Mutant PHT nanopore protein monomer and application thereof

Abstract

The invention discloses a mutant PHT nanopore protein monomer and application thereof. The mutant PHT nanopore protein monomer comprises a mutant of which the sequence is shown as SEQ ID NO: 2, and the mutant comprises mutation at at least one position of the 181st position, the 185th position, the 219th position and the 233th position of the SEQ ID NO: 2. On the basis of the wild type PHT nanopore protein, the capture and resolution capabilities of a DNA substrate are improved by means of amino acid mutation and combined mutation.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and particularly to a mutant PHT nanopore protein monomer and its application. Background Art

[0002] Pore proteins are one of the key technologies affecting nanopore sequencing. The characteristics of the constriction region (reading head) of pore proteins have a great impact on obtaining the original current signal. At present, the types of pore proteins are single. Only a few pore proteins such as Mycobacterium smegmatis porin A (MspA), curli-specific transport channels, and channel complexes (CsgG, CsgG-CsgF) can be used for DNA detection, and only two pore channels, CsgG and CsgG-CsgF, are commercially available (Oxford Nanopore Technologies). In addition, the properties of the amino acid residues in the transmembrane barrel wall of wild-type nanopore proteins pointing to the inside of the channel, especially the charged properties, cannot meet the substrate detection requirements in most cases. Summary of the Invention

[0003] Nanopore proteins play an important role in nanopore sequencing technology. The stability of the empty pore current, the capture ability of the DNA substrate to be detected, and the resolution ability of DNA are all closely related to pore proteins. Based on the wild-type PHT nanopore protein, the present invention improves its capture and resolution abilities for DNA substrates through amino acid mutation and combined mutation.

[0004] The present invention provides a mutant PHT nanopore protein monomer, which comprises a mutant with a sequence as shown in SEQ ID NO:2. The mutant comprises mutations at least at one of positions 181, 185, 219, and 233 of SEQ ID NO:2. For example, the mutant comprises mutations at one, two, three, or four of positions 181, 185, 219, and 233 of SEQ ID NO:2. The mutations at positions 185, 219, and / or 233 may be mutations that result in a change in the charge property. The mutation at position 181 may be a mutation that results in a change in the stability of the nanopore constriction region.

[0005] Optionally, according to the above mutant PHT nanopore protein monomer, the mutant further comprises a mutation at position 87 of SEQ ID NO:2. The mutation at position 87 may be a mutation that results in a change in the diameter of the nanopore constriction region.

[0006] Optionally, according to the above mutant PHT nanopore protein monomer, the mutation is an amino acid substitution. An amino acid substitution means that one amino acid in a protein molecule is replaced by another amino acid. Amino acids may include natural amino acids and / or non-natural amino acids.

[0007] Optionally, the mutation at position 87 is the substitution of phenylalanine at position 87 with leucine, threonine, asparagine, isoleucine or valine; the mutation at position 181 is the substitution of asparagine at position 181 with aspartic acid or glutamic acid; the mutation at position 185 is the substitution of arginine at position 185 with glutamine or asparagine; the mutation at position 219 is the substitution of arginine at position 219 with glutamine or asparagine; the mutation at position 233 is the substitution of glutamine at position 233 with glutamic acid or aspartic acid.

[0008] Optionally, the mutant PHT nanopore protein monomer is any of the following protein monomers:

[0009] (A1) A protein monomer with the amino acid sequence shown in SEQ ID NO:4 or SEQ ID NO:6;

[0010] (A2) A fusion protein obtained by connecting a tag to the end of the protein monomer defined in (A1).

[0011] The tag refers to a polypeptide or protein that is fused and expressed together with the target protein by using in vitro DNA recombination technology, so as to facilitate the expression, detection, tracing and / or purification of the target protein. The protein tag can be a Flag tag, His tag, MBP tag, HA tag, myc tag, GST tag and / or SUMO tag, etc.

[0012] The present invention also provides a construct, which comprises at least two connected PHT nanopore protein monomers, and at least one of the PHT nanopore protein monomers is the above-mentioned mutant PHT nanopore protein monomer. The construct retains the ability to form pores.

[0013] The present invention also provides a mutant PHT nanopore protein, which comprises at least two connected PHT nanopore protein monomers, and at least one of the PHT nanopore protein monomers is the above-mentioned mutant PHT nanopore protein monomer; or the mutant PHT nanopore protein comprises the above-mentioned construct.

[0014] Optionally, in the above-mentioned construct or the above-mentioned mutant PHT nanopore protein, the PHT nanopore protein monomers are the same or different. For example, the PHT nanopore protein monomers may include a PHT nanopore protein monomer with the sequence shown in SEQ ID NO:2, a mutant PHT nanopore protein monomer with the sequence shown in SEQ ID NO:4 and / or a mutant PHT nanopore protein monomer with the sequence shown in SEQ ID NO:6. The connection is a covalent or non-covalent connection. In some embodiments, the connection is a non-covalent connection, mainly through hydrogen bonds.

[0015] The present invention also provides related biological materials of the above-mentioned mutant PHT nanopore protein monomer, the above-mentioned construct or the above-mentioned mutant PHT nanopore protein, and the related biological materials are any one of the following:

[0016] a1) A nucleic acid molecule encoding the above-mentioned mutant PHT nanopore protein monomer, the above-mentioned construct or the above-mentioned mutant PHT nanopore protein;

[0017] a2) An expression cassette containing the nucleic acid molecule described in a1);

[0018] a3) A recombinant vector containing the nucleic acid molecule described in a1), or a recombinant vector containing the expression cassette described in a2);

[0019] a4) A recombinant cell containing the nucleic acid molecule described in a1), or a recombinant cell containing the expression cassette described in a2), or a recombinant cell containing the recombinant vector described in a3).

[0020] In the above-mentioned biological materials, the nucleic acid molecule can be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule can also be RNA, such as mRNA, siRNA, shRNA, sgRNA, miRNA or antisense RNA.

[0021] In the above-mentioned biological materials, the expression cassette refers to DNA that can express a gene in a host cell, and this DNA not only includes a promoter for initiating gene transcription, but also includes a terminator for terminating gene transcription. Further, the expression cassette may also include an enhancer sequence.

[0022] Optionally, the nucleic acid molecule in a1) is any of the following DNA molecules:

[0023] 1) A DNA molecule whose coding sequence is the DNA molecule shown in SEQ ID NO:3 or SEQ ID NO:5;

[0024] 2) A DNA molecule whose nucleotide sequence is the DNA molecule shown in SEQ ID NO:3 or SEQ ID NO:5;

[0025] 3) A DNA molecule that hybridizes with the nucleotide sequence defined in 1) or 2) under stringent conditions and encodes the above-mentioned mutant PHT nanopore protein monomer, the above-mentioned construct or the above-mentioned mutant PHT nanopore protein.

[0026] Optionally, the recombinant vector in a3) is a vector having the DNA molecule shown in SEQ ID NO:3 or SEQ ID NO:5, such as the pET-28a PHT-M4 vector or the pET-28a PHT-M4-F87L vector prepared in the following examples.

[0027] The stringent conditions may be hybridization and membrane washing at 65°C in a solution of 0.1×SSPE (or 0.1×SSC) and 0.1% SDS.

[0028] The use of the above-mentioned mutant PHT nanopore protein monomer, the above-mentioned construct, the above-mentioned mutant PHT nanopore protein, or the above-mentioned related biological material in detecting the presence, absence, or one or more characteristics of a target analyte or in preparing a product for detecting the presence, absence, or one or more characteristics of a target analyte also falls within the scope of protection of the present invention.

[0029] The present invention also provides a method for determining the presence, absence, or one or more characteristics of a target analyte, the method comprising:

[0030] A. contacting the target analyte with the above-mentioned mutant PHT nanopore protein such that the target analyte moves relative to the mutant PHT nanopore protein;

[0031] B. obtaining one or more measurement values when the target analyte moves relative to the mutant PHT nanopore protein, thereby determining the presence, absence, or one or more characteristics of the target analyte.

[0032] Optionally, the method further comprises the step of applying a potential difference when the target analyte contacts the above-mentioned mutant PHT nanopore protein.

[0033] Optionally, the measurement values are obtained by electrical measurement and / or optical measurement. For example, the electrical measurement includes but is not limited to current measurement, impedance measurement, tunneling measurement, wind tunnel measurement, or field effect transistor (FET) measurement, etc. In a specific embodiment of the present invention, the measurement value is a current measurement value.

[0034] The present invention also provides a kit for determining the presence, absence, or one or more characteristics of a target analyte, the kit comprising the above-mentioned mutant PHT nanopore protein monomer, the above-mentioned construct, the above-mentioned PHT nanopore mutant protein, or the above-mentioned related biological material, and a membrane.

[0035] The present invention also provides a device for determining the presence, absence, or one or more characteristics of a target analyte, the device comprising the above-mentioned mutant PHT nanopore protein, and a membrane.

[0036] In the above-mentioned kit or device, the membrane and the mutant PHT nanopore protein may be independently packaged, or the mutant PHT nanopore protein may be embedded in the membrane.

[0037] The membrane described above can be any membrane existing in the prior art, preferably an amphiphilic molecular layer, that is, a layer formed by amphiphilic molecules such as phospholipids having at least one hydrophilic part and at least one lipophilic or hydrophobic part. The amphiphilic molecules can be synthetic or naturally occurring. For example, the membrane is a phospholipid monolayer membrane.

[0038] In the above-mentioned kit or device, a rate-limiting protein may also be included. The rate-limiting protein may include one or more combinations of nucleic acid-binding proteins, helicases, exonucleases, telomerases, topoisomerases, transcriptases, transposases, and / or polymerases.

[0039] Optionally, the helicase is selected from the Hel308 family of helicases and modified Hel308 family helicases, RecD helicases and their variants, TrwC helicases and their variants, Dda helicases and their variants, TraI Eco and its variants, XPD Mbu and its variants, Pif1-like helicases and their variants.

[0040] Optionally, the target analyte is one or more of nucleotides, nucleic acids, amino acids, oligopeptides, polypeptides, and proteins.

[0041] Optionally, the one or more features are selected from at least one of (i) the length of the target analyte; (ii) the identity of the target analyte; (iii) the sequence of the target analyte; (iv) the secondary structure of the target analyte; and (v) whether the target analyte is modified. "Identity" refers to the similarity between sequences. Identity can be evaluated by the naked eye or computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.

[0042] Optionally, the nucleic acid can be naturally occurring or artificially synthesized. Specifically, the nucleic acid can be natural DNA, RNA, or modified DNA or RNA, or it can also be an artificially synthesized nucleic acid, such as peptide nucleic acid (PNA), glycerol nucleic acid (GNA), threose nucleic acid (TNA), locked nucleic acid (LNA), or other synthetic polymers with nucleoside side chains.

[0043] Optionally, the nucleic acid is single-stranded, double-stranded, or at least part of it is double-stranded.

[0044] Optionally, the nucleic acid can be of any length. For example, the length of the nucleic acid can be at least 10, at least 50, at least 100, at least 150, at least 200, at least 250, at least 300, at least 400 or at least 500 nucleotides or nucleotide pairs, and can also be 1000 or more nucleotides or nucleotide pairs, 5000 or more nucleotides or nucleotide pairs or 100000 or more nucleotides or nucleotide pairs.

[0045] Optionally, one or more nucleotides in the nucleic acid can be modified, such as methylated, oxidized, damaged, abasic, protein-labeled, tagged or having a spacer sequence interposed in the middle of the polynucleotide sequence.

[0046] The above-mentioned mutant PHT nanopore protein monomer, construct or mutant PHT nanopore protein can be artificially synthesized, or its coding gene can be synthesized first and then obtained by biological expression.

[0047] The present invention also provides a method for preparing a mutant PHT nanopore protein, which includes transforming a host cell with the above-mentioned recombinant vector and inducing the host cell to express the mutant PHT nanopore protein.

[0048] When the term "comprising" or "including" in the present invention is used to describe the sequence of a protein or nucleic acid, the protein or nucleic acid can be composed of the sequence, or can have additional amino acids or nucleotides at one or both ends of the protein or nucleic acid, but still has the activity described in the present invention.

[0049] In this article, the standard one-letter code for amino acids is used. These are as follows: alanine (A), arginine (R), asparagine (N), aspartic acid (D), cysteine (C), glutamic acid (E), glutamine (Q), glycine (G), histidine (H), isoleucine (I), leucine (L), lysine (K), methionine (M), phenylalanine (F), proline (P), serine (S), threonine (T), tryptophan (W), tyrosine (Y) and valine (V). The standard substitution notation is also used, that is, N181D means that N at position 181 of the sequence is replaced by D.

[0050] The present invention discovers that four amino acid sites (N181 / R185 / R219 / Q233) on the transmembrane β-sheet of PHT nanopore protein greatly affect the capture and resolution ability of DNA substrates. Compared with the wild-type PHT nanopore protein, the present invention combines a large number of verification results and finds that the mutation of N181 will improve the stability of the constriction region, reduce the pore current noise, so as to improve the substrate resolution ability; while mutations such as R185 / R219 / Q233 can change the charged property, reduce the binding of negatively charged DNA substrates to the nanopore barrel wall, thereby improving the passing efficiency of DNA substrates and reducing the retention of DNA after passing through the pore; the F87 mutation can increase the pore diameter of the constriction region and improve the throughput of DNA substrates. Combining the foregoing mutations can improve the substrate capture and passing ability of PHT nanopore protein, thereby improving the detection rate of DNA substrates. Description of the Drawings

[0051] Figure 1 It is the SDS-PAGE detection purity result of the mutant PHT nanopore protein (PHT-M4 and PHT-M4-F87L) in Example 2. The "+" is the protein sample heated at 100°C for 10 minutes; the "-" is the protein sample not heated and placed at room temperature for 10 minutes.

[0052] Figure 2 It is the plot of the empty pore current properties of the mutant PHT nanopore proteins (PHT-F87L, PHT-M4 and PHT-M4-F87L).

[0053] Figure 3 It is the DNA substrate detection result of the mutant PHT nanopore proteins (PHT-M4 and PHT-M4-F87L).

[0054] Figure 4 It is the comparison of the DNA substrate capture ability of the mutant PHT nanopore proteins (PHT-M4 and PHT-M4-F87L).

[0055] Figure 5 It is a partial view of the overall structures of the wild-type PHT nanopore protein and the mutant PHT nanopore protein PHT-M4-F87L. Detailed Embodiments

[0056] The present invention will be further described in detail below in combination with the detailed embodiments. The provided embodiments are only for clarifying the present invention, rather than limiting the scope of the present invention. The following provided embodiments can be used as a guide for those of ordinary skill in the art to make further improvements, and do not limit the present invention in any way.

[0057] In the experimental methods of the following examples, unless otherwise specified, they are all conventional methods, and are carried out according to the techniques or conditions described in the literature in this field or according to the product instructions. The materials, reagents, etc. used in the following examples can be obtained from commercial channels unless otherwise specified.

[0058] Example 1 Construction of PHT nanopore protein expression vector

[0059] 1. Construction of wild-type PHT nanopore protein vector

[0060] The wild-type PHT nanopore protein is derived from Nitratireductor pacificus pht-3B (ACCESSION: WP_008595533, SEQ ID No: 2). The protein expression gene is obtained by artificial synthesis, and codon optimization suitable for E. coli expression is carried out during the synthesis process. The synthesized gene is constructed into the pET-28a vector by seamless cloning to obtain the wild-type PHT nanopore protein vector, and a 6×his is added to the C-terminus of the protein as an affinity purification tag. The wild-type PHT nanopore protein vector contains the wild-type PHT nanopore protein expression gene (the sequence is shown in SEQ ID No: 1), and expresses the wild-type PHT nanopore protein with the expression sequence shown in SEQ ID No: 2.

[0061] The steps for vector construction are as follows:

[0062] Using the wild-type PHT nanopore protein expression gene as a template, the target gene fragment (i.e., the target fragment) is amplified by PCR using forward and reverse primers (primer F: GGGCTAACAGGAGGAATTAACCATGTCATCACGCTCACATCA; primer R: TCAATGATGATGATGATGATGCTGCTGAACAGGGTTAGGTTC). After gel recovery, it is ligated to the linearized pET-28a vector, and then transferred into DH5α competent cells for screening of positive clones. Two clones are picked for sequencing, and after correct sequencing, the constructed plasmid is stored at -20°C for later use.

[0063] The PCR system is as follows (20 μL):

[0064]

[0065] The PCR program is as follows:

[0066]

[0067] The seamless ligation system (10 μL) is as follows:

[0068] 2× seamless ligation buffer 5 μL

[0069] 3 μL of the target fragment (50 ng / μL)

[0070] 2 μL of the linearized vector (10 ng / μL)

[0071] After reacting at 50 °C for 15 min, take 2 μL and transfer it into DH5α cells, pick colonies for sequencing.

[0072] 2. Preparation of the vector for the mutant PHT nanopore protein PHT-F87L

[0073] Using the wild-type PHT nanopore protein vector as a template, prepare the pET-28a PHT-F87L vector by PCR. Add 6×his to the C-terminus of the protein as an affinity purification tag. The pET-28a PHT-F87L vector contains the coding gene for the mutant PHT nanopore protein PHT-F87L, which expresses the mutant PHT nanopore protein PHT-F87L. The difference between PHT-F87L and the wild-type PHT nanopore protein is only that the phenylalanine at position 87 is replaced by leucine (F87L).

[0074] The steps for vector construction are as follows:

[0075] Using the wild-type PHT nanopore protein vector gene as a template, use the forward and reverse primers for the fragment (F87L-f GATAACTTTGCTCAGttaTCCAAAGCGGTCTCACAGG; F87-r CTGAGCAAAGTTATCTTCAGGT) and the forward and reverse primers for the vector (primer F: TTGCTATTGATGAAATTCTTgaaGCTGAAGCTGGCTTTACACG; primer R: ctgATATTCAGCatcGCCGCCAATGCCAAGAT) to perform PCR amplification of the target fragment and the PCR vector respectively. After gel extraction, ligate the target fragment and the PCR vector, and then transfer them into DH5α competent cells for screening of positive clones. Pick 2 clones for sequencing, and after correct sequencing, store the constructed plasmid at -20 °C for later use.

[0076] The PCR system and PCR program are the same as those in "1. Construction of the wild-type PHT nanopore protein vector". The seamless ligation system is the same as that in "1. Construction of the wild-type PHT nanopore protein vector", except that the linearized vector is replaced by the PCR vector.

[0077] 3. Preparation of the vector for the mutant PHT nanopore protein PHT-M4 (N181D / R185Q / R219Q / Q233E)

[0078] Using the wild-type PHT nanopore protein vector as a template, the pET-28a PHT-M4 vector was prepared by PCR. A 6×his tag was added to the C-terminus of the protein as an affinity purification tag. The pET-28a PHT-M4 vector contains the coding gene of the mutant PHT nanopore protein PHT-M4 (the sequence is shown in SEQ ID No:3), and it expresses the mutant PHT nanopore protein PHT-M4 (the sequence is shown in SEQ ID No:4). The differences between PHT-M4 and the wild-type PHT nanopore protein are that asparagine at position 181 is replaced by aspartic acid (N181D), arginine at position 185 is replaced by glutamine (R185Q), arginine at position 219 is replaced by glutamine (R219Q), and glutamine at position 233 is replaced by glutamic acid (Q233E).

[0079] The steps for vector construction are as follows:

[0080] Using the wild-type PHT nanopore protein vector gene as a template, the forward and reverse primers for the fragment (primer F: gatGCTGAATATcagCGCGATGTTATTACAGTT; primer R: ATTTCATCAATAGCAATGAACTTGAAGACTGAGCCctgAAGAAGAACTGAATATACAGTC) and the forward and reverse primers for the vector (primer F: TTGCTATTGATGAAATTCTTgaaGCTGAAGCTGGCTTTACACG; primer R: ctgATATTCAGCatcGCCGCCAATGCCAAGAT) were used to perform PCR amplification of the target fragment and the PCR vector respectively. After gel extraction, the target fragment was ligated with the PCR vector, and then transferred into DH5α competent cells for screening of positive clones. Two clones were picked for sequencing. After correct sequencing, the constructed plasmid was stored at -20°C for later use.

[0081] The PCR system and PCR program are the same as those in "1. Construction of the wild-type PHT nanopore protein vector". The seamless ligation system is the same as that in "1. Construction of the wild-type PHT nanopore protein vector", except that the linearized vector is replaced by the PCR vector.

[0082] 4. Preparation of the mutant PHT nanopore protein PHT-M4-F87L vector

[0083] Using the pET-28a PHT-M4 vector as a template, these two primers (primer F:

[0084] CTCAGcttTCCAAAGCGGTCTCACAG; primer R:

[0085] Using circular PCR to construct the single-point mutant vector pET-28a PHT-M4-F87L vector. After the PCR product was digested with DpnI, 2 μL was transferred into DH5α cells, and colonies were picked for sequencing. After correct sequencing, the constructed plasmid was stored at -20 °C for later use. The pET-28a PHT-M4-F87L vector contains the coding gene of the mutant PHT nanopore protein PHT-M4-F87L (the sequence is shown in SEQ ID No: 5), and it expresses the mutant PHT nanopore protein PHT-M4-F87L (the sequence is shown in SEQ ID No: 6). The differences between PHT-M4-F87L and the wild-type PHT nanopore protein are F87L, N181D, R185Q, R219Q, and Q233E.

[0086] The PCR system and PCR program are the same as those in "1. Construction of the wild-type PHT nanopore protein vector".

[0087] Example 2 Preparation of mutant PHT nanopore protein

[0088] The PHT-F87L, PHT-M4, and PHT-M4-F87L nanopore proteins were prepared by the same expression and purification method. The prepared mutant PHT nanopore protein PHT-F87L was detected by SDS-PAGE. When not heated, it contained oligomeric proteins (i.e., the pore-forming state, with a molecular weight greater than the largest band of the marker, 180 kDa), and monomer-sized bands were produced after heating (the molecular weight was approximately 28 kDa). After the mutant PHT nanopore proteins (PHT-M4, PHT-M4-F87L) were purified by Ni column affinity chromatography and molecular sieve, the protein purity was relatively high ( Figure 1 ), and as seen on SDS-PAGE, monomeric proteins were produced after heating (the molecular weight was approximately 28 kDa); when not heated, the proteins were in an oligomeric state (i.e., the pore-forming state, with a molecular weight greater than the largest band of the marker, 180 kDa).

[0089] The expression and purification steps are as follows:

[0090] 1) After the mutant PHT nanopore protein vector (i.e., the pET-28a PHT-F87L vector, pET-28a PHT-M4 vector, or pET-28a PHT-M4-F87L vector prepared in Example 1) was correctly sequenced, it was transferred into BL21(DE3) for expression. After obtaining 1 mL of the seed solution at 37 °C and 200 rpm, it was transferred into 1 L of LB medium and cultured at 37 °C and 200 rpm until the OD600 reached 1.2, and then the temperature was lowered to 26 °C and induced overnight with 0.2 mM IPTG (isopropyl β-D-thiogalactopyranoside);

[0091] 2) Collect the bacterial cells at 4000 rpm, resuspend them with lysis buffer (20 mL / L of bacteria), centrifuge at 18000 rpm for 1 hour at 4°C after high-pressure disruption, and collect the precipitated membrane fraction;

[0092] 3) Resuspend the membrane fraction with membrane solubilization buffer (10 mL / L of bacteria), extract the membrane proteins by magnetic stirring at 4°C for 1 hour, centrifuge at 18000 rpm for 1 hour at 4°C, and collect the supernatant membrane protein fraction;

[0093] 4) Add imidazole with a final concentration of 30 mM to the supernatant and incubate it with Ni beads equilibrated with membrane solubilization buffer, perform affinity purification after binding at 4°C for 1 hour;

[0094] 5) Transfer the supernatant and Ni beads into a column and let it flow through by gravity naturally; wash with 10 mL of washing buffer and elute the protein with 5 mL of elution buffer;

[0095] 6) Purify the target protein by size exclusion chromatography and detect its purity by SDS-PAGE. The protein purity results are as Figure 1 shown.

[0096] Lysis buffer: 20 mM Tris-HCl, 150 mM NaCl, pH 8.0.

[0097] Membrane solubilization buffer: 20 mM Tris-HCl, 150 mM NaCl, pH 8.0, 1% LDAO (dodecyldimethylamine oxide).

[0098] Washing buffer: 20 mM Tris-HCl, 150 mM NaCl, pH 8.0, 0.5% LDAO, 50 mM imidazole.

[0099] Elution buffer: 20 mM Tris-HCl, 150 mM NaCl, pH 8.0, 0.1% LDAO, 200 mM imidazole.

[0100] Size exclusion chromatography buffer: 20 mM Tris-HCl, 150 mM NaCl, pH 8.0, 0.06% LDAO.

[0101] Example 3 Identification of the DNA Detection Ability of Mutant PHT Nanopore Protein

[0102] After obtaining the mutant PHT nanopore proteins (PHT-F87L, PHT-M4, PHT-M4-F87L) in Example 2, the properties of the empty pore current and the DNA detection ability of these pore proteins were identified. Artificial phospholipid monolayers (DPhPC, dipalmitoylphosphatidylcholine) were formed, and then individual nanopore proteins were embedded. Subsequently, the current changes were recorded at a voltage of 150 mV.

[0103] 1. The steps for identifying the properties of the embedded nanopores and empty pores are as follows:

[0104] In a buffer solution (600 mM KCl, 75 mM K3[Fe(CN)6, 25 mM K4[Fe(CN)6]·3H2O, 100 mM Hepes, pH 8.0), electrical signal measurement values are obtained from the nanopores embedded in the DPhPC phospholipid bilayer. After inserting the single mutant PHT nanopore protein into the phospholipid bilayer, 2 mL of the buffer solution (600 mM KCl, 75 mM K3[Fe(CN)6, 25 mM K4[Fe(CN)6]·3H2O, 100 mM Hepes, pH 8.0) is passed through the system to remove the residual excess nanopore protein to obtain a single nanopore experimental system. The current signals of the mutant PHT nanopore protein on the phospholipid membrane are recorded separately.

[0105] The recorded results are as Figure 2 shown. Compared with PHT-F87L ( Figure 2-1 ), the individual pore current properties of PHT-M4 and PHT-M4-F87L are improved, the pore current properties are more stable, and the noise level is lower. However, PHT-M4 has frequent spontaneous blockage situations ( Figure 2-2 ), while PHT-M4-F87L has better effects, with stable pore current properties, low noise, and fewer spontaneous blockage situations ( Figure 2-3 ).

[0106] 2. The process for preparing the DNA substrate to be tested and identifying the DNA detection ability is as follows:

[0107] After the single nanopore experimental system is constructed, the pre-incubated DNA substrate to be tested crosslinked with the speed control protein, ATP (final concentration 2 mM), and MgCl2 (final concentration 10 mM) are flowed into the single nanopore experimental system (total volume 100 μL) together, and the signal is measured at a constant voltage of +150 mV.

[0108] The DNA sample to be tested is assembled into a pre-incubated DNA substrate to be tested and crosslinked according to the method recorded in the patent (WO2014135838A1) by assembling the T4Dda-E94C / C109A / C136A / A360C mutant protein (helicase, speed control protein, this mutant protein is recorded in US20170283470A1). The length of the DNA sample to be tested is 500 bp (recorded in Nature Biotechnology, Vol38, December 2020, P1415–1420; WO 2019002893 A1; the sequence is as shown in SEQ ID No: 7), containing 5 repeated sequences, each containing 10 Ts (the complementary strand is 10 As).

[0109] The detection results of DNA substrates are as follows Figure 3 shown. The substrate pore-passing property of PHT-F87L is poor, mainly manifested in the low frequency of substrate pore-passing, and almost no DNA pore-passing signal can be recorded. Even if a signal can be recorded, it is also poor and cannot be distinguished. While for PHT-M4 ( Figure 3-1 and Figure 3-2 ) and PHT-M4-F87L ( Figure 3-3 and Figure 3-4 ), after adding the DNA sample to be tested, DNA substrate pore-passing signals with higher frequencies can be observed in the pore current. By comparing the current signals of the same DNA sample of PHT-M4 and PHT-M4-F87L, it can be found that PHT-M4-F87L has better DNA resolution ability and can see the characteristic signals of repetitive sequences ( Figure 3-3 and Figure 3-4 the framed parts).

[0110] The pore-passing efficiency (i.e., capture rate) is calculated according to the number of complete pore-passing of 500bp DNA substrate within a unit time (such as 100 seconds).

[0111] The results are as follows Figure 4 shown. The pore-passing efficiencies of PHT-F87L and PHT-M4 are both relatively low. For a 500bp sample, about 5 are captured in 100 seconds (0.05 per second); the pore-passing efficiency of PHT-M4-F87L is relatively high, and about 28 are captured in 100 seconds (0.28 per second). Therefore, the substrate capture ability of PHT-M4-F87L has been greatly improved.

[0112] Therefore, the mutant-modified PHT-M4 has improved the substrate resolution ability compared with the single PHT-F87L. Introducing the F87L mutation on the basis of PHT-M4 will improve the DNA substrate capture efficiency, and the DNA resolution ability has been further improved. In summary, PHT-M4-F87L is more suitable for the sequencing and / or detection of samples such as DNA.

[0113] In some embodiments, wild-type PHT nanopore protein, mutant PHT nanopore proteins N181D, N181E, R185Q, R185N, R219Q, R219N, Q233E, and Q233D are prepared by the methods described in Examples 1 and 2. The properties of the empty pore current and the DNA detection ability of the aforementioned proteins are identified by the method described in Example 3. The results show that, compared with the wild-type PHT nanopore protein, the DNA detection ability of the mutant PHT nanopore proteins is improved, specifically, the capture ability and / or resolution ability of the DNA substrate is enhanced. Therefore, four amino acid sites (N181 / R185 / R219 / Q233) on the transmembrane β-sheet of PHT nanopore greatly affect the capture and resolution ability of the DNA substrate.

[0114] In some embodiments, wild-type PHT nanopore protein, mutant PHT nanopore proteins F87M, F87P, F87L, F87G, F87I, F87Q, F87E, F87C, F87R, F87H, F87K, F87T, F87A, F87S, F87Y, F87N, F87V, and F87D are prepared by the methods described in Examples 1 and 2. The properties of the empty pore current of the aforementioned proteins are identified by the method described in Example 3. The results show that, compared with the wild-type PHT nanopore protein, both the current signal noise and the spontaneous blockage phenomenon of the mutant PHT nanopore proteins are significantly reduced, and the current properties and current signals are significantly improved. Among them, the mutant proteins F87I, F87V, F87T, F87L, and F87N have better effects, with stable current properties, few spontaneous blockages, a narrower current signal width (upper and lower amplitude), and fewer spikes, and can be used for sequencing and / or detection of samples such as DNA.

[0115] In some embodiments, wild-type PHT nanopore protein is prepared by the methods described in Examples 1 and 2. High-resolution electron microscopy density maps of wild-type PHT nanopore protein and mutant PHT-F87L nanopore protein are obtained using cryo-electron microscopy technology. Subsequently, through data processing, structure analysis, homology modeling, structure building, and refinement, the atomic coordinates of their amino acids are obtained. Figure 5 is a partial view of the overall structure of wild-type PHT nanopore protein and mutant PHT-F87L nanopore protein. The constriction region is determined by the 87th amino acid. Compared with the wild-type PHT nanopore protein (the width of the constriction region is ), in the mutant PHT-F87L nanopore protein (the width of the constriction region is ), the F87L mutation in the mutant PHT-F87L nanopore protein increases the pore diameter of the constriction region by approximately and improves the passage efficiency of the DNA substrate.

[0116] The above has described the present invention in detail. For those skilled in the art, without departing from the gist and scope of the present invention and without the need for unnecessary experiments, the present invention can be implemented within a relatively wide range under equivalent parameters, concentrations, and conditions. Although specific embodiments of the present invention are given, it should be understood that the present invention can be further improved. In short, in accordance with the principle of the present invention, this application intends to cover any modifications, uses, or improvements to the present invention, including those that depart from the scope disclosed in this application but are made by using conventional techniques known in the art. Some basic features can be applied within the scope of the following appended claims.

Claims

1. A mutant PHT nanopore protein monomer, characterized in that, The mutant PHT nanopore protein monomer includes a mutant with a sequence as shown in SEQ ID NO:2, and the mutant includes mutations at at least one of positions 181, 185, 219, and 233 of SEQ ID NO:

2.

2. The mutant PHT nanopore protein monomer according to claim 1, wherein The mutant further includes a mutation at position 87 of SEQ ID NO:2; Preferably, the mutation is an amino acid substitution; Preferably, the mutation at position 87 is that phenylalanine at position 87 is substituted with leucine, threonine, asparagine, isoleucine, or valine, the mutation at position 181 is that asparagine at position 181 is substituted with aspartic acid or glutamic acid, the mutation at position 185 is that arginine at position 185 is substituted with glutamine or asparagine, the mutation at position 219 is that arginine at position 219 is substituted with glutamine or asparagine, and the mutation at position 233 is that glutamine at position 233 is substituted with glutamic acid or aspartic acid.

3. A construct, characterized in that, The construct contains at least two linked PHT nanopore protein monomers, and at least one of the PHT nanopore protein monomers is the mutant PHT nanopore protein monomer described in claim 1 or 2.

4. A mutant PHT nanopore protein, characterized in that the mutant PHT nanopore protein contains at least two linked PHT nanopore protein monomers, and at least one of the PHT nanopore protein monomers is the mutant PHT nanopore protein monomer described in claim 1 or 2; or the mutant PHT nanopore protein contains the construct described in claim 3.

5. The construct according to claim 3 or the mutant PHT nanopore protein according to claim 4, characterized in that the PHT nanopore protein monomers are the same or different; the linkage is a covalent or non-covalent linkage.

6. The mutant PHT nanopore protein monomer according to claim 1 or 2, the construct according to claim 3 or 5, or the biological material related to the mutant PHT nanopore protein according to claim 4 or 5, characterized in that The related biological material is any one of the following: a1) A nucleic acid molecule encoding the mutant PHT nanopore protein monomer described in claim 1 or 2, the construct described in claim 3 or 5, or the mutant PHT nanopore protein described in claim 4 or 5; a2) An expression cassette containing the nucleic acid molecule described in a1); a3) A recombinant vector containing the nucleic acid molecule described in a1), or a recombinant vector containing the expression cassette described in a2); a4) A recombinant cell containing the nucleic acid molecule described in a1), or a recombinant cell containing the expression cassette described in a2), or a recombinant cell containing the recombinant vector described in a3).

7. Use of the mutant PHT nanopore protein monomer described in claim 1 or 2, the construct described in claim 3 or 5, the mutant PHT nanopore protein described in claim 4 or 5, or the related biological material described in claim 6 in detecting the presence, absence, or one or more characteristics of a target analyte or in preparing a product for detecting the presence, absence, or one or more characteristics of a target analyte; Preferably, the target analyte is one or more of nucleotides, nucleic acids, amino acids, oligopeptides, polypeptides, and proteins.

8. A method for determining the presence, absence, or one or more characteristics of a target analyte, characterized in that, The method includes: A. The target analyte contacts the mutant PHT nanopore protein as claimed in claim 4 or 5, such that the target analyte moves relative to the mutant PHT nanopore protein; B. One or more measurements are obtained while the target analyte moves relative to the mutant PHT nanopore protein, thereby determining the presence, absence, or one or more characteristics of the target analyte; Preferably, the target analyte is one or more of nucleotides, nucleic acids, amino acids, oligopeptides, polypeptides, and proteins.

9. A kit or device for determining the presence, absence, or one or more characteristics of a target analyte, characterized in that, The kit includes the mutant PHT nanopore protein monomer as claimed in claim 1 or 2, the construct as claimed in claim 3 or 5, the mutant PHT nanopore protein as claimed in claim 4 or 5, or the related biological material as claimed in claim 6, and a membrane; The device includes the mutant PHT nanopore protein as claimed in claim 4 or 5, and a membrane; Preferably, the target analyte is one or more of nucleotides, nucleic acids, amino acids, oligopeptides, polypeptides, and proteins.

10. A method for preparing the mutant PHT nanopore protein according to claim 4 or 5, characterized in that, Comprising transforming a host cell with the recombinant vector as described in claim 6 and inducing the host cell to express the mutant PHT nanopore protein.

Images