Immunogenic complexes, vaccines and methods of making and using the same

By displaying EBV and SARS-CoV-2 antigens on the surface of MS2 bacteriophage virus-like particles and encapsulating the corresponding mRNAs internally, the problem of the lack of effective EBV vaccines in the prior art has been solved, and efficient dual-antigen vaccine development has been achieved, which activates a strong immune response.

CN120346312BActive Publication Date: 2026-02-24INSTITUTE OF BIOPHYSICS CHINESE ACADEMY OF SCIENCES
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510411027.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Priority Date
2024-09-25
Filing Date
2025-04-02
Publication Date
2026-02-24
Estimated Expiration
2045-04-02

AI Technical Summary

Technical Problem

There is a lack of effective specific drugs and vaccines against EBV in the current technology. EBV infection causes severe disease and exacerbates the severity of COVID-19. EBV envelope glycoproteins play a key role in the viral infection process, and existing vaccines cannot effectively activate B cell responses.

Method used

An immunogenic complex based on MS2 bacteriophage virus-like particles was developed. The antigen was covalently linked to the surface of the virus-like particles using the SpyCatcher-SpyTag system, and the corresponding nucleic acid was encapsulated inside the particles to achieve simultaneous delivery of protein and mRNA antigens. A dual-antigen vaccine was prepared using an insect cell expression system.

Benefits of technology

It achieves efficient antigen display and induces high neutralizing antibody titers and T-cell responses in vivo, providing a cocktail vaccine against EBV and SARS-CoV-2 that can simultaneously activate humoral and cellular immune responses, offering an effective prevention and control strategy.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120346312B_ABST
    Figure CN120346312B_ABST
Patent Text Reader

Abstract

The present application relates to the technical field of vaccines, in particular to an immunogenic complex, a vaccine and a preparation method and application thereof. The immunogenic complex provided by the present application realizes the simultaneous delivery of protein and nucleic acid antigens by displaying antigens on the surface of phage virus-like particles and wrapping nucleic acids of the same species as the antigens inside the virus-like particles, and has a high antigen display efficiency and expression amount of nucleic acids. The immunogenic complex can simultaneously induce high-titer antigen-specific antibodies and neutralizing antibodies, and IFNγ specific to the antigen corresponding to the nucleic acid + T cell response. The vaccine based on the immunogenic complex can simultaneously induce effective humoral immunity and cellular immunity response, thereby providing an effective vaccine strategy for the prevention and treatment of antigen-related microbial infections and the treatment of related diseases, and providing a new idea for the development of other infectious diseases or tumor vaccines.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the field of vaccine technology, in particular to immunogenic complexes, vaccines and methods of preparation and use thereof. BACKGROUND

[0002] MS2 bacteriophage is a single-stranded RNA bacteriophage belonging to the family of Leviviridae, with a genome containing 3569 nucleotides encoding four proteins, capsid protein, mature enzyme protein, replicase protein and lytic protein. The 5' end of the replicase gene contains a stem-loop structure composed of 19 bases, which is the site of recognition between capsid protein dimers and genomic RNA and initiates self-packaging (i.e. the packaging site, pac site). Meanwhile, during the assembly of MS2 virions, the packaging site also acts as a translational regulatory element. When the amount of capsid protein exceeds the requirement for assembly, capsid protein dimers bind to the packaging site, preventing ribosomes from binding to the start site of the replicase, thereby inhibiting the translation of the replicase. In MS2 bacteriophage, 178 copies of capsid protein and one mature enzyme protein encapsulate the genomic RNA to form a T=3 regular icosahedral structure. With further research on MS2 bacteriophage, it was found that when the packaging site sequence is fused with the foreign nucleic acid sequence of interest, the interaction with MS2 capsid protein is retained, thereby enabling the packaging of various RNA molecules of interest into MS2 virus-like particles (VLPs). Studies have shown that if the uracil (U) at position 5 of the stem-loop structure is replaced with cytosine (C) (pac site C variant), the affinity of the packaging site for MS2 capsid protein will increase by 6-50 times compared to the wild type, thereby improving the packaging efficiency of MS2 virus-like particles and the tolerance of the length of the encapsulated RNA. In a number of studies, sequences expressing MS2 capsid protein and cDNA fragments encoding RNA of interest were constructed into the same plasmid or two plasmids, and in bacterial or yeast hosts, MS2 bacteriophage virus-like particles containing specific mRNA, miRNA, siRNA or viral genomic RNA were packaged for nucleic acid quality control products or RNA delivery vectors. On the other hand, the N-terminus and AB loop of MS2 capsid protein are both located in relatively exposed positions on the surface of the bacteriophage icosahedral particle, allowing the insertion of small foreign peptide-encoding sequences to fully display the foreign peptide segments on the outside of the particle and exert corresponding biological effects. This feature also makes MS2 virus-like particles widely used as vaccine carriers to display antigen epitopes in high density and repetition on the surface of the particles, effectively activating B cell responses in vivo and enhancing the immunogenicity of antigen peptides. Therefore, the ability to specifically encapsulate foreign RNA and display polypeptides of capsid protein makes MS2 virus-like particles have the potential to be developed as a vaccine carrier for simultaneously delivering protein and mRNA antigens.

[0003] Epstein-Barr virus (EBV) is a human herpesvirus 4 that infects more than 95% of the world's population. Most primary EBV infections are asymptomatic, but a small percentage of infected individuals develop infectious mononucleosis. EBV, which persists latently in host cells, can induce immortalization of lymphocytes or epithelial cells, and further cause post-transplant lymphoproliferative disorder, Burkitt's lymphoma, Hodgkin's lymphoma, gastric cancer, nasopharyngeal carcinoma and other autoimmune diseases. Recently, it has been reported that EBV reactivation can exacerbate the severity of COVID-19. At present, there is no specific drug and vaccine against EBV officially on the market, so it is of great significance to develop specific drugs and vaccines against EBV for the prevention and treatment of EBV infection.

[0004] EBV envelope glycoproteins include gp350 / 220, gH and gL, gp42 and gB, which play a key role in receptor recognition, attachment and virus-host membrane fusion during viral infection, and are important EBV preventive vaccine candidate antigen targets. In addition, after EBV primary infection of the oropharyngeal epithelium, it will further infect B cells in the secondary lymphoid tissue, and finally establish latent infection, expressing only a few genes including EBV nuclear antigen (EBNA) and latent membrane protein (LMP) genes. Among them, EBNA1 is the only core antigen expressed in the latent and lytic phases, and is involved in the maintenance of the EBV episome. Studies have found that EBNA1-specific CD 4+ and CD 8+ T cells can effectively control the growth of EBV immortalized epithelial cells or B cells. SUMMARY

[0005] The present application provides an immunogenic complex, a vaccine and a preparation method and application thereof.

[0006] The present application develops an immunogenic complex and a dual antigen vaccine based on phage virus-like particles for simultaneous delivery of protein and mRNA antigens. The combination of the two antigens can simultaneously induce high neutralizing antibody titers and T cell responses, and further prepare a cocktail vaccine against microbial infection and microbial infected cells.

[0007] Specifically, the present application provides the technical solutions described below.

[0008] In a first aspect, the present application provides an immunogenic complex, which comprises a virus-like particle and an antigen covalently linked to the virus-like particle by a SpyCatcher-SpyTag system, the covalent linkage allowing the antigen to be displayed on the surface of the virus-like particle;

[0009] The virus-like particle comprises a bacteriophage coat protein and a nucleic acid wrapped inside; the nucleic acid does not comprise nucleic acid from a host cell expressing the virus-like particle.

[0010] In order to allow simple, rapid and effective display of larger antigens on the surface of the virus-like particle, the present application uses the SpyCatcher-SpyTag protein connection system to display the antigen on the surface of the virus-like particle.

[0011] In the present application, the host cell expressing the virus-like particle includes but is not limited to insect cell SF9 and the like.

[0012] Preferably, the nucleic acid and the antigen are derived from the same microorganism or the same animal cell.

[0013] Preferably, the nucleic acid is RNA. More preferably, it is mRNA.

[0014] Preferably, the bacteriophage is an Escherichia coli bacteriophage. The Escherichia coli bacteriophage includes MS2 bacteriophage, Qβ bacteriophage or AP205 bacteriophage and the like.

[0015] Preferably, the bacteriophage is an MS2 bacteriophage.

[0016] Preferably, the coat protein is expressed in the form of a coat protein dimer, and the SpyTag is fused to the N-terminus of the coat protein dimer.

[0017] The present application finds that, compared with expressing SpyTag fused to the AB loop of one coat protein in the coat protein dimer, when SpyTag is fused to the N-terminus of the coat protein dimer, the coupling efficiency is significantly higher when coupling with the antigen fused to SpyCatcher, and the stability of the virus-like particle is higher during the coupling process, and degradation is less likely to occur.

[0018] The outer surface of the virus-like particle formed by self-assembly of the fused SpyTag and coat protein dimer displays 90 copies of SpyTag, which is covalently linked to the fusion protein of SpyCatcher and antigen, thereby realizing efficient display of the antigen on the surface of the virus-like particle.

[0019] Preferably, the SpyTag is connected to the coat protein dimer through a first connection peptide, and the sequence of the first connection peptide is shown in SEQ ID NO. 1.

[0020] The present application finds that, compared with using other connection peptide sequences, using (G4S)2 as the connection peptide can significantly improve the coupling efficiency of the SpyTag-fused coat protein dimer and the antigen fused to SpyCatcher.

[0021] The amino acid sequence of the capsid protein dimer is shown as SEQ ID NO. 2.

[0022] According to the amino acid sequence of the capsid protein dimer and the codon rules provided above, the coding gene sequence of the capsid protein dimer can be obtained by those skilled in the art, and due to the degeneracy of codons, the coding gene sequence is not unique, and all gene sequences capable of encoding the production of the above-mentioned capsid protein dimer are within the protection scope of the present application.

[0023] In some embodiments of the present application, the coding gene sequence of the capsid protein dimer is shown as SEQ ID NO. 11. The coding gene sequence is obtained by codon optimization based on the codon bias of insect cells.

[0024] Preferably, the SpyCatcher is connected to the antigen through a second connecting peptide. The second connecting peptide is a flexible connecting peptide rich in glycine and serine. The SpyCatcher is fused to the N-terminus of the antigen.

[0025] Preferably, the nucleic acid and the antigen are derived from Epstein-Barr virus or SARS-CoV-2.

[0026] Specifically, the antigen is the RBD sequence of the Epstein-Barr virus envelope glycoprotein gLgH, the Epstein-Barr virus envelope glycoprotein gp350 or the SARS-CoV-2 S protein.

[0027] The nucleic acid is the mRNA of the Epstein-Barr virus nuclear antigen EBNA1, the mRNA of the Epstein-Barr virus envelope glycoprotein gp350, the mRNA of the Epstein-Barr virus envelope glycoprotein gLgH, the mRNA of the Epstein-Barr virus envelope glycoprotein gB or the mRNA of the SARS-CoV-2 nucleocapsid protein.

[0028] As a specific embodiment, the present application develops an immunogenic complex and a dual antigen vaccine based on MS2 bacteriophage virus-like particles for simultaneously delivering protein and mRNA antigens for Epstein-Barr virus. First, the envelope glycoprotein gLgH or gp350 of Epstein-Barr virus is selected as the delivered protein antigen, and the mRNA of the nuclear antigen EBNA1 of Epstein-Barr virus is selected as the delivered mRNA antigen, and the two antigens are combined to simultaneously induce higher neutralizing antibody titers and T cell responses, thereby preparing an Epstein-Barr virus cocktail vaccine against viral infection and virus-infected cells.

[0029] In the above immunogenic complex for EB virus, the SpyCatcher is fused with the EB virus envelope glycoprotein, wherein the EB virus envelope glycoprotein comprises a fusion protein formed by gL protein and gH protein or the EB virus envelope glycoprotein is gp350 protein.

[0030] Preferably, the amino acid sequence of the gL protein is shown in SEQ ID NO.3, and the amino acid sequence of the gH protein is shown in SEQ ID NO.4.

[0031] Preferably, the amino acid sequence of the EB virus envelope glycoprotein gp350 is shown in SEQ ID NO.5.

[0032] Preferably, the SpyCatcher is fused to the N-terminus of the EB virus envelope glycoprotein.

[0033] In the aforementioned fusion protein of SpyCatcher and EBV envelope glycoprotein, SpyCatcher and EBV envelope glycoprotein are preferably linked by a linker peptide. The linker peptide shown in SEQ ID NO. 12 is preferred.

[0034] Of the aforementioned EBV envelope glycoproteins, the gL and gH proteins are preferably linked by a linker peptide. The linker peptide shown in SEQ ID NO. 12 is preferred.

[0035] In this invention, the amino acid sequence of SpyCatcher is shown in SEQ ID NO.13, and the amino acid sequence of SpyTag is shown in SEQ ID NO.14.

[0036] For EB virus, the amino acid sequence encoded by the mRNA of nuclear antigen EBNA1 is shown in SEQ ID NO.7.

[0037] Preferably, a 5'-UTR is attached to the 5' end of the mRNA of the EB virus nuclear antigen EBNA1, and an MS2 phage packaging site and a 3'-UTR are sequentially attached to the 3' end along the 5' to 3' direction.

[0038] This invention has found that linking the 5'-UTR, EBNA1 mRNA, MS2 phage packaging site, and 3'-UTR in the above order not only enables the EBNA1 mRNA encapsulated inside the MS2 virus-like particle to be recognized and translated by the eukaryotic transcription system, but also significantly increases the expression level of EBNA1 compared to other linking sequences.

[0039] Preferably, the MS2 phage packaging site is two tandem MS2 phage packaging sites; the sequence of the MS2 phage packaging site is preferably as shown in SEQ ID NO.15. The sequence shown in SEQ ID NO.15 is a mutant in which uracil (U) at position 5 of the MS2 phage packaging site is replaced with cytosine (C).

[0040] The UTRs mentioned above refer to the UTRs of human cell reduced coenzyme phytol CYBA, namely the 5'-UTR and the 3'-UTR.

[0041] Preferably, the 5'-UTR sequence is as shown in SEQ ID NO.16, and the 3'-UTR sequence is as shown in SEQ ID NO.17.

[0042] Preferably, the sequence of the gene encoding the EB virus antigen mRNA is shown in SEQ ID NO.18. It sequentially includes a 5'-UTR, the mRNA of EB virus nuclear antigen EBNA1, a tandem MS2 phage packaging site, and a 3'-UTR. The sequence of the EB virus nuclear antigen EBNA1 mRNA is a codon-optimized sequence according to insect cell codon preferences.

[0043] The immunogenic complex described above displays the EBV envelope glycoprotein gLgH on the outside of MS2 phage virus-like particles and encapsulates the EBV latent protein EBNA1 mRNA internally. This immunogenic complex can simultaneously induce high titers of gLgH-specific antibodies and neutralizing antibodies, as well as EBNA1-specific IFNγ in mice. + T cell response.

[0044] For EB virus, the optional delivered mRNA antigen may include at least one of the following: mRNA of envelope glycoprotein gp350, the amino acid sequence of which is shown in SEQ ID NO.5; mRNA of envelope glycoprotein gLgH, the amino acid sequence of which is shown in SEQ ID NO.8; or mRNA of envelope glycoprotein gB, the amino acid sequence of which is shown in SEQ ID NO.9.

[0045] As another specific embodiment of the present invention, the present invention develops an immunogenic complex and dual-antigen vaccine for SARS-CoV-2 virus based on MS2 bacteriophage virus-like particles that simultaneously deliver protein and mRNA antigens. First, the RBD sequence of the SARS-CoV-2 S protein is selected as the delivered protein antigen, and the mRNA of the SARS-CoV-2 nucleocapsid protein is selected as the delivered mRNA antigen. Combining these two antigens can simultaneously induce high neutralizing antibody titers and T-cell responses, thereby obtaining a SARS-CoV-2 virus cocktail vaccine targeting both viral infection and viral-infected cells.

[0046] In the above immunogenic complex against SARS-CoV-2 virus, the SpyCatcher is fused with the RBD of the S protein of SARS-CoV-2.

[0047] Preferably, the amino acid sequence of the RBD sequence of the SARS-CoV-2 S protein is shown in SEQ ID NO.6.

[0048] Preferably, the SpyCatcher is fused to the N-terminus of the RBD of the S protein of SARS-CoV-2.

[0049] In the fusion protein of SpyCatcher and the RBD of the SARS-CoV-2 S protein described above, SpyCatcher is preferably linked to the RBD of the SARS-CoV-2 S protein via a linker peptide. The linker peptide shown in SEQ ID NO. 19 is preferred.

[0050] For the SARS-CoV-2 virus, the delivered mRNA antigen can be the mRNA of the SARS-CoV-2 nucleocapsid protein, the amino acid sequence of which is shown in SEQ ID NO.10. The specific structure and sequence of the delivered mRNA antigen for the SARS-CoV-2 virus can be referenced from the EB virus antigen mRNA, by replacing the EB virus nuclear antigen EBNA1 mRNA with the SARS-CoV-2 nucleocapsid protein mRNA.

[0051] In a second aspect, the present invention provides a polynucleotide combination encoding the immunogenic complex, comprising:

[0052] (1) First polynucleotide: Its sequence contains, along the 5'-3' direction, the SpyTag coding sequence, the first linker peptide coding sequence, and the phage capsid protein dimer coding sequence;

[0053] (2) Second polynucleotide: Its sequence along the 5'-3' direction contains, in sequence, the 5'-UTR, the coding sequence of the nucleic acid, two tandem phage packaging sites and the 3'-UTR;

[0054] And, (3) the third polynucleotide: its sequence along the 5'-3' direction contains the SpyCatcher coding sequence, the second linker peptide coding sequence and the coding sequence of the antigen.

[0055] As one specific embodiment, the present invention provides a polynucleotide combination, the combination comprising:

[0056] (1) First polynucleotide: Its sequence contains, along the 5'-3' direction, the SpyTag coding sequence, the first linker peptide coding sequence, and the MS2 phage capsid protein dimer coding sequence;

[0057] (2) Second polynucleotide: Its sequence along the 5'-3' direction contains the 5'-UTR, the mRNA coding sequence of EB virus nuclear antigen EBNA1, two tandem MS2 phage packaging sites and the 3'-UTR;

[0058] And, (3) the third polynucleotide: its sequence along the 5'-3' direction contains the SpyCatcher coding sequence, the second linker peptide coding sequence and the EB virus envelope glycoprotein coding sequence in sequence;

[0059] The EB virus envelope glycoprotein coding sequence includes the EB virus gL protein coding sequence, the third linker peptide coding sequence, and the EB virus gH protein coding sequence.

[0060] Preferably, the amino acid sequence of the capsid protein dimer is as shown in SEQ ID NO.2, and / or the sequence of the first linker peptide is as shown in SEQ ID NO.1, and / or the amino acid sequence of the gL protein is as shown in SEQ ID NO.3, and / or the amino acid sequence of the gH protein is as shown in SEQ ID NO.4, and / or the amino acid sequence encoded by the mRNA of the nuclear antigen EBNA1 is as shown in SEQ ID NO.7, and / or the sequence of the MS2 phage packaging site is as shown in SEQ ID NO.15.

[0061] Preferably, the sequences of the second linker peptide and the third linker peptide are as shown in SEQ ID NO.12.

[0062] Thirdly, the present invention provides a combination of recombinant vectors, wherein the recombinant vectors comprise:

[0063] (1) First recombinant vector: comprising a polynucleotide, wherein the polynucleotide is (1) and (2) of the polynucleotide combination described in the second aspect above;

[0064] (2) Second recombinant vector: containing a polynucleotide, wherein the polynucleotide is (3) of the polynucleotide combination described in the second aspect above.

[0065] The backbone of the first recombinant vector can be any expression plasmid suitable for the Bac-to-Bac baculovirus insect expression system, including but not limited to the pFastBacDual vector. Preferably, the polynucleotides in (1) and (2) of the polynucleotide combination described in the second aspect are cloned downstream of the two promoters of the pFastBacDual vector, respectively.

[0066] The backbone of the second recombinant vector can be any expression plasmid capable of expressing the target gene in bacteria, fungi, or animal cells. For example, if *E. coli* is chosen as the host cell, the backbone of the second recombinant vector is an *E. coli* expression plasmid.

[0067] Fourthly, the present invention provides a host cell assembly, the host cell assembly comprising:

[0068] (1) First host cell: containing a recombinant vector, wherein the recombinant vector is (1) of the recombinant vector combination described in the third aspect above.

[0069] (2) Second host cell: containing a recombinant vector, wherein the recombinant vector is (2) of the recombinant vector combination described in the third aspect above.

[0070] The first host cell described above can be any host cell or intermediate host cell capable of enabling the MS2 phage capsid protein to self-assemble into virus-like particles, including bacterial, fungal, or animal cells. As an example, the first host cell is *Escherichia coli* containing a baculovirus shuttle vector and insect cells.

[0071] The second host cell described above can be any bacterial, fungal, or animal cell capable of expressing a heterologous protein. As an example, the second host cell is an animal cell line (e.g., the 293F cell line).

[0072] Fifthly, the present invention provides a method for preparing the immunogenic complex described above, wherein the first recombinant vector described in (1) of the third aspect above is introduced into Escherichia coli containing a baculovirus shuttle vector to obtain recombinant baculovirus particles;

[0073] The recombinant rod particles were transfected into insect cells to obtain the virus-like particles;

[0074] The second recombinant vector described in (2) of the third aspect above is introduced into a host cell to obtain a fusion protein of SpyCatcher and the antigen;

[0075] The fusion protein of SpyCatcher and the antigen is linked to virus-like particles.

[0076] As one specific embodiment, the present invention provides a method for preparing the immunogenic complex described above. The method includes: expressing the coding sequence of the capsid protein dimer fused with SpyTag at the N-terminus and the coding sequence of EB virus antigen mRNA using a baculovirus-insect cell expression system to obtain the virus-like particles; introducing the coding sequence of the fusion protein of SpyCatcher and EB virus envelope glycoprotein into host cells for expression to obtain the fusion protein of SpyCatcher and EB virus envelope glycoprotein; and linking the fusion protein of SpyCatcher and EB virus envelope glycoprotein to the virus-like particles to obtain the immunogenic complex.

[0077] In one embodiment of the present invention, the EB virus antigen mRNA coding sequence carrying the MS2 phage packaging site and the MS2 capsid protein dimer coding sequence fused with SpyTag are respectively cloned downstream of two promoters of the pFastBacDual vector, and the recombinant virus-like particles are assembled using a Bac-to-Bac baculovirus insect expression system. Preferably, the MS2 capsid protein dimer coding sequence fused with SpyTag is shown in SEQ ID NO.20.

[0078] In some embodiments of the present invention, the coding sequence of the fusion protein of SpyCatcher and EB virus envelope glycoprotein is shown in SEQ ID NO.21.

[0079] In a sixth aspect, the present invention provides any one of the following applications of the immunogenic complex, the polynucleotide combination, the recombinant vector combination, or the host cell combination described above:

[0080] (1) To prepare a medicine for the prevention and / or treatment of microbial infections from which the antigen is derived;

[0081] (2) To prepare a medicine for the prevention and / or treatment of diseases caused by microbial infections from which the antigen is derived;

[0082] (3) Prepare a drug for the prevention and / or treatment of diseases caused by abnormal expression of the antigen.

[0083] In a seventh aspect, the present invention provides the use of the above-described immunogenic complex or the polynucleotide combination or the recombinant vector combination or the host cell combination in the preparation of a medicament for the prevention and / or treatment of microbial infections or diseases caused by microbial infections.

[0084] The microorganisms mentioned are either EB virus or the novel coronavirus SARS-CoV-2.

[0085] Eighthly, the present invention provides a medicament comprising the immunogenic complex described above.

[0086] Preferably, the drug further comprises a pharmaceutically acceptable carrier and / or excipient.

[0087] Preferably, the drug is a vaccine.

[0088] Preferably, the vaccine further comprises an adjuvant. The adjuvant is preferably an aluminum adjuvant, or a combination of an aluminum adjuvant and a CpG adjuvant.

[0089] In a ninth aspect, the present invention provides the use of the immunogenic complex or the drug described above in the prevention and / or treatment of microbial infections or diseases caused by the antigen.

[0090] The beneficial effects of this invention include at least the following: The immunogenic complex provided by this invention simultaneously delivers protein and nucleic acid antigens by displaying antigens on the surface of bacteriophage virus-like particles and encapsulating nucleic acids of the same species as the antigens inside the virus-like particles, exhibiting high antigen display efficiency and high nucleic acid expression levels. This immunogenic complex can simultaneously induce high titers of antigen-specific antibodies and neutralizing antibodies, as well as specific IFNγ corresponding to the nucleic acid antigen. + T-cell response. Vaccines based on this immunogenic complex can simultaneously induce effective humoral and cellular immune responses, providing an effective vaccine strategy for the prevention and treatment of antigen-associated microbial infections and related diseases, while also offering new insights for the development of vaccines for other infectious diseases or tumors. Attached Figure Description

[0091] To more clearly illustrate the technical solutions in this invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of this invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.

[0092] Figure 1 SpyTag-MS2 in Embodiment 1 of the present invention ( luc Expression, purification, and morphological characterization of virus-like particles; where A is SpyTag-MS2 purified by continuous sucrose density gradient centrifugation from 20% to 60% (…). luc After sampling the virus-like particles, SDS-PAGE images were obtained by layering; B represents SpyTag-MS2. luc Image of virus-like particles captured under a transmission electron microscope; C represents SpyTag-MS2 detected by dynamic light scattering DLS. luc)Particle size diagram of virus-like particles.

[0093] Figure 2 SpyTag-MS2 in Embodiment 2 of the present invention ( luc Evaluation of protein display efficiency on the surface of virus-like particles; where A is the SDS-PAGE image of SpyCatcher protein purified by Ni-NTA column affinity chromatography and before and after ULP enzyme treatment; B is the SDS-PAGE image of SpyCatcher-gLgH protein purified by Ni-NTA column affinity chromatography; C is the SDS-PAGE image of SpyCatcher protein with ABSpyTag(G4S)-MS2 ( luc ), ABSpyTag(G4S)2-MS2( luc ) and NSpyTag(G4S)2-MS2( luc SDS-PAGE image of virus-like particle conjugation; Image J performs grayscale analysis on MS2 CP dimer bands to calculate virus-like particle coupling efficiency. D represents SpyCatcher-gLgH fusion protein conjugated with ABSpyTag(G4S)-MS2 ( luc ), ABSpyTag(G4S)2-MS2( luc ) and NSpyTag(G4S)2-MS2( luc SDS-PAGE image of virus-like particles after coupling; Image J performs grayscale analysis on MS2 CP dimer bands to calculate virus-like particle coupling efficiency.

[0094] Figure 3This invention evaluates the ability of SpyTag-MS2 virus-like particles to encapsulate RNA within the virus-like particles. A represents the sequences of six luciferase gene mRNAs, with different UTRs, pac site C variant tandems, and luciferase gene CDs. B represents the luciferase gene expression efficiency after transfection of the six mRNAs into 293T and Raw264.7 cells. C represents the efficiency of quantitative PCR detection of six mRNAs of different lengths encapsulated within SpyTag-MS2 virus-like particles: EBV ebna1 (1095 nt), SARS-CoV-2 nucleocapsid (1401 nt), EBV gp350 (1419 nt), firefly luciferase (1691 nt), EBV gb (2304 nt), and EBVglgh (2520 nt). The results are presented at a 100:100 ppm. The complete RNA gene copy number encapsulated in μg virus-like particles is used as an indicator; D represents the translation efficiency of luciferase RNA encapsulated inside virus-like particles distributed in layers 8, 9, 10, 11, and 12 of SpyTag-MS2 (luc) centrifuged at a 20%-60% continuous sucrose density gradient as detected by a luciferase reporter assay.

[0095] Figure 4 This document describes the purification and morphological characterization of RBD-NSpyTag(G4S)2-MS2 (nucleocapsid) virus-like particles in Example 4 of the invention. A shows SDS-PAGE images of SpyCatcher-RBD protein and NSpyTag(G4S)2-MS2 (nucleocapsid) virus-like particles ligated at different molar ratios; B shows agarose gel electrophoresis images, nucleic acid and protein staining images, of SpyCatcher-RBD protein and NSpyTag(G4S)2-MS2 (nucleocapsid) virus-like particles ligated at different molar ratios; C shows images of Hiload 16 / 600 superdex 200. Pergrade chromatography column purification and separation of RBD-NSpyTag(G4S)2-MS2 (nucleocapsid) virus-like particles and free SpyCatcher-RBD protein; D is the SDS-PAGE image of RBD-NSpyTag(G4S)2-MS2 (nucleocapsid) virus-like particles; E is the negative-stained transmission electron microscope image of RBD-NSpyTag(G4S)2-MS2 (nucleocapsid) virus-like particles.

[0096] Figure 5 For example 5 of the invention, gp350-NSpyTag(G4S)2-MS2( ebna1Virus-like particle purification and particle morphology characterization; where A is SpyCatcher-gp350 protein and NSpyTag(G4S)2-MS2 ( ebna1 SDS-PAGE images of virus-like particles linked at different molar ratios; B represents SpyCatcher-gp350 protein and NSpyTag(G4S)2-MS2 ( ebna1 Virus-like particles were ligated at different molar ratios and subjected to agarose gel electrophoresis, followed by nucleic acid and protein staining. C represents the purification and separation of gp350-NSpyTag(G4S)2-MS2 using a Hiload 16 / 600 Superdex 200 per grade chromatography column. ebna1 Virus-like particles and free SpyCatcher-gp350 protein; D is gp350-NSpyTag(G4S)2-MS2 ( ebna1 ) SDS-PAGE image of virus-like particles; E represents gp350-NSpyTag(G4S)2-MS2 ( ebna1 Image of virus-like particles taken with a negatively stained transmission electron microscope.

[0097] Figure 6 In Example 6 of this invention, gLgH-NSpyTag(G4S)2-MS2( ebna1 Virus-like particle purification and particle morphology characterization; where A is the purification and separation of gLgH-NSpyTag(G4S)2-MS2 using a Hiload 16 / 600 superdex 200 pergrade chromatography column. ebna1 Virus-like particles and free SpyCatcher-gLgH protein; B is gLgH-NSpyTag(G4S)2-MS2 ( ebna1 ) SDS-PAGE image of virus-like particles; C represents gLgH-NSpyTag(G4S)2-MS2 ( ebna1 Image of virus-like particles captured under a transmission electron microscope and its two-dimensional reconstruction; D represents the ELISA detection of gLgH-NSpyTag(G4S)2-MS2 ( ebna1 The ability of virus-like particles to bind to gLgH neutralizing antibody 1D8.

[0098] Figure 7 In Example 7 of this invention, gLgH-NSpyTag(G4S)2-MS2 ( ebna1 ) Detection of anti-gLgH specific antibody response level induced by virus-like particles; where A is the immunization program for C57BL / 6 mice; B is the ELISA detection of gLgH-NSpyTag(G4S)2-MS2 ( ebna1The status of anti-gLgH IgG antibodies at different time points after mice were immunized with virus-like particles.

[0099] Figure 8 In Example 8 of this invention, gLgH-NSpyTag(G4S)2-MS2 ( ebna1 ) Detection of EBV neutralizing antibody levels caused by virus-like particles; where A is gLgH-NSpyTag(G4S)2-MS2( ebna1 The level of neutralizing antibodies against EBV-infected B cells induced by virus-like particles; B is gLgH-NSpyTag(G4S)2-MS2( ebna1 The level of neutralizing antibodies against EBV-infected epithelial cells caused by virus-like particles.

[0100] Figure 9 In Example 9 of this invention, gLgH-NSpyTag(G4S)2-MS2( ebna1 EBNA1 caused by virus-like particles + IFNγ + Specific T cell detection; where A represents the immunization program for C57BL / 6 mice, and ELISPOT was used to detect EBNA1. + IFNγ + Specific T cell number; B represents EBNA1 + IFNγ + Statistical results of the number of specific T cells. Detailed Implementation

[0101] The sequences involved in this invention and their corresponding information are shown in Table 1.

[0102] Table 1

[0103]

[0104]

[0105] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some, not all, of the embodiments of this invention. Based on the embodiments of this invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of this invention.

[0106] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, and the materials and reagents used are commercially available. All quantitative experiments in the following examples were performed in triplicate, and the results were averaged.

[0107] Example 1 ABSpyTag(G4S)-MS2( luc Construction of virus-like particles

[0108] Materials: All endonucleases were purchased from ThermoFisher, and all primers were synthesized by Beijing Qingke Biotechnology. 2× Prime STAR was purchased from Takara, gel extraction kit from Shanghai Sangon Biotech, homologous recombination kit, Top10 E. coli competent cells, DNase I and RNase A from Beijing TransGen Biotech, plasmid mini-preparation kit from Beijing Tiangen Biotech, DH10Bac competent cells from Beijing Biomed, baculovirus shuttle vector bacmid mini-extraction kit from Beyotime, kanamycin, gentamicin, tetracycline and X-Gal from Shanghai Sangon Biotech, IPTG from Inalco, Grace medium, Cellfectin II Reagent transfection reagent, Sf-900TM II SFM (1×) medium and Sf-900TM (1.3×) medium from ThermoFisher, gp64 antibody from Santa Cruz, HRP-goat anti-mouse secondary antibody from EarthOx, chromogenic substrate TMB membrane peroxidase substrate from Sera Care, sucrose from Sigma, and ultracentrifuge tubes from Beckman.

[0109] 1. ABSpyTag(G4S)-MS2( luc Construction of virus-like particle expression plasmid

[0110] The dual expression vector pFastBac using the baculovirus Bac-to-Bac expression system TMDual, a tandem dimer coding sequence for the MS2 capsid protein was inserted at the multiple cloning site following the PH promoter of the polyhedromic protein. The first capsid protein CP in the tandem dimer is wild-type (SEQ ID NO. 22), and the SpyTag coding sequence (SEQ ID NO. 23) was inserted between amino acids 15-16 (TG, located in the AB loop) of the second capsid protein for expressing the capsid protein assembled into a VLP. A firefly luciferase gene coding sequence (SEQ ID NO. 24) containing two consecutive pac site C variants (SEQ ID NO. 15) was inserted at the multiple cloning site following the P10 promoter for transcribing fireflyluciferase mRNA encapsulated within the VLP. The SpyTag-MS2 capsid protein dimer interacts with the pac site-containing firefly luciferase mRNA, completing the self-assembly of MS2 virus-like particles in insect cells.

[0111] The nucleic acid sequence encoding the MS2 capsid protein tandem dimer was optimized using the sf9 host codon in insect cells. Specifically, the first two positions of the second capsid protein were replaced with GCTAGC, introducing an Nhe I restriction site through a synonymous amino acid mutation; the first two positions were replaced with GTCGAC, introducing a Sal I restriction site through a synonymous amino acid mutation; and a SpyTag coding sequence was inserted between amino acids 15 and 16. A GGGGS linker sequence (SEQ ID NO. 25) was added to both the N-terminus and C-terminus of the SpyTag sequence, and the C-terminal GS amino acid sequence was replaced with GGATCC, introducing a BamHI restriction site through a synonymous amino acid mutation. The introduction of the NheI, Sal I, and BamHI restriction sites facilitates future modification of the second capsid protein and allows for flexible replacement of the inserted exogenous peptide. The above-mentioned MS2 capsid protein tandem dimer coding sequence fused with SpyTag was named CP-ABSpyTag(G4S)CP and synthesized by BGI Genomics (SEQ ID NO. 26). Primers with restriction enzyme sites were designed for PCR amplification of the CP-ABSpyTag(G4S) CP fragment. The upstream primer introduced the plasmid homologous arm, EcoRI restriction site, and the kozak sequence GCCACC. The downstream primer introduced the stop codon, Hind III restriction site, and plasmid homologous arm. The PCR reaction system was as follows: 2×Prime STAR 25 μL, upstream primer (10 μM) 1 μL, downstream primer (10 μM) 1 μL, template 1 μL, ddH2O 23 μL, total volume 50 μL. The PCR reaction conditions were as follows: pre-denaturation, 98℃, 2 min; denaturation, 98℃, 10 s; annealing, 60℃, 10 s; extension, 72℃, 30 s; a total of 35 cycles were performed, with a final extension time of 5 min. pFastBac TM The dual expression plasmid was digested with EcoRI and Hind III, and recovered by agarose gel electrophoresis. Homologous recombination was performed at 50°C for 15 minutes using a 1:2 molar ratio of pFastBac Dual vector to CP-ABSpyTag(G4S)-CP fragment, with the recombinase acting as an enzyme. The recombinant product was transformed into E. coli Top 10 competent cells, incubated on ice for 30 minutes, heat-shocked at 42°C for 45 seconds, and then on ice for 2 minutes. 900 μL of antibiotic-free LB medium was added, and the cells were incubated at 37°C and 220 rpm for 1 hour. 200 μL of the bacterial culture was then transferred to LB agar plates containing 50 μg / mL ampicillin and incubated at 37°C for 12 hours. Single colonies were picked the following day for sequencing verification. Colonies with correct sequencing were amplified to 5 mL, and the plasmid pFastBac-PH ABSpyTag(G4S)dMS2CP was extracted using a plasmid extraction kit.

[0112] Using the pGL3 luciferase reporter plasmid as a template, primers with restriction enzyme sites at both ends were designed to amplify the luciferase-pac site C variant tandem fragment by PCR. The upstream primer included a plasmid homologous arm and an XhoI restriction site, while the downstream primer included a stop codon TAA, two tandem pac site C variants, a KpnI restriction site, and a plasmid homologous arm. The pFastBac-PH ABSpyTag(G4S)dMS2 CP plasmid obtained in the previous step was double-digested with XhoI and KpnI, recovered by agarose gel, and homologously recombinated with the amplified luciferase-pac site C variant tandem fragment. The homologous recombination product was transformed into E. coli Top 10 competent cells, and the correct clones were screened by sequencing. Colonies with correct sequencing were amplified and cultured to 5 mL, and the plasmid pFastBac-PH ABSpyTag(G4S)dMS2 CP-P10luc C tandem was extracted using a plasmid extraction kit.

[0113] The amplification primers for the EcoRI-CP-ABSpyTag(G4S)CP-HindIII fragment are as follows.

[0114] Primer F (SEQ ID NO.37):

[0115] CGTCCCACCATCGGGCGAATTCGCCACCATGGCTTCCAACTTCACCCAGTTCG;

[0116] Primer R (SEQ ID NO.38):

[0117] CCTCTAGTACTTCTCGACAAGCTTTTAGTAGATACCGGAGTTAGCAGCG;

[0118] The amplification primers for the XhoI-luciferase-pac site C variant tandem-KpnI fragment are as follows.

[0119] Primer F (SEQ ID NO.39):

[0120] CTTGATCACCCGGGATCTCGAGGCCACCATGGAAGACGCCAAAAACATAAAG;

[0121] Primer R (SEQ ID NO.40):

[0122] GCCTCCCCCATCTCCCGGTACCACATGGGTGATCCTCATGTACATGGGTGATCCTCATGTTTACACGGCGATCTTTCCGC.

[0123] 2. ABSpyTag(G4S)-MS2( luc Expression of virus-like particles in insect sf9 cells

[0124] After obtaining the recombinant donor plasmid pFastBac-PH ABSpyTag(G4S)-dMS2 CP-P10 luc C tandem, it was transformed into DH10Bac competent cells. Recombinant baculotropic plasmid rBacmid-ABSpyTagMS2-luciferase mRNA was obtained through screening with three antibiotics and blue-white screening (kanamycin / gentamicin / tetracycline / IPTG / X-Gal) and PCR identification. The recombinant baculotropic plasmid was then transfected into insect sf9 cells to obtain recombinant baculovirus. The P3 generation of recombinant baculovirus was further used to infect sf9 cells for ABSpyTag-MS2 ( luc The high expression of virus-like particles.

[0125] (1) Preparation of recombinant rod particles

[0126] Thaw DH10Bac competent cells on ice, add 1 μg of recombinant donor plasmid pFastBac-PH ABSpyTag(G4S)dMS2 CP-P10 luc C tandem, mix gently, and incubate on ice for 30 minutes. Heat shock at 42℃ for 90 seconds, then incubate on ice for 2 minutes. Add 900 μL of SOC medium equilibrated to room temperature beforehand, and incubate at 37℃ with a shaker at 220 rpm for 4 hours. Prepare 10 using SOC medium. 0 10 -1 10 -2 10 -3Four dilution gradients of bacterial culture were prepared. 100 μL of each dilution was plated onto solid LB agar plates containing 50 μg / mL kanamycin, 7 μg / mL gentamicin, 10 μg / mL tetracycline, 40 μg / mL IPTG, and 24 μg / mL X-Gal, respectively, and incubated at 37°C for 48 hours. White colonies were picked and thoroughly dissolved in 20 μL of LB agar containing the three antibiotics (50 μg / mL kanamycin, 7 μg / mL gentamicin, and 10 μg / mL tetracycline) as templates for colony PCR. Universal M13 primers were used. PCR conditions were as follows: pre-denaturation, 98°C, 2 min; denaturation, 98°C, 10 s; annealing, 51°C, 15 s; extension, 72°C, 3 min; a total of 35 cycles were performed, with a final extension time of 5 min. PCR products were identified by 1% agarose gel electrophoresis, and colonies identified as positive by PCR were further sequenced for verification. Finally, positive colonies were inoculated into LB medium containing three antibiotics (50 μg / mL kanamycin, 7 μg / mL gentamicin, and 10 μg / mL tetracycline) and cultured at 37°C with shaking for 16 h. Recombinant baculovirus shuttle vector bacmid was extracted using a mini-extraction kit and named rBacmid-ABSpyTagMS2-luciferase.

[0127] (2) Preparation of recombinant baculovirus

[0128] sf9 cell density increased to 1.5-2.5 × 10⁻⁶. 6 The cells / mL were in the logarithmic growth phase. 15-30 min before transfection, the cells were resuspended in serum-free and antibiotic-free Grace medium and seeded into 6-well plates at 0.4 × 10⁶ cells / mL. 6Cells / mL, 2mL per well, incubate at 27℃ or room temperature to allow cell adhesion. Transfection was performed according to the Cellfectin II Reagent instructions, as follows: 100μL serum-free, antibiotic-free Grace medium was added to a 1.5mL EP tube, followed by 8μL of transfection reagent, and briefly vortexed to mix. In another 1.5mL EP tube, 100μL serum-free, antibiotic-free medium and 3μL of baculovirus were added and gently mixed. The diluted baculovirus was then mixed with diluted Cellfectin II and gently incubated at room temperature for 15-30 minutes. The transfection mixture was added dropwise to the adhered cells and incubated at 27℃ for 5 hours. After 5 hours, the transfection mixture was aspirated, and 2mL of complete medium (Grace medium with additives + 10% FBS) was added. The cells were incubated at 27℃ for further culture until 70%-80% cytotoxicity was achieved. The culture supernatant was collected to obtain P1 generation recombinant baculovirus vBacmid-ABSpyTagMS2-luciferase. P1 generation virus infects normal sf9 cells to obtain P2 generation virus, and P2 generation virus is used to infect sf9 cells again to obtain P3 generation virus.

[0129] (3) Baculovirus titer determination

[0130] sf9 cell density increased to 1.5-2.5 × 10⁻⁶. 6 The cells / mL were in the logarithmic growth phase. Dilute the cells to 1×10⁻⁶. 6 Cells / mL, add 100 μL to each well of a 96-well plate, and incubate at 27°C for 1 hour to allow cell adhesion. Use Sf-900 TM II SFM (1×) medium was used to dilute the P3 generation virus stock solution, 10 -1 10 -2 10 -3 10 -4 10 -5 10 -6 10 -7 10 -8 There are a total of 8 gradients. Discard the original culture medium in the 96-well plate, add 50 μL of virus dilution to each well, and perform 3 replicates for each dilution. Incubate at 27°C for 1 hour, discard the virus solution, and add 50 μL of 0.55% overlay medium. The 0.55% overlay medium is prepared as follows: 10 mL 2.4% carboxymethyl cellulose + 33.3 mL Sf-900 TM(1.3×) medium, incubated at 27℃ for 48 hours. Add 150 μL of 4% paraformaldehyde to each well for fixation, incubate at room temperature for 10 min. Discard the supernatant, wash three times with 200 μL of 0.05% PBST per well. Add 50 μL of 5% goat serum to each well, block at room temperature for 30 minutes. Discard the supernatant, wash three times with 200 μL of 0.05% PBST per well. Dilute gp64 antibody 1:200, add 50 μL to each well, incubate at 37℃ for two hours or overnight at 4℃. Discard the supernatant, wash three times with 200 μL of 0.05% PBST per well. Dilute secondary antibody HRP-goatanti mouse 1:500, add 50 μL to each well, incubate at 37℃ for 1 hour. Discard the supernatant, wash three times with 200 μL of 0.05% PBST per well. Add 50 μL of TMB membrane peroxidase substrate to each well and allow to develop color at room temperature until distinct blue spots are visible under a microscope. Virus titer (infectious units per ml, IFU / ml) = number of blue spots × corresponding dilution × 20.

[0131] 3. ABSpyTag(G4S)-MS2( luc Purification of virus-like particles

[0132] (1) Inoculate P3 generation recombinant baculovirus vBacmid-ABSpyTagMS2-luciferase at a moi=1 in 1L at a density of 2×10⁻⁶ mcg / mL. 6 sf9 cells per cell / mL were placed in a 27°C shaking incubator and cultured at 110 rpm for 72 hours.

[0133] (2) Collect cells by centrifugation at 4000 rpm and 4℃ for 35 minutes. Resuspend the cell pellet in 80 mL of TBS solution (10 mM Tris-HCl, 100 mM NaCl, 1 mM MgCl2, 0.1 mM EDTA, pH 7.4), sonicate for 15 min at 35% amplitude for 5 seconds on, 9 seconds off, until the solution is clear and transparent. Remove cell debris by centrifugation at 12000 rpm and 4℃ for 45 min, collect the supernatant, and filter through a 0.45 μm PVDF membrane. Add 20% PEG6000 (w / v) and 1 M NaCl to a final concentration, and incubate overnight at 4℃ for precipitation. Centrifuge at 12000 rpm and 4℃ for 45 minutes, discard the supernatant, add 20 mL of TBS and incubate overnight to dissolve the white precipitate. After the precipitate is completely dissolved, add 10 U / mL DNase I and 10 μg / mL RNase A, and treat at 37℃ for 1 h. Add chloroform at a 1:1 volume ratio, immediately invert and mix, centrifuge at 12000 rpm and 4°C for 15 minutes, take the upper aqueous phase, and concentrate it in a 100 kDa ultrafiltration tube.

[0134] (3) Purification of ABSpyTag(G4S)-MS2 by 20%-60% continuous sucrose density gradient centrifugation luc Virus-like particles. 20% sucrose solution: 10g sucrose was added to TBS solution, completely dissolved, and then brought to a final volume of 50mL. The solution was filtered through a 0.22μm PVDF membrane. 60% sucrose solution: 30g sucrose was added to TBS solution, completely dissolved, and then brought to a final volume of 50mL. The solution was filtered through a 0.22μm PVDF membrane. Using a syringe, 20% and 60% sucrose solutions were added sequentially to the ultracentrifugation tubes. A 20%-60% continuous sucrose density gradient was prepared using a Biocomp GRADIENT MASTER 108 fully automated density gradient generator, with the program being Long Sucr 20-60% wv 2St. At least 1mL of protein concentrate was slowly added to the top of each ultracentrifugation tube. The tubes were centrifuged for 22 hours using a Himac ultracentrifuge with a P40ST rotor at 150,000 RCF at 4℃. After ultracentrifugation, samples were taken sequentially from top to bottom, 1mL per layer. SDS-PAGE protein electrophoresis detection of ABSpyTag(G4S)-MS2 ( luc The location of the virus-like particles was desaccharified using a 100 kDa ultrafiltration concentrator and replaced with TBS buffer.

[0135] 4. ABSpyTag(G4S)-MS2( luc ) Morphological characterization of virus-like particles

[0136] (1) The ABSpyTag(G4S)-MS2 was measured using a Wyatt Technology DynaPro Titan DLS instrument. luc The diameter and polydispersity of virus-like particles were determined. Virus-like particles were diluted with TBS solution to 0.05 mg / mL, added to microplates, and measured at room temperature.

[0137] (2) Transmission electron microscopy observation of ABSpyTag(G4S)-MS2( luc ) Size and morphology of virus-like particles. Dilute virus-like particles to 0.2 mg / mL with PBS solution. Take 5 μL of the dilution and drop it onto a 300-mesh carbon copper grid. Let it absorb for 1 min. Gently absorb the liquid from the edge of the copper grid with filter paper. Add 5 μL of 2% uranyl acetate and incubate for 2 min. Wash twice. Absorb excess liquid with filter paper and air dry at room temperature. After drying, observe the sample under a Tecnai Spirit (120 kV) transmission electron microscope.

[0138] Results: The MS2 capsid protein tandem dimer CP-ABSpyTag(G4S)CP, fused with SpyTag, was successfully expressed in sf9 cells and self-assembled into virus-like particles. Figure 1After sucrose density gradient centrifugation and layering, SDS-PAGE analysis revealed a distinct target protein band of approximately 30 kDa in layers 8 to 13, with the highest abundance in layers 9 and 10. Samples from layers 9 and 10 were collected, desaccharified, concentrated, and subjected to dynamic light scattering analysis to determine the virus-like particle size. Particle morphology was observed using transmission electron microscopy. (ABSpyTag(G4S)-MS2) luc The virus-like particles exhibited good dispersibility and uniformity, with a diameter of approximately 26.8 nm, consistent with the expected size. (See attached image) Figure 1 B and C.

[0139] Example 2: The effect of the linkage mode of SpyTag and MS2 capsid protein tandem dimer on the display of SpyCatcher fusion protein on the surface of virus-like particles.

[0140] Materials: All restriction enzymes were purchased from ThermoFisher, and all primers were synthesized by Beijing Qingke Biotechnology. Imidazole and PMSF were purchased from Shanghai Sangon Biotech, the endotoxin-free plasmid large-scale extraction kit was purchased from Tiangen Biotech, the 293F cell line was purchased from Life Technologies, OPM-293 CD05 medium and feed were purchased from OPMA, the transfection reagent PEI was purchased from Polyscience, the Vivaflow 200 vortex / tangential flow ultrafilter was purchased from Sartorius, and all ultrafiltration concentration tubes were purchased from Millipore.

[0141] 1. ABSpyTag(G4S)2-MS2( luc Construction, expression, and purification of virus-like particles

[0142] To ensure that SpyTag is fully exposed on the surface of MS2 virus-like particles and tolerates the display of larger antigens, ABSpyTag(G4S)2-MS2 was further constructed. lucA virus-like particle variant was developed, extending the GGGGS linkers flanking the SpyTag to GGGGSGGGGS. The modified SpyTag-MS2 capsid protein dimer was named CP-ABSpyTag(G4S)2-CP, with the nucleic acid sequence SEQ ID NO.27. Using the pFastBac-PH ABSpyTag(G4S)dMS2 CP-P10 luc C tandem plasmid as a template, the linkers at both ends of the SpyTag were extended by PCR amplification (primer sequences are described below). The amplified target fragment and the pFastBac-PH ABSpyTag(G4S)dMS2 CP-P10 luc C tandem plasmid were double-digested with SalI and BamHI, respectively, and recovered by agarose gel electrophoresis. Homologous recombination was performed at a vector:target fragment molar ratio of 1:2, and the resulting fragments were transformed into competent E. coli cells. Plasmids were extracted from the correctly sequenced positive clones and named pFastBac-PH ABSpyTag(G4S)2dMS2 CP-P10 luc Ctandem.

[0143] ABSpyTag(G4S)2-MS2 was expressed using the Bac to bac baculovirus expression system. luc Virus-like particles were purified by continuous sucrose density gradient centrifugation at concentrations of 20%-60%. The method was the same as in Example 1.

[0144] The amplification primers for extending the linkers at both ends of the SpyTag are shown below.

[0145] Primer F (SEQ ID NO.41):

[0146] CACCCAGTTCGTGTTGGTCGACAACGGTGGCACCGGGGGCGGTGGATCAGGTGGCGGAGGTAGCGC;

[0147] Primer R (SEQ ID NO.42):

[0148] GGAGCCACGGTCACGTCACCGGATCCACCTCCACCACTCCCTCCGCCACCCTTAGTCG.

[0149] 2. NSpyTag(G4S)2-MS2( luc Construction, expression, and purification of virus-like particles

[0150] The N-terminus of the MS2 capsid protein dimer can tolerate peptide insertion of appropriate length without affecting virus-like particle assembly. Inserting the SpyTag-GGGGSGGGGS peptide into the N-terminus of the capsid protein dimer constructs NSpyTag(G4S)2-MS2. luc A virus-like particle variant. The nucleic acid sequence encoding the MS2 capsid protein tandem dimer was optimized for the insect cell sf9 host codon and synthesized by BGI Genomics (SEQ ID NO. 11). Both capsid proteins were wild-type. The SpyTag-GGGGSGGGGS peptide coding sequence was inserted into the N-terminus of the capsid protein dimer using PCR amplification. Primer sequences are shown below. The upstream primer contained a plasmid homologous arm, an EcoRI restriction site, a kozak sequence, a start codon, and the SpyTag-GGGGSGGGGS peptide coding sequence. The downstream primer contained the stop codon TAA, a Hind III restriction site, and a plasmid homologous arm. The plasmid pFastBac-PH ABSpyTag(G4S)dMS2 CP-P10 luc C tandem was digested with EcoRI and Hind III, recovered by agarose gel, and homologously recombinated with the amplified NSpyTag(G4S)2-CP-CP (SEQ ID NO.20) target fragment at a vector:target fragment molar ratio of 1:2. The resulting plasmid was transformed into competent E. coli cells. Plasmids were extracted from correctly sequenced positive clones and named pFastBac-PH NSpyTag(G4S)2dMS2 CP-P10 luc C tandem.

[0151] NSpyTag(G4S)2-MS2 was expressed using the Bac to Bac baculovirus expression system. luc Virus-like particles were purified by continuous sucrose density gradient centrifugation at concentrations of 20%-60%. The method was the same as in Example 1.

[0152] The primers for amplifying the EcoRI-NSpyTag(G4S)2-CP-CP-HindIII fragment are shown below.

[0153] Primer F (SEQ ID NO.43):

[0154] CGTCCCACCATCGGGCGAATTCGCCACCATGGCCCATATAGTGATGGTCGATG;

[0155] Primer R (SEQ ID NO.44):

[0156] CCTCTAGTACTTCTCGACAAGCTTTTAGTAGATACCGGAGTTAGCAGC.

[0157] 3. SpyCatcher protein expression and purification

[0158] The coding sequence of the SpyCatcher gene (SEQ ID NO.28) was cloned into the pRSF-6×His-SUMO expression vector between the BamHI and NotI restriction sites using homologous recombination. The pRSF-6×His-SUMO expression vector was modified from pRSFDuet-1, with the sequence between the NcoI and BamHI restriction sites replaced by 6×his-thrombin site-SUMO (SEQ ID NO.29). The modified vector is held by the applicant and is available to the public from the Institute of Biophysics, Chinese Academy of Sciences. This biological material is only for the purpose of replicating the experiments of this invention and may not be used for other purposes. The correctly sequenced pRSF-hissumo-SpyCatcher expression plasmid was transformed into E. coli RIL competent cells, and single colonies were picked and cultured overnight in kanamycin (50 μg / mL) resistant LB medium at 37°C and 220 rpm. The culture volume was expanded to 1 L on the second day. When the OD value reached approximately 0.6 during the logarithmic growth phase, 0.4 mM of IPTG (the inducer) was added, and the culture was incubated at 180 rpm with shaking for 22 hours at 18°C. The bacterial pellet was collected at 4000 rpm for 30 minutes at 4°C for protein purification. The cells were resuspended in 100 mL of binding buffer (20 mM Tris-HCl, 150 mM NaCl, 20 mM imidazole, pH 8.5), and 1 mM of the protease inhibitor PMSF was added. The cells were then homogenized using a high-pressure homogenizer. The mixture was centrifuged at 12000 rpm for 40 minutes at 4°C, and the supernatant was collected and filtered through a 0.45 μm PVDF membrane. Soluble recombinant proteins were purified using Ni-NTA column affinity chromatography with a flow rate controlled by an HL-2B digital display constant flow pump. The affinity chromatography purification procedure is as follows: Column equilibration: binding buffer, 200 mL; Sample loading: 3 cycles; Contaminating protein removal: binding buffer, 200 mL; Elution of target protein: elution buffer (20 mM Tris-HCl, 150 mM NaCl, 500 mM imidazole, pH 8.5), 10 mL / tube, collect the eluent. The target protein sample was concentrated by centrifugation at 4000 rpm in a 10 kDa ultrafiltration tube at 4°C using SDS-PAGE. The target protein buffer was replaced with binding buffer by dilution with imidazole-free Tris-NaCl solution (20 mM Tris-HCl, 150 mM NaCl, pH 8.5) or by dialyzing. ULP1 enzyme was added, and the mixture was incubated at 4°C for 30 min. The protein sample was rebound onto the Ni-NTA affinity chromatography column, and the flow-through was collected. The purity of the target protein was determined by SDS-PAGE, and the target protein was dialyzed into Tris-NaCl solution for storage.

[0159] 4. Expression and purification of SpyCatcher-gLgH fusion protein

[0160] The nucleic acid sequence encoding the mouse Igκ secretion signal peptide -SpyCatcher-(G4S)3-EBV gL (24-137 amino acids)-(G4S)3-EBV gH (18-679 amino acids) fragment was synthesized by BGI Genomics (SEQ ID NO.21) and cloned into pCDNA. TM 3.1 / Myc-hisA expression vector. pcDNA was extracted from host bacteria using an endotoxin-free large-scale extraction kit. TM 3.1-SpyCatcher-gLgH plasmid. pCDNA was purified using PEI reagent. TM 3.1 The SpyCatcher-gLgH plasmid was transfected into the 293F cell line. To prepare the transfection mixture: Add 100 μg of plasmid to 5 mL of CD05 medium and mix well; add 450 μL of PEI to 5 mL of CD05 medium and mix well, incubate at room temperature for 2 minutes; add the PEI mixture to the plasmid mixture, mix thoroughly, and incubate at room temperature for 15-20 minutes. Then, add the transfection mixture to 100 mL of medium to a cell density of 2 × 10⁻⁶ cells / mL. 6Add cells / mL of cell culture medium, mix well, and incubate at 37°C, 5% CO2, and 125 rpm on a shaker. After 24 hours, add 5 mL of feed. After 5 days, when cell viability drops to approximately 60%-70%, collect the culture supernatant for protein purification. Perform two-step centrifugation (500×g for 10 minutes, then 8000 rpm at 4°C for 30 minutes) to remove insoluble impurities such as cell debris. Filter the supernatant through a 0.45 μm PVDF filter to further remove insoluble impurities. Concentrate the supernatant using a Vivaflow 200 vortex / tangential flow ultrafilter with a molecular weight cutoff of 30 kDa and replace the buffer solution with the binding buffer solution used for affinity chromatography purification (20 mM HEPES, 500 mM NaCl, 20 mM imidazole). Purify the expressed target protein using Ni-NTA affinity chromatography. The affinity chromatography purification procedure is as follows: Column equilibration: bind buffer (20mM HEPES, 500mM NaCl, 20mM imidazole, 10% glycerol, pH 7.4), 100mL; Sample loading: pass cell supernatant through a nickel column, repeating three times; Protein removal: bind buffer (20mM HEPES, 500mM NaCl, 20mM imidazole, 10% glycerol, pH 7.4), 100mL; Elution of target protein: elution buffer (20mM HEPES, 500mM NaCl, 250mM imidazole, 10% glycerol, pH 7.4), 10mL / tube, collect the eluent. The target protein sample was concentrated by centrifugation at 4000 rpm and 40 kDa ultrafiltration tube at 4 °C using SDS-PAGE. It was then replaced with 3× PBS buffer (411 mM NaCl, 8.1 mM KCl, 24 mM Na2HPO4 and 6 mM KH2PO4), aliquoted and stored at -80 °C.

[0161] 5. SpyCatcher and SpyCatcher-gLgH fusion proteins were respectively fused with ABSpyTag(G4S)-MS2 ( luc ), ABSpyTag(G4S)2-MS2( luc ) and NSpyTag(G4S)2-MS2( luc Virus-like particle linkage

[0162] The aspartic acid residue at position 7 of SpyTag binds to the lysine residue at position 31 of SpyCatcher (SC) to form a stable amide covalent bond; this reaction is completed within minutes. SpyCatcher or SpyCatcher-gLgH fusion proteins are then combined with three SpyTag-VLPs (i.e., ABSpyTag(G4S)-MS2( luc ), ABSpyTag(G4S)2-MS2( luc) and NSpyTag(G4S)2-MS2( luc Virus-like particles (VLPs) were ligated at different molar ratios (each VLP consisted of 90 MS2 CPdimers containing SpyTags, i.e., 90 SpyTags on one VLP; this ratio refers to the molar ratio of SpyCatcher to the SpyTags on the VLP to be ligated). The mixture was incubated overnight at 4°C in PBS (137 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, 1.8 mM KH2PO4). The SpyCatcher (SC) ligation systems with the three SpyTag-VLP ligation systems are shown in Table 2. After the reaction, 10 μL of 5× loading buffer was added to each tube, and the tubes were boiled at 100°C for 5 min. 20 μL of the sample was then subjected to 12% SDS-PAGE to determine the ligation efficiency.

[0163] Table 2

[0164]

[0165] The SpyCatcher-gLgH (SC-gLgH) ligation system with three SpyTag-VLP systems is shown in Table 3. After overnight incubation at 4°C, 12.5 μL of 5× loading buffer was added to each tube, and the tubes were boiled at 100°C for 5 min. 20 μL of sample was taken, and the ligation efficiency was detected by 15% and 7.5% SDS-PAGE.

[0166] Table 3

[0167]

[0168] Result: As luc As shown in Figure A, the SDS-PAGE electrophoresis results indicate that the ULP enzyme successfully cleaved His-Sumo from the His-Sumo-SpyCatcher protein, obtaining SpyCatcher protein with purity sufficient for downstream ligation experiments. The protein band position was largely consistent with the predicted protein size (12.5 kDa). Figure 2As shown in Figure B, SpyCatcher-gLgH protein with purity sufficient for downstream ligation experiments was obtained after Ni-NTA affinity chromatography purification. Three SpyTag-VLPs were ligated to different ratios of SpyCatcher / GLgH, and the coupling efficiency (percentage of total VLP binding sites) between the three SpyTag-VLPs and SpyCatcher / GLgH was determined by SDS-PAGE. The coupling efficiency was calculated as 1 - (gray value of the uncoupled SpyTag-MS2 CP band after reaction) / (gray value of the total SpyTag-MS2 CP band before reaction). The gray values ​​of the CP bands were quantitatively analyzed using ImageJ. Standard curves were plotted based on the gray values ​​of the CP bands of SpyTag-VLPs with different quality gradients on the SDS-PAGE gel. When linked to the smaller molecular weight SpyCatcher protein, with a SpyTag-VLP to SpyCatcher molar ratio of 1:4, ABSpyTag(G4S)2-MS2 ( Figure 2 The coupling efficiency of virus-like particles is the highest, nearly 100%. luc (C). When linked to the larger molecular weight SpyCatcher-gLgH protein, with a SpyTag-VLP to SpyCatcher-gLgH molar ratio of 1:2, NSpyTag(G4S)2-MS2 ( Figure 2 The coupling efficiency of virus-like particles is the highest, nearly 65%. luc (D). Additionally, ABSpyTag(G4S)-MS2( Figure 2 The SpyTag on the surface of virus-like particles may not be fully displayed; neither SpyCatcher nor SpyCatcher-gLgH can be well displayed on the particle surface. When conjugated with the SpyCatcher-gLgH protein, ABSpyTag(G4S)-MS2( luc ) and ABSpyTag(G4S)2-MS2( luc The virus-like particles were unstable, and two CP protein degradation bands were visible in the SDS-PAGE image (identified by mass spectrometry).

[0169] Example 3 NSpyTag(G4S)2-MS2( luc Optimization of nucleic acid encapsulation within virus-like particles

[0170] Materials: Trizol, MEGAscript kit, and Lipofectamine™ Messenger MAX transfection reagent were purchased from ThermoFisher; Cap 1 labeling kit was purchased from Nearshore Proteins; PrimeScript... TMThe RT reagent kit and oligo dT were purchased from Takara, the 2× SYBR green mix was purchased from Meiji Bio, and the Luciferase reporterassay test kit was purchased from Promega.

[0171] 1. The effect of Pac site (C variant) and UTR location distribution on in vivo translation efficiency of target mRNA

[0172] Based on the different distributions of the target genes CDs, pac site C variant, 5'-UTR, and 3'-UTR, a total of six mRNA sequences were designed (structures shown in Figure 1). luc (As shown in A). The target gene was the firefly reporter gene fireflyluciferase (SEQ ID NO. 30), with UTRs of the 5'-UTR (SEQ ID NO. 16) and 3'-UTR (SEQ ID NO. 17) of the human cellular reduced coenzyme chlorophyll CYBA, and a poly(A) tail of 120 nt. The DNA fragments corresponding to the six mRNA sequences were synthesized by BGI Genomics, transcribed using the MEGAscript kit, and capped using a vaccinia virus capping system. The obtained mRNAs were transfected into human embryonic kidney cells 293T and mouse macrophages Raw264.7, respectively. The expression level of the luciferase reporter gene was detected by a luciferase reporter assay.

[0173] (1) mRNA in vitro transcription and purification: Taking a 20 μL system as an example, the following were included: 75 mM ATP 2 μL, 75 mM CTP 2 μL, 75 mM GTP 2 μL, 75 mM N1-Me-Pseudo UTP 2 μL, 10× Reaction Buffer 2 μL, PCR product template 200 ng, enzyme mixture 2 μL, and RNase-free deionized water added to 20 μL. The reaction was carried out at 37℃ for 3 hours, then 1 μL of TURBO DNase was added, and the reaction was carried out at 37℃ for 15 minutes to digest the DNA template. The LiCl precipitation method was used to purify RNA: 20 μL of the post-transcriptional reaction mixture was added to 30 μL of RNase-free deionized water and 30 μL of 7.5 M LiCl precipitation solution, and incubated at -20°C for 1 hour; centrifuged at 12000 rpm and 4°C for 15 minutes, the supernatant was discarded, and the RNA precipitate was washed twice with pre-cooled 70% ethanol (prepared with RNase-free deionized water); the RNA was dissolved in 20 μL of RNase-free deionized water.

[0174] (2) The vaccinia virus capping system adds a Cap1 cap structure to the 5' end of the mRNA: Taking a 100 μL reaction system as an example, it contains: 50 μg RNA diluted to 67 μL, heated at 65℃ for 5 minutes, and placed on ice for 5 minutes for pre-denaturation; 10× Capping Reaction Buffer 10 μL, 10 mM GTP 10 μL, 20 mM SAM 2.5 μL, RNase inhibitor 2.5 μL, Cap2'-O-Methyltransferase 4 μL, and Vaccinia Capping Enzyme 4 μL. The reaction is carried out at 37℃ for 30 minutes, and the RNA capping is completed, which is the mature mRNA.

[0175] (3) mRNA transfection and luciferase reporter assay to detect reporter gene expression: The six mature mRNAs obtained above were transfected into 293T and Raw264.7 cells respectively using Lipofectamine™ Messenger MAX transfection reagent. The cells were seeded in 24-well plates one day in advance at a density of about 70-80%. 0.5 μg of mRNA was transfected into each well. The samples were collected 24 hours later, and reporter gene expression was detected using the Luciferase reporter assay system kit. 100 μL of deionized water was added to each well to dilute to 1× lysis buffer, and lysis was performed at room temperature for 30 minutes. 50 μL of reaction substrate was added to 2 μL of lysate, and the luciferase signal was detected using a Promega GLOMAXMULTI detector.

[0176] 2. The effects of mRNAs of different lengths on NSpyTag(G4S)2-MS2 ( Figure 3 The impact of virus-like particle packaging

[0177] To investigate the ability of MS2 virus-like particles prepared in an insect expression system to encapsulate mRNA lengths, virus-like particles encapsulating EBV EBNA1 (1095 nt), EBV gp350 (1419 nt), EBV gB (2304 nt), EBV gLgH (2520 nt), fireflyluciferase (1691 nt), and SARS-CoV-2 nucleocapsid (1401 nt) mRNA fragments were constructed. The 5'-UTR, 3'-UTR, pac site, and the target gene coding sequence were arranged in the same positions as the fifth mRNA described in Example 3, Section 1 above, and were synthesized by BGI Genomics. The above-mentioned EBNA1 (SEQ ID NO.18, 5'-UTR-EBV EBNA1 (326-641 amino acids)-C variant tandem-3'-UTR fragment nucleic acid sequence), gp350 (SEQ ID NO.31), gLgH (SEQ ID NO.32), gB (SEQ ID NO.33), and SARS-CoV-2 nucleocapsid (SEQ ID NO.34) nucleic acid fragments were amplified by PCR. The upstream primer was supplemented with a plasmid homologous arm and an Xho I restriction site, and the downstream primer was supplemented with a Kpn I restriction site and a plasmid homologous arm. The primer sequences are shown below. The pFastBac-PH NSpyTag(G4S)2dMS2 CP-P10 luc C tandem plasmid was double-digested with Xho I and Kpn I, and the fragments were recovered by agarose gel. Homologous recombination was performed at a vector:target fragment molar ratio of 1:2, and the fragments were transformed into competent E. coli cells. Plasmids were extracted from correctly sequenced positive clones and named as follows: pFastBac-PH NSpy(G4S)2dMS2 CP-P10 EBNA1 C tandem, pFastBac-PH NSpy(G4S)2dMS2 CP-P10 gp350 C tandem, pFastBac-PH NSpy(G4S)2dMS2 CP-P10 gLgH C tandem, pFastBac-PH NSpy(G4S)2dMS2 CP-P10 gB C tandem, and pFastBac-PH NSpy(G4S)2dMS2 CP-P10 nucleocapsid C tandem. Six virus-like particles were expressed using the Bac to bac baculovirus expression system, namely NSpyTag(G4S)2-MS2( luc ), NSpyTag(G4S)2-MS2( ebna1 ), NSpyTag(G4S)2-MS2( gp350), NSpyTag(G4S)2-MS2( glgh ), NSpyTag(G4S)2-MS2( gb (Same as in Example 2.2) and NSpyTag(G4S)2-MS2 ( luc Purification was performed using a continuous sucrose density gradient centrifugation at a concentration of 20%-60%, following the same method as in Example 1.

[0178] The primers for amplifying the XhoI-EBNA1 / gp350 / gLgH / gB-KpnI fragment are shown below.

[0179] Primer F (SEQ ID NO.45):

[0180] CTTGATCACCCGGGATCTCGAGGGGCGCGCCTAGCAGTG;

[0181] Primer R (SEQ ID NO.46):

[0182] GCCTCCCCCATCTCCCGGTACCTCCCGGCTTCGCTGCATTTATTG.

[0183] The primers for amplifying the XhoI-SARS-CoV-2 nucleocapsid-KpnI fragment are shown below.

[0184] Primer F (SEQ ID NO.47):

[0185] AGACTTGATCACCCGGGATCTCGAGGGGCGCGCCTAGCAGTGTC CC;

[0186] Primer R (SEQ ID NO.48):

[0187] TTAGCCTCCCCCATCTCCCGGTACCTCCCGGCTTCGCTGCATTTAT TGCAG.

[0188] RNA was extracted from 100 μg of virus-like particles using the Trizol method and replaced with PrimeScript. TMThe primers in the RTreagent Kit were oligo dT for reverse transcription, and absolute quantitative PCR was used to detect the copy number of intact mRNA encapsulated within virus-like particles. The specific steps of absolute quantitative PCR were as follows: 1 μL cDNA template, 5 μL 2× SYBR green mix, 0.4 μL upstream primer (10 μM), 0.4 μL downstream primer (10 μM), and 3.2 μL ddH2O. The PCR products of the above EBV EBNA1, gp350, gLgH, gB, firefly luciferase, and SARS-CoV-2 nucleocapsid nucleic acid sequences were used as cDNA templates for quantitative PCR, for a total of 10... 8 10 7 10 6 10 5 10 4 10 3 10 2 and 10 1 Eight dilution gradients (copy / μL) were used to plot the standard curve. The quantitative PCR primers are shown below.

[0189] nucleocapsid :

[0190] F (SEQ ID NO. 49): GGGCGCGCCTAGCAGTGTCC;

[0191] R (SEQ ID NO.50): TTCCTCCGCTTCCTCCTCTG;

[0192] ebna1 :

[0193] F (SEQ ID NO.51):ATGGAAGCCGCCCTGCTGG;

[0194] R (SEQ ID NO. 52): GGAACTCGGGGATCTCCAC;

[0195] gp350 :

[0196] F (SEQ ID NO. 53): ATGTGGCCTACCCTTGCTG;

[0197] R (SEQ ID NO. 54): CAGGTCTGGTTGCTCACCAG.

[0198] glgh :

[0199] F (SEQ ID NO.55): ATGCAAACCCCCGAACAACC;

[0200] R (SEQ ID NO.56): CTGCCTCAGCTCGCACACTC;

[0201] gb :

[0202] F (SEQ ID NO.57): ATGGAAGACGCCAAAAACATAAAG;

[0203] R (SEQ ID NO. 58): CCAGGGCGTATCTCTTCATAGCC;

[0204] SARS-CoV-2 luc :

[0205] F (SEQ ID NO.59):GGGCGCGCCTAGCAGTGTCC;

[0206] R (SEQ ID NO. 60): CGCGCCCCACTGCGTTCTC.

[0207] 3. The mRNA encapsulated within virus-like particles can be translated and expressed in mammalian cells.

[0208] NSpyTag(G4S)2-MS2 was extracted from layers 8, 9, 10, 11, and 12 of the centrifuged mixture using a continuous sucrose density gradient of 20-60%. nucleocapsid RNA encapsulated within virus-like particles. Pre-seeded 293T cells were transfected using Lipofectamine™ Messenger MAX transfection reagent. 1.5 μg of RNA was transfected into each well of a 24-well plate. Samples were collected after 24 hours, and reporter gene expression was detected using the Luciferasereporter assay system.

[0209] result: luc Six mRNAs from cell line A were transfected into 293T and Raw264.7 cells. The fifth mRNA showed the highest level of luciferase reporter gene expression in both cell types. Figure 3 The optimal sequence of UTR, pac site C variant, and target gene coding sequence (B) was determined. Quantitative real-time PCR was used to quantify the RNA within the six MS2 virus-like particles involved in this invention. The results showed that MS2 virus-like particles encapsulating 2520 nt of exogenous RNA could be successfully assembled within insect sf9 cells, and approximately 10 nucleotides of exogenous RNA were found in 100 μg VLP. 10Complete mRNA of approximately 10 copies (mixture of virus-like particles from layers 9-12 of sucrose density gradient centrifugation) Figure 3 C). Extracting NSpyTag(G4S)2-MS2( Figure 3 Fireflyluciferase RNA, derived from sf9 cells and encapsulated within virus-like particles, was successfully translated and expressed when transfected into mammalian 293T cells. The highest translation efficiency was observed in the RNA distributed within the 10th layer of virus-like particles after centrifugation using a sucrose density gradient.

[0210] Example 4: Construction of SARS-CoV-2 dual-antigen delivery vaccine particles RBD-NSpyTag(G4S)2-MS2 based on NSpyTag(G4S)2-MS2 virus-like particles luc )

[0211] Materials: Anti-Flag M2 matrix was purchased from Sigma.

[0212] 1. Expression and purification of SpyCatcher-RBD fusion protein

[0213] The nucleic acid sequence encoding the secretion signal peptide SpyCatcher-GSGGSG linker-SARS-CoV-2 RBD fragment was synthesized by BGI Genomics (SEQ ID NO.35) and cloned into pCDNA. TM 3.1 / Strep-TagII-flag expression vector. pCDNA was extracted from host bacteria using an endotoxin-free large-scale extraction kit. TM 3.1-SpyCatcher-RBD plasmid. pCDNA was injected using PEI reagent. TM3.1 The SpyCatcher-RBD plasmid was transfected into the 293F cell line using the same transfection method as described in Example 2. After 3.5 days, when cell viability decreased to approximately 60%-70%, the culture supernatant was collected for protein purification. Two-step centrifugation (500×g for 10 minutes, then 8000 rpm at 4°C for 30 minutes) was performed to remove insoluble impurities such as cell debris. The supernatant was further filtered through a 0.45 μm PVDF membrane to remove insoluble impurities. The supernatant was concentrated using a Vivaflow 200 vortex / tangential flow ultrafilter with a molecular weight cutoff of 10 kDa and replaced with Tris buffer (50 mM Tris, 150 mM NaCl, pH 7.8). The expressed target protein was purified by Anti-Flag M2 matrix affinity chromatography. The affinity chromatography purification procedure is as follows: Column equilibration: Wash the matrix with 9 column volumes of Tris buffer, repeat twice, then wash the matrix with 3 column volumes of glycine buffer (0.1M, pH=3.5) (no more than 15 minutes); then add 5 column volumes of Tris buffer for column equilibration; Sample loading: Load the cell supernatant onto the column, repeat three times; Protein removal: Wash the column with 10-20 column volumes of Tris buffer to remove unbound proteins; Elution of target protein: Elute the protein with glycine buffer (0.1M, pH 3.5), and transfer the eluted protein to 1.5 mL centrifuge tubes containing 15-25 μL of 1M Tris buffer (pH 8.0), 1 mL per tube. Collect the eluent and analyze it by SDS-PAGE. The target protein sample was concentrated by centrifugation at 4000 rpm and 4°C using a 10 kDa ultrafiltration tube, then replaced with PBS buffer (pH 7.8), aliquoted and stored at -80°C.

[0214] 2. SpyCatcher-RBD fusion protein and NSpyTag(G4S)2-MS2 ( nucleocapsid Virus-like particle linkage

[0215] SpyCatcher-RBD fusion protein with NSpyTag(G4S)2-MS2 ( nucleocapsid Virus-like particles were ligated at different molar ratios (same as 5 in Example 2) and incubated overnight at 4°C in PBS (pH 7.8). The ligation system of SpyCatcher-RBD (SC-RBD) and SpyTag-VLP is shown in Table 4. After the reaction, 5 μL of 5× loading buffer was added to each tube, and the tubes were boiled at 100°C for 5 min. The ligation efficiency was then detected by 11% SDS-PAGE. In the same reaction system, 4 μL of 6× DNA loading buffer was added to each tube, and 1% agarose gel electrophoresis was performed to detect whether particle aggregation occurred.

[0216] Table 4

[0217]

[0218] 3. RBD-NSpyTag(G4S)2-MS2( nucleocapsid Production of virus-like particles

[0219] NSPyTag(G4S)2-MS2( nucleocapsid Virus-like particles and SpyCatcher-RBD fusion protein were mixed in a large volume at a molar ratio of 1:0.5 and incubated overnight at 4°C with inverted inversion. Microprecipitates were removed using a 0.22 μm filter membrane, and excess SpyCatcher-RBD was removed by purification using an AKTAPure M1 protein purification system equipped with a Hiload 16 / 600 Superdex 200 pergrade gel filtration chromatography column. The gel filtration chromatography column was equilibrated and eluted with PBS buffer (pH=7.8) at a flow rate of 1 mL / min throughout the process. The elution peak was collected, and SDS-PAGE protein electrophoresis was used to detect whether free SpyCatcher-RBD protein had been completely removed. Virus-like particles were concentrated in a 100 kDa thickener tube, aliquoted, and stored at -80°C. The obtained RBD-NSpyTag(G4S)2-MS2 was diluted with PBS solution. nucleocapsid The virus-like particles were concentrated to 0.3 mg / mL, and 5 μL was incubated and stained with 2% uranyl acetate (same as 4 in Example 1). After drying, they were observed by Tecnai Spirit (120 kV) transmission electron microscopy.

[0220] Result: NSpyTag(G4S)2-MS2( nucleocapsid Virus-like particles were linked to SpyCatcher-RBD fusion proteins at different ratios, and the coupling efficiency between virus-like particles and SpyCatcher-RBD was detected by SDS-PAGE. When the molar ratio of SpyTag to SpyCatcher was 1:2, NSpyTag(G4S)2-MS2( nucleocapsid The coupling efficiency of virus-like particles is close to saturation. nucleocapsid (A). The ligation mixtures with different ratios were further subjected to agarose gel electrophoresis. Nucleic acid and protein staining showed that when the SpyTag to SpyCatcher molar ratio was 1:1, 1:2, 1:3, and 1:4, the ligation products aggregated and deposited in the nucleic acid gel wells. Lowering the SpyCatcher-RBD to NSpyTag(G4S)2-MS2 ( Figure 4 When the conjugation ratio of virus-like particles was 1:0.125, 1:0.25, and 1:0.5, no protein was deposited in the nucleic acid gel wells, and RNA migrated along with the AP205 protein. nucleocapsid B). Therefore, NSpyTag(G4S)2-MS2(Figure 4 Virus-like particles were conjugated to SpyCatcher-gLgH fusion protein at a 1:0.5 ratio in large volumes, and purified using a Superdex 200 pergrade gel filtration chromatography column. The resulting product was RBD-NSpyTag(G4S)2-MS2. nucleocapsid The main peak of the virus-like particles is located at 51 ml. nucleocapsid The C). SDS-PAGE protein electrophoresis showed that high-purity RBD-NSpyTag(G4S)2-MS2 was obtained. Figure 4 Virus-like particles ( nucleocapsid (D). Virus-like particles were negatively stained with 2% uranium acetate and observed and photographed using a Tecnai Spirit (120kV) transmission electron microscope. The results are as follows. Figure 4 As shown in E, RBD-NSpyTag(G4S)2-MS2( Figure 4 The virus-like particles were relatively well dispersed. However, due to the limited number of conjugated SpyCatcher-RBDs, no clear and distinct spike structures were observed on the particle surface.

[0221] Example 5: Construction of EBV dual-antigen delivery vaccine particles gp350-NSpyTag(G4S)2-MS2 based on NSpyTag(G4S)2-MS2 virus-like particles nucleocapsid )

[0222] 1. Expression and purification of SpyCatcher-gp350 fusion protein

[0223] The nucleic acid sequence encoding the mouse Igκ secretion signal peptide SpyCatcher-(G4S)3-EBV gp350 (2-425 amino acids) fragment was synthesized by BGI Genomics (SEQ ID NO.36) and cloned into pCDNA. TM 3.1 / 3xflag expression vector. pCDNA was extracted from host bacteria using an endotoxin-free large-scale extraction kit. TM 3.1 The SpyCatcher-gp350 plasmid was transfected into the 293F cell line for SpyCatcher-gp350 fusion protein expression. The transfection and protein purification methods for 293F cells were the same as in Example 4, step 1. The column binding buffer was PBS buffer (pH=7.4). SDS-PAGE analysis was performed. The target protein sample was concentrated by centrifugation at 4000 rpm in a 30 kDa ultrafiltration tube at 4°C, then replaced with PBS buffer (pH=7.4), aliquoted, and stored at -80°C.

[0224] 2. SpyCatcher-gp350 fusion protein and NSpyTag(G4S)2-MS2 ( ebna1Virus-like particle linkage

[0225] NSpyTag(G4S)2-MS2( ebna1 The preparation of virus-like particles is described in Examples 2 and 3. The SpyCatcher-gp350 fusion protein was combined with NSpyTag(G4S)2-MS2 (… ebna1 Virus-like particles were ligated at different molar ratios and incubated overnight at 4°C in PBS (pH 7.4). The ligation system of SpyCatcher-gp350 (SC-gp350) and SpyTag-VLP is shown in Table 5. After the reaction, 5 μL of 5× loading buffer was added to each tube, and the tubes were boiled at 100°C for 5 min. The ligation efficiency was then detected by 9% SDS-PAGE. In the same reaction system, 4 μL of 6× DNA loading buffer was added to each tube, and 1% agarose gel electrophoresis was performed to detect whether particle aggregation occurred.

[0226] Table 5

[0227]

[0228] 3. gp350-NSpyTag(G4S)2-MS2( ebna1 Production of virus-like particles

[0229] NSPyTag(G4S)2-MS2( ebna1 Virus-like particles and SpyCatcher-gp350 fusion protein were mixed in a large volume at a molar ratio of 1:2 and incubated overnight at 4°C with inverted inversion. Microprecipitates were removed using a 0.22 μm filter, and excess SpyCatcher-gp350 was removed by purification using an AKTA Pure M1 protein purification system with a Hiload 16 / 600 Superdex 200 pergrade gel filtration chromatography column. The gel filtration chromatography column was equilibrated and eluted with PBS buffer (pH 7.4) at a flow rate of 1 mL / min throughout the process. The elution peak was collected, and SDS-PAGE protein electrophoresis was used to detect whether free SpyCatcher-gp350 protein had been completely removed. Virus-like particles were concentrated in a 100 kDa thickener tube, aliquoted, and stored at -80°C. The obtained gp350-NSpyTag(G4S)2-MS2 was diluted with PBS solution. ebna1 The virus-like particles were concentrated to 0.5 mg / mL, and 5 μL was incubated and stained with 2% uranyl acetate (same as 4 in Example 1); after drying, they were observed by Tecnai Spirit (120 kV) transmission electron microscopy.

[0230] Result: NSpyTag(G4S)2-MS2( ebna1Virus-like particles were linked to SpyCatcher-gp350 fusion protein at different ratios, and the coupling efficiency between virus-like particles and SpyCatcher-gp350 was detected by SDS-PAGE. ebna1 (A). The ligation products from different ratios were further subjected to agarose gel electrophoresis. Nucleic acid and protein staining showed that when the molar ratio of SpyTag to SpyCatcher was 1:0.125, 1:0.25, 1:0.5, 1:1, 1:2, 1:3, and 1:4, the ligation products did not aggregate, RNA migrated along with AP205 protein, and no protein was deposited in the nucleic acid gel wells (A). Figure 5 B). NSPyTag(G4S)2-MS2( Figure 5 Virus-like particles were massively conjugated with SpyCatcher-gp350 fusion protein at a 1:2 ratio, and purified using a Superdex 200 pergrade gel filtration chromatography column. The resulting product was gp350-NSpyTag(G4S)2-MS2. ebna1 The main peak of the virus-like particles is located at 49 mL. ebna1 The C). SDS-PAGE protein electrophoresis showed that high-purity gp350-NSpyTag(G4S)2-MS2 was obtained. Figure 5 Virus-like particles ( ebna1 (D). Virus-like particles were negatively stained with 2% uranium acetate and observed and photographed using a TecnaiSpirit (120kV) transmission electron microscope. The results are as follows. Figure 5 As shown in E, gp350-NSpyTag(G4S)2-MS2( Figure 5 The virus-like particles exhibit good dispersion and uniformity, with clearly visible protrusions on the outer surface of the spherical core of the virus-like particles, namely the SpyCatcer-gp350 antigen.

[0231] Example 6: Construction of EBV dual-antigen delivery vaccine particles gLgH-NSpyTag(G4S)2-MS2 based on NSpyTag(G4S)2-MS2 virus-like particles ebna1 )

[0232] Materials: Tween20 purchased from Beijing Lanbolide, Blocker TMCasein in PBS was purchased from Thermo Fisher, HRP-goat-anti-human from EarthOx, TMB Substrate Kit from Thermo Fisher, 100kDa concentration tubes from Merck Millipore, 96-well ELISA plates from Corning Costar, and gLgH neutralizing antibody 1D8 was provided by Professor Xu Miao's research group at Sun Yat-sen University Cancer Center (Sun Yat-sen University Cancer Hospital, Sun Yat-sen University Cancer Institute).

[0233] 1. gLgH-NSpyTag(G4S)2-MS2( ebna1 Production of virus-like particles

[0234] The expression and purification of the antigen fusion protein SpyCatcher-gLgH are described in Example 2, section 4. NSpyTag(G4S)2-MS2( ebna1 The preparation of virus-like particles is described in Examples 2 and 3. NSpyTag(G4S)2-MS2 ( ebna1 Virus-like particles and SpyCatcher-gLgH fusion protein were mixed in a large volume at a molar ratio of 1:2 and incubated overnight at 4°C with inverted inversion. Minor precipitates were removed using a 0.22 μm filter, and excess SpyCatcher-gLgH was removed by purification using an AKTA Pure M1 protein purification system equipped with a Hiload 16 / 600 Superdex 200 pergrade gel filtration chromatography column. The gel filtration chromatography column was equilibrated and eluted with PBS buffer at a flow rate of 1 mL / min throughout the process. The elution peak was collected, and SDS-PAGE protein electrophoresis was used to determine whether free SpyCatcher-gLgH protein had been completely removed. The virus-like particles were concentrated in a 100 kDa thickener tube, aliquoted, and stored at -80°C.

[0235] 2. gLgH-NSpyTag(G4S)2-MS2( ebna1 Characterization of virus-like particles

[0236] PBS solution diluted gLgH-NSpyTag(G4S)2-MS2( ebna1Virus-like particles were diluted to 0.5 mg / mL. 5 μL of the diluted solution was dropped onto a 300-mesh carbon copper mesh and allowed to adsorb for 1 min. The liquid was gently absorbed from the edge of the copper mesh with filter paper. 5 μL of 2% uranyl acetate was added for incubation and staining for 2 min, followed by two washes. Excess liquid was absorbed with filter paper, and the sample was air-dried at room temperature. After drying, the sample was observed under a Thermo Fisher Talos F200C transmission electron microscope equipped with a Gatan K2 summit camera (4K×4K). Data collection was performed on regions with good particle dispersion and uniformity. A template-free automatic selection procedure based on a Laplace-Gaussian (LoG) filter was used to select an initial particle set from 50 frames of samples, generating a two-dimensional classification template. All particles were automatically selected based on this template. RELION 5.0 was used to further process the data and reconstruct the morphology and structure of the virus-like particles in two dimensions. ELISA detection of gLgH-NSpyTag(G4S)2-MS2( ebna1 The binding affinity of virus-like particles to gLgH neutralizing antibody 1D8 was evaluated to assess the immunogenicity of the gLgH protein displayed on the particle surface. gLgH and gLgH-NSpyTag(G4S)2-MS2 were diluted separately with coating buffer (PBS solution). ebna1 Virus-like particles, in which the molar amounts of gLgH are equal, gLgH 2μg / mL, gLgH-NSpyTag(G4S)2-MS2( ebna1 Virus-like particles, 3.5 μg / mL, were added to 50 μL / well of an ELISA plate and incubated overnight at 4°C. The next day, 300 μL / well of 0.05% PBST (PBS solution containing 0.05% Tween 20) was added, and the plate was washed three times. TM Block with casein in PBS, 100 μL / well, incubate at room temperature for 1 hour. Neutralize with gLgH antibody 1D8 using a blocker. TM Casein was serially diluted in PBS (initial concentration 10 μg / mL, 50 μL / well, then 3-fold dilution for a total of 12 gradients), and mixed with gLgH, gLgH-NSpyTag(G4S)2-MS2 at room temperature. ebna1 Incubate virus-like particles in a 96-well ELISA plate for 3 hours. Add 300 μL of 0.05% PBST per well and wash 3 times. Secondary antibody HRP-goat-anti-human (1:2000, using Blocker) TM Casein diluted in PBS) was incubated at room temperature for 1 hour. 300 μL of 0.05% PBST / well was added, and the sample was washed 7 times. Color development was performed using a TMB Substrate Kit, and the reaction was stopped with 2M H2SO4. The OD values ​​of the corresponding wells were read using a microplate reader. 450 -OD630 value.

[0237] Result: gLgH-NSpyTag(G4S)2-MS2( ebna1 Virus-like particles and SpyCatcher-gLgH fusion protein were mixed and purified using a Superdex 200 pergrade gel filtration chromatography column. gLgH-NSpyTag(G4S)2-MS2( ebna1 The main peak of the virus-like particles is located at 49.5 ml. ebna1 A). SDS-PAGE protein electrophoresis showed that high-purity gLgH-NSpyTag(G4S)2-MS2 was obtained. Figure 6 Virus-like particles ( ebna1 B). gLgH-NSpyTag(G4S)2-MS2( Figure 6 Virus-like particles were negatively stained with 2% uranium acetate and observed and photographed using a Talos F200C transmission electron microscope equipped with a Gatan K2 summit camera. Two-dimensional reconstruction was then performed, and the results are as follows: ebna1 As shown in C, compared with MS2 virus-like particles without antigen, gLgH-NSpyTag(G4S)2-MS2( Figure 6 The outer surface of the spherical core of the virus-like particle has clearly visible protrusions, namely the bound SC-gLgH antigen. ELISA detects gLgH and gLgH-NSpyTag(G4S)2-MS2( ebna1 The affinity of virus-like particles for gLgH neutralizing antibody 1D8 indicates that the immunogenicity of the antigen increases after gLgH is displayed on the surface of MS2 virus-like particles. (See [link to relevant documentation]). ebna1 D.

[0238] Example 7 gLgH-NSpyTag(G4S)2-MS2( Figure 6 Virus-like particles induce a gLgH-specific antibody response in mice.

[0239] Materials: Aluminum adjuvant was purchased from Thermo Fisher; TLR9 ligand mouse CpG-B adjuvant (ODN1826, 5'-tccatgacgttcctgacgtt-3', all nucleotides were thiolated) was synthesized by Takara; C57BL / 6 female mice (6-8 weeks old) were purchased from Jiangsu Jicui Yaokang Biotechnology Co., Ltd.; HRP-goat-anti-mouse IgG was purchased from BethylLaboratories.

[0240] 1. C57BL / 6 mouse immunization regimen

[0241] C57BL / 6 mice were divided into five groups: (1) Naïve; (2) gLgH antigen mixed with aluminum adjuvant, 9 μg / mouse; (3) gLgH antigen mixed with aluminum adjuvant and CpG adjuvant, 9 μg / mouse, with CpG dosage of 20 μg / mouse; (4) gLgH-NSpyTag(G4S)2-MS2( ebna1 ) Virus-like particles, 15μg / animal; (5) gLgH-NSpyTag(G4S)2-MS2( ebna1 Virus-like particles were mixed with aluminum adjuvant and CpG adjuvant, 15 μg / animal, and the CpG dosage was 20 μg / animal. gLgH antigen was reacted with gLgH-NSpyTag(G4S)2-MS2 ( ebna1 The molar amounts of gLgH in the virus-like particles were equal. Each group's immune component was diluted with PBS to a 200 μL immunization system per mouse, and subcutaneous immunization was administered via the tail base. A second immunization with the same dose was given 14 days after the initial immunization, and a third immunization was given on day 28. Serum samples from immunized mice were collected at days 14, 28, 42, 70, 126, and 147 after the initial immunization to detect anti-gLgH antibody levels.

[0242] 2. ELISA detection of specific antibody levels against gLgH in mouse serum.

[0243] Dilute gLgH antigen to 2 μg / mL with PBS solution and coat ELISA plates with 50 μL / well, incubating overnight at 4°C. Perform serial dilutions of mouse serum (initial 1:100, then 3-fold dilutions for a total of 12 dilutions) and incubate with the gLgH-coated ELISA plates at room temperature for 3 hours. Incubate with the secondary antibody HRP-goat-anti-mouse IgG at room temperature for 1 hour. Develop with TMB substrate and read the OD values ​​of the corresponding wells using a microplate reader. 450 and OD 630 Values. Wells containing unincubated serum were used as blank controls; OD values ​​of 12 blank control wells were calculated. 450 -OD 630 The average value plus 10 times the standard deviation is taken as the baseline value, and the lowest serum dilution greater than the baseline value is recorded as the antibody titer.

[0244] Results: 14 days after initial immunization, gLgH-NSpyTag(G4S)2-MS2 without any adjuvant was observed. ebna1 Virus-like particles can induce high titers of anti-gLgH IgG antibodies, with antibody titers reaching 1×10⁻⁶. 4 The levels were approximately higher than those of the gLgH antigen mixed with aluminum adjuvant, gLgH antigen mixed with aluminum adjuvant, and CpG adjuvant groups. After combining aluminum adjuvant and CpG adjuvant, the gLgH-NSpyTag(G4S)2-MS2 ( ebna1The antibody response induced by the virus-like particles in mice was further enhanced, with antibody titers reaching 1×10⁻⁶. 4.8 Approximately two weeks after the second immunization, gLgH-NSpyTag(G4S)2-MS2 ( ebna1 The level of anti-gLgH IgG antibodies induced by virus-like particles was comparable to that in the gLgH antigen mixed aluminum adjuvant and CpG adjuvant groups, but still higher than that in the gLgH antigen mixed aluminum adjuvant group. Two weeks after the third immunization, the gLgH antibody level in the gLgH antigen mixed aluminum adjuvant and CpG adjuvant groups was slightly higher than that in the gLgH-NSpyTag(G4S)2-MS2 group. ebna1 The antibody levels in the virus-like particle group and the gLgH antigen mixed aluminum adjuvant group were still the lowest, with gLgH-NSpyTag(G4S)2-MS2( ebna1 The highest levels were observed in the group with virus-like particles mixed with aluminum adjuvant and CpG adjuvant. Long-term monitoring was performed by collecting blood samples at days 70, 126, and 147 of the immunization process. Results showed that gLgH-NSpyTag(G4S)2-MS2 ( ebna1 The antibody levels induced by virus-like particles have good persistence. ebna1 ).

[0245] Example 8 gLgH-NSpyTag(G4S)2-MS2( Figure 7 Virus-like particles induce EBV neutralizing antibodies in mice.

[0246] Materials: Defined Keratinocyte-SFM and EpiLife medium were purchased from Gibico; TPA (phorbol ester) was purchased from Cell Signaling Technology; NaB (sodium butyrate) was purchased from Merk; anti-IgG antibody was purchased from Sigma; and TGF-β was purchased from Peprotech. EBV-GFP-infected CNE2 cells were provided by the Zeng Musheng research group at Sun Yat-sen University Cancer Center. EBV-negative Akata cells were provided by the Xu Miao research group at Sun Yat-sen University Cancer Center. EBV-GFP-infected Akata cells and immortalized NP460-Tert nasopharyngeal epithelial cells were provided by the Sai-Wah Tsao research group at the University of Hong Kong.

[0247] 1. Preparation of EBV from epithelial cells

[0248] CNE2 cells infected with EBV-GFP were cultured in RPMI 1640 medium with 5% FBS at 37°C in a 5% CO2 incubator. When the cells reached 90% confluence, TPA (20 ng / mL) and NaB (2.5 mM) were added for induction. After 12 hours, the cells were washed with PBS and fresh culture medium was added. The culture supernatant was collected 48–72 hours after medium change, centrifuged at 2000 rpm for 10 minutes at 4°C to remove cell debris, and then filtered through a 0.45 μm filter. Virus concentration was achieved by centrifugation at 27600 RCF for 3 hours using a Himac ultracentrifuge with a P45AT rotor at 4°C. The concentrated virus was resuspended in serum-free RPMI 1640 medium and used immediately for infection or aliquoted and stored at -80°C.

[0249] 2. Preparation of EBV from B cells

[0250] Akata cells infected with EBV-GFP were cultured in RPMI 1640 + 10% FBS at 37°C with 5% CO2. When the cells reached the logarithmic growth phase, the density was adjusted to 2 × 10⁶ cells / year. 6 Cells / mL were added to induce infection with anti-IgG antibody at a final concentration of 5 μg / mL. After 5 days, the culture supernatant was collected, centrifuged at 2000 rpm, 4°C for 10 minutes to remove cells and cell debris, and then filtered through a 0.45 μm filter. Virus concentration was achieved by centrifuging at 27600 RCF for 3 hours using a Himac ultracentrifuge with a P45AT rotor at 4°C. The concentrated virus was resuspended in RPMI 1640 + 10% FBS medium and used immediately for infection or aliquoted and stored at -80°C.

[0251] 3. Detection of neutralizing antibody levels in mouse serum against EBV-infected B cells

[0252] Serum from mice on day 28 of Example 7 was collected, and the levels of neutralizing antibodies against EBV-infected B cells in the serum were compared using the following in vitro neutralizing antibody detection method: Mouse serum was diluted with serum-free RPMI 1640 medium, starting with a 5-fold serial dilution, for a total of 6 dilutions. 25 μL of the diluted serum was added to a 96-well cell plate, along with 25 μL of GFP-EBV virus dilution produced by LNE2 cells, and the mixture was incubated at 37°C for 2 hours. Akata cells were resuspended in serum-free RPMI 1640 medium, and the cell concentration was adjusted to 2 × 10⁶ cells / well. 6Cells / mL. 50 μL of cell suspension was added to the above virus-mouse serum mixture, incubated for 3 hours, then replaced with fresh, EBV-free complete culture medium (RPMI 1640 + 10% FBS), and cultured at 37°C for another 48 hours. The virus infection rate (number of GFP-positive cells) of Akata cells was detected using a BD LSR Fortessa flow cytometer, and the IC50 of serum virus-neutralizing antibodies was calculated using Prism. 50 .

[0253] 4. Detection of neutralizing antibody levels in mouse serum against EBV-infected epithelial cells

[0254] Serum from mice on day 28 of Example 7 was used to compare the levels of neutralizing antibodies against EBV-infected epithelial cells in the serum using the following in vitro neutralizing antibody detection method: NP460tert cells were seeded in 96-well plates at a volume of 100 μL (7500 cells / well) using a 1:1 mixture of Defined Keratinocyte-SFM and EpiLife medium and incubated at 37°C for 24 hours. Afterward, the medium was replaced with a 2 ng / mL mixture of Defined Keratinocyte-SFM and EpiLife medium and cultured for another 24 hours. Mouse serum was diluted 25-fold with RPMI 1640 + 10% FBS medium. 125 μL of the diluted serum was added to a 96-well cell plate, along with 125 μL of GFP-EBV virus diluted with Akata cells. The mixture was thoroughly mixed and incubated at 37°C for 2 hours. The TGF-β-containing medium in the NP460tert cells was aspirated, the cells were washed once with PBS, and the above-mentioned virus-mouse serum mixture was added. The cells were then incubated at 37°C. After 48 hours, the NP460tert cells in the 96-well plates were digested, resuspended in PBS containing 2% paraformaldehyde and 2% FBS, and the proportion of GFP-positive NP460tert cells was detected using a BD LSR Fortessa flow cytometer to compare the virus infection rate.

[0255] Result: As ebna1 As shown in A, gLgH-NSpyTag(G4S)2-MS2( Figure 8 The titer of B-cell virus-neutralizing antibodies induced by virus-like particles was higher than that of gLgH vaccine components containing mixed aluminum adjuvant or aluminum adjuvant combined with CpG adjuvant. Among them, gLgH-NSpyTag(G4S)2-MS2( ebna1 The highest titer of neutralizing antibodies against B-cell viruses was induced by a mixture of virus-like particles and aluminum adjuvant, as well as CpG adjuvant. ebna1As shown in B, gLgH-NSpyTag(G4S)2-MS2( Figure 8 The titer of virus-neutralizing antibodies induced by virus-like particles in epithelial cells was also higher than that of conventional gLgH vaccines with mixed aluminum adjuvants.

[0256] Example 9 gLgH-NSpyTag(G4S)2-MS2( ebna1 Virus-like particles induce EBNA1-specific T cell responses in mice.

[0257] Materials: MultiScreen Filter ELISPOT plates (MSIPS4510) were purchased from Millipore; PepTivator® EBV EBNA-1 peptide library for T cell in vitro activation was purchased from Miltenyi Biotec; concanavalin A, the stimulant, was purchased from Sigma; OTI and OTII peptides were purchased from Shanghai BioShenggong; AEC substrate chromogenic kit was purchased from BD; and mouse IFNγ ELISPOT assay kit was purchased from MABTECH.

[0258] 1. C57BL / 6 mouse immunization regimen

[0259] C57BL / 6 mice were divided into three groups: (1) Naïve; (2) gLgH-NSpyTag(G4S)2-MS2( ebna1 (3) gLgH-NSpyTag(G4S)2-MS2( ebna1 Virus-like particles were mixed with aluminum adjuvant and CpG adjuvant, 100 μg / mouse, and CpG was administered at a dose of 50 μg / mouse. Each group's immunization components were diluted with PBS to a 200 μL immunization system per mouse, and subcutaneous immunization was performed at the base of the tail. A second immunization with the same dose was administered 7 days after the initial immunization. On day 12, inguinal lymph nodes of the immunized mice were harvested for EBNA1 analysis. + IFNγ + T-cell detection.

[0260] 2. ELISpot detection of EBNA1 + IFNγ + Specific T cells

[0261] One day in advance, pretreat ELISPOT plates with 35% ethanol (30 μL / well, discard after no more than 1 minute). Wash twice with 200 μL / well of QH2O. Wash three times with 200 μL / well of PBS. Coat with IFNγ capture antibody AN18 (diluted with 0.22 μm filtered PBS to a final concentration of 10 μg / mL, 100 μL / well) and incubate overnight at 4°C. Place mouse inguinal lymph nodes in RPMI 1640 medium containing 2% FBS. Thoroughly grind the lymph nodes on a 70-mesh sieve using the back of a 1 mL syringe plunger to remove precipitate. Centrifuge at 1200 rpm for 5 minutes, then resuspend and count the cells. Dilute the cells to 5 × 10⁶ cells / well. 6 / mL, at 5×10 per well 5 Cells were seeded in 96-well round-bottom plates. A total of 5 μg / mL of the positive stimulus concanavalin A (ConA), 10 μg / mL of the OTI+OTII negative control stimulating peptide, and 0.6 nmol (approximately 1 μg) of EBV peptide library per peptide / mL were added, for a total volume of 200 μL. The ELISPOT plates were pre-washed with PBS, and 100 μL of RPMI 1640 medium containing 10% FBS was added. The plates were blocked at room temperature for 2 hours. The blocking medium was discarded, and the cell-stimulant mixture was vertically transferred dropwise to the ELISPOT plates and incubated at 37°C for 48 hours. The plates were washed twice with QH2O and three times with 0.05% PBST. 100 μL / well of the IFNγ detection antibody R4-6A2-biotin (diluted to 1 μg / mL with PBS containing 0.5% FBS and filtered through a 0.22 μm membrane) was added to each well, and the plates were incubated at room temperature for 2 hours. The plates were washed three times with 0.05% PBST. Add 100 μL of Streptavidin-HRP (diluted 100-fold with PBS containing 0.5% FBS) to each well and incubate at room temperature for 1 hour. Wash the plate four times with 0.05% PBST and twice with PBS. Develop the AEC substrate, stop the reaction with QH2O, and after drying, photograph the plate using a Cellular Technology Limited instrument and count the number of spots on the membrane.

[0262] Result: As ebna1 As shown, gLgH-NSpyTag(G4S)2-MS2( Figure 9 Immunization with virus-like particles combined with aluminum adjuvant and CpG adjuvant can induce EBNA1 in mice. + IFNγ + Specific T cell response.

[0263] In summary, this invention utilizes a baculovirus Bac-to-Bac expression system to produce MS2-based virus-like particles gLgH-NSpyTag(G4S)2-MS2( ebna1 ebna1Not only can it effectively display SpyTag peptides on its outer surface, facilitating rapid and efficient display of antigen proteins and effectively inducing the production of specific antibodies and neutralizing antibodies against EBV, but it can also encapsulate exogenous mRNA and deliver it into mice to generate specific T cell responses.

[0264] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. An immunogenic complex, characterized in that, The complex consists of virus-like particles and an antigen covalently linked to the virus-like particles via a SpyCatcher-SpyTag system, wherein the covalent link causes the antigen to be displayed on the surface of the virus-like particles. The virus-like particles are composed of bacteriophage capsid proteins and nucleic acids encapsulated within them. The SpyTag is linked to the N-terminus of the phage capsid protein via a first linker peptide; the SpyCatcher is linked to the N-terminus of the antigen via a second linker peptide. The phage capsid protein is an MS2 phage capsid protein dimer, and its amino acid sequence is shown in SEQ ID NO.2; The antigen is EB virus envelope glycoprotein gLgH, which is a fusion protein formed by gL protein and gH protein; the amino acid sequence of gL protein is shown in SEQ ID NO.3, and the amino acid sequence of gH protein is shown in SEQ ID NO.

4. The nucleic acid is the mRNA of EB virus nuclear antigen EBNA1, and the sequence of the gene encoding the mRNA is shown in SEQ ID NO.

18.

2. The immunogenic complex according to claim 1, characterized in that, The sequence of the first linker peptide is shown in SEQ ID NO.

1.

3. The immunogenic complex according to claim 1, characterized in that, The second linker peptide is a flexible linker peptide rich in glycine and serine.

4. The immunogenic complex according to any one of claims 1 to 3, characterized in that, The amino acid sequence encoded by the mRNA of the nuclear antigen EBNA1 is shown in SEQ ID NO.

7.

5. A polynucleotide combination, characterized in that, The polynucleotide combination encodes the immunogenic complex according to any one of claims 1 to 4, comprising: (1) First polynucleotide: Its sequence contains, along the 5'-3' direction, the SpyTag coding sequence, the first linker peptide coding sequence, and the phage capsid protein dimer coding sequence; (2) Second polynucleotide: Its sequence along the 5'-3' direction contains the 5'-UTR, the coding sequence of the nuclear antigen EBNA1, two tandem phage packaging sites and the 3'-UTR; And, (3) the third polynucleotide: its sequence contains, along the 5'-3' direction, the coding sequence of SpyCatcher, the coding sequence of the second linker peptide and the coding sequence of the membrane glycoprotein gLgH.

6. A recombinant vector combination, characterized in that, The recombinant vector comprises: (1) First recombinant vector: comprising a polynucleotide, wherein the polynucleotide is the first polynucleotide and the second polynucleotide of claim 5; And, (2) the second recombinant vector: comprising a polynucleotide, wherein the polynucleotide is the third polynucleotide of claim 5.

7. A host cell assembly, characterized in that, The host cell assembly comprises: (1) First host cell: comprising a recombinant vector, wherein the recombinant vector is the first recombinant vector of claim 6; And, (2) second host cell: comprising a recombinant vector, wherein the recombinant vector is the second recombinant vector of claim 6.

8. The method for preparing the immunogenic complex according to any one of claims 1 to 4, characterized in that, The preparation method includes: The first recombinant vector described in claim 6 is introduced into Escherichia coli containing a baculovirus shuttle vector to obtain recombinant baculovirus particles. The recombinant rod particles were transfected into insect cells to obtain the virus-like particles; The second recombinant vector as described in claim 6 is introduced into a host cell to obtain a fusion protein of SpyCatcher and the antigen; The fusion protein of SpyCatcher and the antigen is linked to virus-like particles.

9. Any of the following applications of the immunogenic complex according to any one of claims 1 to 4, the polynucleotide combination according to claim 5, the recombinant vector combination according to claim 6, or the host cell combination according to claim 7: (1) To prepare drugs for the prevention of EB virus infection; (2) Prepare drugs for preventing diseases caused by EB virus infection.

10. A drug, characterized in that, The drug comprises the immunogenic complex according to any one of claims 1 to 4.

11. The medicament according to claim 10, characterized in that, The drug in question is a vaccine.

Citation Information

Patent Citations

  • Vaccine compositions against novel coronavirus infections

    CN114634578A

  • VLP-mRNA composite multivalent virus vaccine as well as preparation method and application thereof

    CN116474083A