGAGACTATTTTCCTGTGTGGGGCACATGCCTTGGATTTGAAGAGCTTTCACTGCTGATTAGTGGA

[0139] GAGTGCTTATTAACTGCCACAGATACTGTTGACGTGGCAATGCCGCTGAACTTCACTGGAGGTCAATTGCACAGCAG

[0140] AATGTTCCAGAATTTTCCTACTGAGTTGTTGCTGTCATTAGCAGTAGAACCTCTGACTGCCAATTTCCATAAGTGGAG

[0141] CCTCTCCGTGAAGAATTTTACAATGAATGAAAAGTTAAAGAAGTTTTTCAATGTCTTAACTACAAATACAGATGGCA

[0142] AGATTGAGTTTATTTCAACAATGGAAGGATATAAGTATCCAGTATATGGTGTCCAGTGGCATCCAGAGAAAGCACCTT

[0143] ATGAGTGGAAGAATTTGGATGGCATTTCCCATGCACCTAATGCTGTGAAAACCGCATTTTATTTAGCAGAGTTTTTTG

[0144] TTAATGAAGCTCGGAAAAACAACCATCATTTTAAATCTGAATCTGAAGAGGAGAAAGCATTGATTTATCAGTTCAGT

[0145] CCAATTTATACTGGAAATATTTCTTCATTTCAGCAATGTTACATATTTGATcatcatcatcatcatcactaataaCCCGGGCCCGTCGA

[0146] CTGCAGAGGCCTGCATGATGAAAATAAAAACAGGTGCACGCATCCTCGCATTATCCGCATTAACGACGATGATGTTT

[0147] TCCGCCTCGGCTCTCGCCAAAATCGAAGAAGGTAAACTGGTAATCTGGATTAACGGCGATAAAGGCTATAACGGTCT

[0148] CGCTGAAGTCGGTAAGAAATTCGAGAAAGATACCGGAATTAAAGTCACCGTTGAGCATCCGGATAAACTGGAAGAG

[0149] AAATTCCCACAGGTTGCGGCAACTGGCGATGGCCCTGACATTATCTTCTGGGCACACGACCGCTTTGGTGGCTACGC

[0150] TCAATCTGGCCTGTTGGCTGAAATCACCCCGGACAAAGCGTTCCAGGACAAGCTGTATCCGTTTACCTGGGATGCCG

[0151] TACGTTACAACGGCAAGCTGATTGCTTACCCGATCGCTGTTGAAGCGTTATCGCTGATTTATAACAAAGATCTGCTGC

[0152] CGAACCCGCCAAAAACCTGGGAAGAGATCCCGGCGCTGGATAAAGAACTGAAAGCGAAAGGTAAGAGCGCGCTGA

[0153] TGTTCAACCTGCAAGAACCGTACTTCACCTGGCCGCTGATTGCTGCTGACGGGGGTTATGCGTTCAAGTATGAAAAC

[0154] GGCAAGTACGACATTAAAGACGTGGGCGTGGATAACGCTGGCGCGAAAGCGGGTCTGACCTTCCTGGTTGACCTGA

[0155] TTAAAAACAAACACATGAATGCAGACACCGATTACTCCATCGCAGAAGCTGCCTTTAATAAAGGCGAAACAGCGAT

[0156] GACCATCAACGGCCCGTGGGCATGGTCCAACATCGACACCAGCAAAGTGAATTATGGTGTAACGGTACTGCCGACC

[0157] TTCAAGGGTCAACCATCCAAACCGTTCGTTGGCGTGCTGAGCGCAGGTATTAACGCCGCCAGTCCGAACAAAGAGC

[0158] TGGCGAAAGAGTTCCTCGAAAACTATCTGCTGACTGATGAAGGTCTGGAAGCGGTTAATAAAGACAAACCGCTGGG

[0159] TGCCGTAGCGCTGAAGTCTTACGAGGAAGAGTTGGCGAAAGATCCACGTATTGCCGCCACCATGGAAAACGCCCAG

[0160] AAAGGTGAAATCATGCCGAACATCCCGCAGATGTCCGCTTTCTGGTATGCCGTGCGTACTGCGGTGATCAACGCCGC

[0161] CAGCGGTCGTCAGACTGTCGATGAAGCCCTGAAAGACGCGCAGACTCGTATCACCAAGTAACAAGCTTGTCGACCT

[0162] GCAGTCTAGATAGGTAATCTCTGCTTAAAAGCATAGAATCTAAGATCCCTGCCATTTGGCGGGGATTTTTTTATTTGTT

[0163] TTCAGGAAATAAATAATCGATCGCGTAATAAAATCTATTATTATTTTTGTGAAGAATAAATTTGGGTGCAATGAGAATG

[0164] CGCAGGCCCTTTCGTCTCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGACACATGCAGCTCCCGGAGACGGTCA

[0165] CAGCTTGTCTGTAAGCGGATGCCGGGAGCAGACAAGCCCGTCAGGGCGCGTCAGCGGGTGTTGGCGGGTGTCGGG

[0166] GCTGGCTTAACTATGCGGCATCAGAGCAGATTGTACTGAGAGTGCACCATAAAATTGTAAACGTTAATATTTTGTTAA

[0167] AATTCGCGTTAAATTTTTGTTAAATCAGCTCATTTTTTAACCAATAGGCCGAAATCGGCAAAATCCCTTATAAATCAAA

[0168] AGAATAGCCCGAGATAGGGTTGAGTGTTGTTCCAGTTTGGAACAAGAGTCCACTATTAAAGAACGTGGACTCCAAC

[0169] GTCAAAGGGCGAAAAACCGTCTATCAGGGCGATGGCCCACTACGTGAACCATCACCCAAATCAAGTTTTTTGGGGT

[0170] CGAGGTGCCGTAAAGCACTAAATCGGAACCCTAAAGGGAGCCCCCGATTTAGAGCTTGACGGGGAAAGCCGGCGA

[0171] ACGTGGCGAGAAAGGAAGGGAAGAAAGCGAAAGGAGCGGGCGCTAGGGCGCTGGCAAGTGTAGCGGTCACGCTG

[0172] CGCGTAACCACCACACCCGCCGCGCTTAATGCGCCGCTACAGGGCGCGTACTATGGTTGCTTTGACGTATGCGGTGT

[0173] GAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGGCGTCAGGTGGCACTTTTCGGGGAAATGTGCGCGG

[0174] AACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAAT

[0175] AATATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCC

[0176] TGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATC

[0177] GAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAA

[0178] AGTTCTGCTATGTGGCGCGGTATTATCCCGTATTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCA

[0179] GAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTG

[0180] CTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGC

[0181] TTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACG

[0182] ACGAGCGTGACACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTA

[0183] GCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGC

[0184] TGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATG

[0185] GTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCT

[0186] GAGATAGGTGCCTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTAAAAC

[0187] TTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTC

[0188] GTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCT

[0189] GCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAA

[0190] GGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTTCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGA

[0191] ACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTC

[0192] TTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACA

[0193] GCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCC

[0194] GAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGG

[0195] GGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTC

[0196] AGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTC

[0197] ACATAGTCATGCCCCGCGCCCACCGGAAGGAGCTGACTGGGTTGAAGGCTCTCAAGGGCATCGGTCGAGATCCCGG

[0198] TGCCTAATGAGTGAGCTAACTTACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCC

[0199] AGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCCAGGGTGGTTTTTCTTTTCAC

[0200] CAGTGAGACGGGCAACAGCTGATTGCCCTTCACCGCCTGGCCCTGAGAGAGTTGCAGCAAGCGGTCCACGCTGGTT

[0201] TGCCCCAGCAGGCGAAAATCCTGTTTGATGGTGGTTAACGGCGGGATATAACATGAGCTGTCTTCGGTATCGTCGTAT

[0202] CCCACTACCGAGATATCCGCACCAACGCGCAGCCCGGACTCGGTAATGGCGCGCATTGCGCCCAGCGCCATCTGATC

[0203] GTTGGCAACCAGCATCGCAGTGGGAACGATGCCCTCATTCAGCATTTGCATGGTTTGTTGAAAACCGGACATGGCAC

[0204] TCCAGTCGCCTTCCCGTTCCGCTATCGGCTGAATTTGATTGCGAGTGAGATATTTATGCCAGCCAGCCAGACGCAGAC

[0205] GCGCCGAGACAGAACTTAATGGGCCCGCTAACAGCGCGATTTGCTGGTGACCCAATGCGACCAGATGCTCCACGCC

[0206] CAGTCGCGTACCGTCTTCATGGGAGAAAATAATACTGTTGATGGGTGTCTGGTCAGAGACATCAAGAAATAACGCCG

[0207] GAACATTAGTGCAGGCAGCTTCCACAGCAATGGCATCCTGGTCATCCAGCGGATAGTTAATGATCAGCCCACTGACG

[0208] CGTTGCGCGAGAAGATTGTGCACCGCCGCTTTACAGGCTTCGACGCCGCTTCGTTCTACCATCGACACCACCACGCT

[0209] GGCACCCAGTTGATCGGCGCGAGATTTAATCGCCGCGACAATTTGCGACGGCGCGTGCAGGGCCAGACTGGAGGTG

[0210] GCAACGCCAATCAGCAACGACTGTTTGCCCGCCAGTTGTTGTGCCACGCGGTTGGGAATGTAATTCAGCTCCGCCAT

[0211] CGCCGCTTCCACTTTTTCCCGCGTTTTCGCAGAAACGTGGCTGGCCTGGTTCACCACGCGGGAAACGGTCTGATAA

[0212] GAGACACCGGCATACTCTGCGACATCGTATAACGTTACTGGTTTCACATTCACCACCCTGAATTGACTCTCTTCCGGG

[0213] CGCTATCATGCCATACCGCGAAAGGTTTTGCGCCATTCGATGGTGTCCGGGATCTCGACGCTCTCCCTTATGCGACTC

[0214] CTGCATTAGGAAGCAGCCCAGTAGTAGGTTGAGGCCGTTGAGCACCGCCGCCGC

Claims

1. A method for rapid detection of γ-glutamyl hydrolase activity based on liquid chromatography-mass spectrometry, characterized in that, The detection of γ-glutamyl hydrolase activity uses γ-polyglutamic acid as the enzymatic hydrolysis substrate.

2. The method according to claim 1, wherein The method includes the steps of: (1) Pretreatment: The sample to be tested undergoes an enzymatic catalysis reaction under a reaction system; (2) Liquid chromatography-mass spectrometry detection.

3. The method according to claim 2, wherein The sample to be tested in step (1) is purified γ-glutamyl hydrolase.

4. The method according to claim 2, wherein The reaction system in step (1) includes sodium acetate buffer, enzymatic hydrolysis substrate, and internal standard.

5. The method according to claim 4, wherein The concentration of sodium acetate in the reaction system in step (1) is 0.25 mol / L.

6. The method according to claim 4, wherein The internal standard in the reaction system in step (1) is L-glutamic acid-2,4,4-[d3], and the reaction system also includes bovine serum albumin.

7. The method according to claim 5, wherein The volume ratio of the sample to be tested to the γ-polyglutamic acid in step (1) is 1:

1.

8. The method according to claim 4, wherein The enzymatic catalysis reaction in step (1) is carried out in a 37°C water bath, sampled for inactivation, and the supernatant is taken after centrifugation for liquid chromatography-mass spectrometry detection; the inactivation methods include any one of inactivation with 10% trichloroacetic acid, inactivation with acetonitrile, inactivation with 10% hydrochloric acid, and inactivation with a 100°C water bath.

9. The method according to claim 8, wherein The enzymatic catalysis reaction in step (1) is carried out in a 37°C water bath for 30 min, during which 100 μL is taken every 5 min and transferred to a 100°C water bath for 10 min for inactivation, and the supernatant is taken after centrifugation for liquid chromatography-mass spectrometry detection.

10. Use of an enzymatic hydrolysis substrate for improving the accuracy of detecting the activity of γ-glutamyl hydrolase by liquid chromatography-mass spectrometry, characterized in that, The enzymatic hydrolysis substrate is γ-polyglutamic acid.