Novel PD-L1 enhancer configuration for regulating transcription of 114 target genes and experimental method

Abstract

The invention relates to the technical field of gene engineering, and discloses a novel PD-L1 enhancer configuration for regulating transcription of 114 target genes and an experimental method, which are used for determining nine regular enhancer complex configurations and six possible irregular configurations. The invention creatively and basically solves the problem of a PD-L1 combined DNA model, 114 target genes are screened out through PD-L1-seqence detection, it is found that the PD-L1 enhancer cannot enhance transcription of GAS6 and EGR1 in SW620, and possible configurations of nine PD-L1 enhancers conforming to existing experimental data are determined.

Description

Technical Field

[0001] The present invention relates to the field of genetic engineering technology, and specifically to a new PD-L1 enhancer configuration for regulating the transcription of 114 target genes and an experimental method. Background Art

[0002] Programmed Death Ligand 1 (PD-L1, also known as B7-H1 or CD274), located on human chromosome 9p24.1, is a ligand of Programmed Death Protein 1 (PD-1) and negatively regulates cellular immune responses. In addition to the usual cell membrane expression of PD-L1, through endocytosis of the cell membrane and cytoplasmic-nuclear transport, PD-L1 is also expressed in the nucleus. PD-L1 in the nucleus is mainly enriched near the transcription start site of target genes, presumably regulating the transcription of target genes. However, whether PD-L1 directly binds to DNA or indirectly binds to DNA through transcription factors is still unknown worldwide except for the revelation of our latest research results. Knockout of PD-L1 and wild-type sequencing showed that PD-L1 regulates the gene transcription of antigen-presenting molecules, immune checkpoint molecules, and inflammatory molecules, determining the effectiveness of tumor immunotherapy and chemoradiotherapy [1]. The latest report shows that PD-L1 binds to the transcription factor SP1 and indirectly binds to the GAS6 promoter [2], and binds to the transcription factor STAT3 and indirectly binds to the EGR1 promoter [3], promoting the transcription of the two genes. The former promotes tumor progression by activating the MerTK pathway, and the latter promotes angiogenesis. This is the major technical background, and it is basically impossible to accurately understand the mode of PD-L1 binding to DNA from this, let alone to test the effect of PD-L1 regulating target genes. In short, it is in a state of knowledge germination and cannot be applied.

[0003] We extensively read all the scientific literature on the mechanism of action of PD-L1, especially the direct binding molecules. Through years of cumulative efforts and step-by-step exploration, we finally clarified the key points. There is an SP1 binding site on the EGR1 promoter, but no STAT3 binding site. Moreover, since STAT3 and SP1 are transcription factors of PD-L1, when PD-L1 is overexpressed, the expression of SP1 and STAT3 is upregulated. If directly binding to PD-L1 to promote or inhibit transcription, it will form a positive or negative feedback loop of PD-L1 expression, which contradicts the obvious increase of PD-L1 to a certain extent during the carcinogenesis process. Therefore, we correctly analyzed the characteristics of the existing scientific data and speculated that PD-L1-mediated-SP1 is the correct way for PD-L1 to bind to DNA. Tumor stemness is mediated by PD-L1-HMGA1 in colon cancer and PD-L1-SMAD3 in hepatocellular carcinoma [4, 5, 6], and HMGA1-SP1 and SMAD3-SP1 are relatively common ways to bind to DNA. Therefore, we further speculated that the mediators might be the two molecules HMGA1 and SMAD3. It is reported that SMAD3 and STAT3 mediate tumor stemness simultaneously and form a SMAD3-P300-STAT3 complex to bind to DNA. In summary, SMAD3 binding to P300-STAT3 in the PD-L1-HMGA1 / SMAD3-SP1 complex is the best model obtained through our correct scientific thinking, integrating all the existing data and binding properties. This is the small technical background. Our critical analysis gradually and orderly narrows down the scope. The best model covers all the existing data and can be scientifically verified. In short, it is in a state of being verifiable and applicable after knowledge creation, which is vastly different from the budding of knowledge.

[0004] As mentioned above, the prior art is first limited to only two genes, GAS6 and EGR1. PD-L1 binds to the GAS6 promoter with SP1, and PD-L1 binds to the EGR1 promoter with STAT3, only reaching the level of the large technical background. Although it is reported that 1144 target genes can be detected using the Cut&Tag technology of PD-L1 [3], and we can detect 114 target genes using the PD-L1-sequence technology, we cannot infer the general pattern of binding to the promoters of target genes from PD-L1-SP1 or PD-L1-STAT3. Therefore, under the premise of the existing technology and theoretical gaps, we can only verify whether there is PD-L1-SP1 or PD-L1-STAT3 binding to the target genes, and verify the effects of overexpression and knockout of PD-L1-SP1 or PD-L1-STAT3 on the transcription of target genes. For the understanding and application of the general pattern of PD-L1 regulating target genes, there will be a very long detour to take and a great deal of resource waste before we may approach a sufficient understanding and application of the PD-L1 gene regulation mechanism. Summary of the Invention

[0005] (1) Technical problem to be solved

[0006] In view of the deficiencies of the prior art, the present invention provides a new PD-L1 enhancer configuration for regulating the transcription of 114 target genes and an experimental method.

[0007] (2) Technical solution

[0008] A new PD-L1 enhancer configuration for regulating the transcription of 114 target genes, including the following configurations:

[0009]

[0010] Preferably, PD-L1 does not directly bind to SP1 and STAT3 and then bind to DNA.

[0011] Preferably, HMGA1, SMAD3 and P300 act as mediator molecules to mediate the basic configuration of PD-L1 binding to the complex and SP1 and STAT3 binding to DNA.

[0012] Preferably, HMGA1 and SMAD3 are mediators between PD-L1 and SP1, P300 is a mediator between SMAD3 and STAT3, and HMGA1 binds to P300 and pulls down SMAD3.

[0013] Preferably, it includes the following steps:

[0014] S1. 114 PD-L1-enriched target genes are obtained by chromatin immunoprecipitation sequencing (Chip-sequence) of PD-L1;

[0015] S2. The gene sequences enriched with PD-L1, HMGA1, SMAD3, SP1, and STAT3 in MG63 cells and SW620 cells are enriched by ChIP experiments, and qPCR verification and analysis are carried out;

[0016] S3. Proteins are extracted from animal tissues, cells, and plant tissues. The total protein concentration is measured by the BCA method. WB detection is carried out before and after the immunoprecipitation (CoIP) experiment, and qPCR verification and analysis are carried out;

[0017] S4. MG63 and SW620 cells were transfected with PD-L1, PD-L1+HMGA1+SP1, PD-L1+SMAD3+SP1, and P300+STAT3+SP1 plasmids in sequence. After PCR detection under normoxic conditions, SW620 cells were transfected with control small interfering RNA (siRNA) and siRNA targeting SP1, PD-L1+SP1, HMGA1, and HMGA1+SMAD3 in sequence, cultured under normoxic conditions, and detected by real-time fluorescence quantitative PCR (qRT-PCR) to obtain primer sequences.

[0018] (III) Beneficial technical effects

[0019] First, the present invention creatively and fundamentally solves the problem of the model of PD-L1 binding to DNA. Based on the budding of knowledge, through theoretical creation and experimental verification, a unified and universal model of PD-L1 binding to DNA is confirmed.

[0020] Second, the present invention screened out 114 target genes through PD-L1-seqence detection, especially including PD-L1 itself, and found for the first time that its own positive feedback significantly upregulated its expression, which would profoundly affect its immune function and gene regulation.

[0021] Third, the present invention found that the PD-L1 enhancer cannot enhance the transcription of GAS6 and EGR1 in SW620, which means that there is a valuable antagonistic mechanism or negative regulatory mechanism. At the same time, this mechanism does not exist on the PD-L1 gene. The specific reason remains to be clarified in the future.

[0022] Fourth, the present invention identifies nine possible configurations of PD-L1 enhancers that are consistent with existing experimental data, indicating that further investment is needed to determine one or more configurations that are actually effective, and the specifics remain to be clarified in the future. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 This is a schematic diagram of the chromatin immunoprecipitation (ChIP) experiment.

[0024] Figure 2 This is a chromatin fragmentation detection diagram.

[0025] Figure 3 This is a graph showing protein and promoter enrichment detected by qPCR.

[0026] Figure 4 This is the HMGA1 antibody detection chart.

[0027] Figure 5 This is the SMAD3 antibody detection chart.

[0028] Figure 6It is a detection graph of GAPDH antibody (36kd).

[0029] Figure 7 It is a detection graph of PD-L1 antibody (40 - 60kd).

[0030] Figure 8 It is a detection graph of SP1 antibody (81kd).

[0031] Fig. 9 It is a detection graph of SMAD3 antibody.

[0032] Fig.10 It is a detection graph of SMAD3 qPCR.

[0033] Fig.11 It is a detection graph of PD-L1 qPCR.

[0034] Fig.12 It is a detection graph of SP1 qPCR.

[0035] Fig.13 It is a detection graph of HMGA1 qPCR.

[0036] Fig.14 It is a detection graph of HMGA1 antibody (17kd), coip-WB experiment of HMGA1 and SMAD3 proteins in MG63 cells.

[0037] Fig.15 It is a detection graph of SP1 antibody (90kd), coip-WB experiment of HMGA1 and SMAD3 proteins in MG63 cells.

[0038] Fig.16 It is a detection graph of PD-L1 antibody (40 - 50kd), coip-WB experiment of HMGA1 and SMAD3 proteins in MG63 cells.

[0039] Fig.17 It is a detection graph of SMAD3 antibody (52kd), coip-WB experiment of HMGA1 and SMAD3 proteins in MG63 cells.

[0040] Fig.18 It is a detection graph of GAPDH antibody (36kd), coip-WB experiment of HMGA1 and SMAD3 proteins in MG63 cells.

[0041] Fig.19 It is the WB detection graph after IP of the first group of HMGA1 antibody (17kd), coip-WB experiment of HMGA1 and SMAD3 proteins in MG63 cells.

[0042] Fig. 20WB detection map after the first IP of SP1 antibody (90kd), coip-WB experiment of HMGA1 and SMAD3 proteins in MG63 cells.

[0043] Fig.21 WB detection map after the first IP of PD-L1 antibody (40-50kd), coip-WB experiment of HMGA1 and SMAD3 proteins in MG63 cells.

[0044] Fig. 22 WB detection map after the second IP of SMAD3 antibody (52kd), coip-WB experiment of HMGA1 and SMAD3 proteins in MG63 cells.

[0045] Fig.23 WB detection map after the second IP of SP1 antibody (90kd), coip-WB experiment of HMGA1 and SMAD3 proteins in MG63 cells.

[0046] Fig.24 WB detection map after the second IP of PD-L1 antibody (40-50kd), coip-WB experiment of HMGA1 and SMAD3 proteins in MG63 cells.

[0047] Fig.25 WB detection map before IP of HMHA1 antibody (17kd), coip-WB experiment of HMGA1 and SMAD3 proteins in sw620 cells.

[0048] Fig.26 WB detection map before IP of SP1 antibody (81kd), coip-WB experiment of HMGA1 and SMAD3 proteins in sw620 cells.

[0049] Fig. 27 WB detection map before IP of PD-L1 antibody (40-60kd), coip-WB experiment of HMGA1 and SMAD3 proteins in sw620 cells.

[0050] Fig.28 WB detection map before IP of SMAD3 antibody (55kd), coip-WB experiment of HMGA1 and SMAD3 proteins in sw620 cells.

[0051] Fig.29 WB detection map before IP of GADPH antibody (36kd), coip-WB experiment of HMGA1 and SMAD3 proteins in sw620 cells.

[0052] Fig.30 Detection map of HMGA1 antibody (17kd), WB after the first IP, bait HMGA1, coip-WB experiment of HMGA1 and SMAD3 proteins in sw620 cells.

[0053] Fig.31 It is a detection graph of SP1 antibody (81kd). After IP in group 1 and then WB, the prey is SP1, and it is a coip-WB experiment of HMGA1 and SMAD3 proteins in sw620 cells.

[0054] Fig.32 It is a detection graph of PD-L1 antibody (40 - 60kd). After IP in group 1 and then WB, the prey is PD-L1, and it is a coip-WB experiment of HMGA1 and SMAD3 proteins in sw620 cells.

[0055] Fig.33 It is a detection graph of SMAD3 antibody (55kd). After IP in group 2 and then WB, the bait is SMAD3, and it is a coip-WB experiment of HMGA1 and SMAD3 proteins in sw620 cells.

[0056] Fig.34 It is a detection graph of SP1 antibody (81kd). After IP in group 2 and then WB, the prey is SP1, and it is a coip-WB experiment of HMGA1 and SMAD3 proteins in sw620 cells.

[0057] Fig.35 It is a detection graph of PD-L1 antibody (40 - 60kd). After IP in group 2 and then WB, the prey is PD-L1, and it is a coip-WB experiment of HMGA1 and SMAD3 proteins in sw620 cells.

[0058] Fig.36 It is a graph of GAS6, EGR1, and PD-L1 mRNA in MG63 cells and SW620 cells after overexpressing the PD-L1 enhancer component.

[0059] Fig.37 It is a graph of PD-L1, GAS6, and EGR1 mRNA in SW620 cells after knocking out the enhancer component under normoxic and hypoxic conditions. Detailed implementation method

[0060] Example 1

[0061] ChIP-seq experimental method for SW620 cell samples:

[0062] 1. Experimental materials and instruments

[0063] Table 1

[0064]

[0065]

[0066] 37% formaldehyde or 16% formaldehyde

[0067] Qubit fluorometer and quantification kit

[0068] DNA Purification and Recovery Kit (Abclonal RK30100)

[0069] SYBR Green qPCR Mix

[0070] Illumina V4 DNA Library Preparation Kit (Vazyme ND610-01)

[0071] 2. Experimental Procedures

[0072] 2.1 Sample Crosslinking

[0073] Preparation: 1×PBS: Take 1 mL of 5×PBS, add 4 mL of ultrapure water, and mix well;

[0074] 1% Formaldehyde PBS Solution: Take 27 μL of 37% formaldehyde solution, add 973 μL of PBS, and mix well.

[0075] 2.1.1 Cell Samples

[0076] 1) Cell Collection: Centrifuge the cultured cells (about 1×10 7 cells) to collect the cell pellet;

[0077] 2) Crosslinking: Add 1 mL of 1% formaldehyde PBS solution, pipette to mix well, and incubate with rotation at room temperature for 10 min;

[0078] 3) Crosslinking Termination: Add 100 μL of Glycine buffer, incubate with rotation at room temperature for 5 min, centrifuge at 1000 g for 5 min at 4°C, and discard the supernatant;

[0079] 4) Washing: Add 1 mL of pre-cooled PBS, pipette to mix the cells well, centrifuge at 1000 g for 5 min at 4°C, discard the supernatant, add 1 mL of pre-cooled PBS again for one wash, wash a total of 2 times, and discard the supernatant.

[0080] 2.2 Sample Lysis

[0081] Preparation: Take 200 μL of Lysis Buffer, add 10 μL of Protease inhibitor (100×), and 5 μL of DTT, and mix well.

[0082] 1) Lysis: Add 200 μL of Lysis Buffer, incubate with rotation at 4°C for 30 min, or let it stand on ice for 30 min for lysis, vortex every 5 min, and then add 1 mL of ChIP Buffer and mix well;

[0083] 2) Ultrasonication: Interrupt by low-temperature ultrasonication (explore the optimal interruption conditions through preliminary experiments according to different types of ultrasonic instruments). After ultrasonication, centrifuge at 10,000 g and 4 °C for 10 min, and take the supernatant.

[0084] 3) Decrosslinking: Take 50 μL of the supernatant, add 100 μL of ultrapure water and 1 μL of RNase A, mix well and incubate at 37 °C for 5 min. Then continue to add 6 μL of 5 M NaCl and 2 μL of proteinase K, and incubate at 65 °C for 3 h or overnight.

[0085] 4) DNA recovery: Operate according to the instructions using a DNA purification and recovery kit, and finally elute with 50 μL of ultrapure water (this sample can also be used as Input).

[0086] 5) Quality inspection: Measure the DNA concentration using a Qubit fluorometer, and detect the DNA fragment size by 1.5% agarose gel electrophoresis (the ChIP-qPCR fragments are concentrated at about 200 - 700 bp, and the ChIP-seq fragments are concentrated at about 300 bp for the best results).

[0087] 2.3 Preparation of magnetic beads

[0088] 1) Take out Protein A / G Magnetic Beads from the 4 °C refrigerator, invert them several times to mix the magnetic beads and the solution evenly. Respectively take 50 μl and transfer them into 3 1.5 mL EP tubes, labeled as IgG, IP, and positive.

[0089] 2) Resuspend the magnetic beads with 0.2 mL of pre-cooled ChIP Buffer, place them on a magnetic stand and let them stand for 1 min to separate the magnetic beads and the solution, and carefully aspirate and discard the supernatant with a pipette.

[0090] 3) Repeat step 2) once, for a total of 2 washes.

[0091] 2.4 Immunoprecipitation

[0092] 1) Take an appropriate amount of the lysed and sonicated sample and dilute it with ChIP Buffer to a final volume of 1.6 mL (dilute histone to 10 - 20 μg / mL, and dilute transcription factor to 20 - 40 μg / mL). Take 10 μL of the diluted sample, add 140 μL of ultrapure water as Input, place it at -20 °C, and de-crosslink and recover it together with the enriched sample.

[0093] 2) Respectively take 490 μL of the diluted sample, labeled as IgG, IP, and positive, and correspondingly add 1 μL of IgG, 2 μL of positive antibody, and 3 - 5 μg of the target antibody, and incubate at 4 °C with rotation for 3 h or overnight.

[0094] 3) Take out the incubated IP, IgG, and positive groups, centrifuge instantaneously for 3 s, and add them to the prepared magnetic bead tubes respectively, then incubate with rotation at 4 °C for 2 h;

[0095] 4) Take out IgG, IP, and positive from the silent mixer, place them on the magnetic stand and let stand for 1 min, then discard the supernatant;

[0096] 5) Resuspend the magnetic beads with 1 mL of wash buffer 1 respectively, place them on the magnetic stand and let stand for 1 min, then discard the supernatant;

[0097] 6) Resuspend the magnetic beads with 1 mL of wash buffer 2 respectively, place them on the magnetic stand and let stand for 1 min, then discard the supernatant;

[0098] 7) Resuspend the magnetic beads with 1 mL of wash buffer 3 respectively, place them on the magnetic stand and let stand for 1 min, then discard the supernatant;

[0099] 8) Resuspend the magnetic beads with 1 mL of wash buffer 4 respectively, place them on the magnetic stand and let stand for 1 min, then discard the supernatant. Repeat this step once, and finally discard the supernatant to harvest the precipitate.

[0100] 2.5 DNA Recovery and Amplification

[0101] Preparation: Take out the Elution Buffer from 4 °C and let it return to room temperature until the liquid is completely dissolved (it can be dissolved by heating at 37 °C);

[0102] 1) Add 150 μL of Elution Buffer to the magnetic bead precipitates of the IP, IgG, and positive groups respectively, vortex and mix well, incubate with rotation at room temperature for 15 min, centrifuge instantaneously for 3 s, place on the magnetic stand and let stand for 1 min, then take the supernatant;

[0103] 2) Add 1 μL of RNase A respectively, mix well and incubate at 37 °C for 5 min. Then continue to add 6 μL of 5 M NaCl and 2 μL of proteinase K, and incubate at 65 °C for 3 h (start the synchronous operation of Input at this step);

[0104] 3) Operate according to the instructions using the DNA purification and recovery kit, and finally elute with 50 μL of ultrapure water.

[0105] 4) Operate according to the instructions using the DNA library construction kit to obtain the Illumina high-throughput sequencing library.

[0106] 2.6 Library Quality Inspection and Sequencing

[0107] 2.6.1 Library Quality Inspection and Quantification

[0108] Take 1 μL of the DNA library and perform a 2100 quality inspection on the library using the Agilent High Sensitivity DNA Kit on an Agilent Bioanalyzer machine. Quantify the library on a Promega QuantiFluor using the Quant-iT PicoGreen dsDNA Assay Kit. The concentration of the qualified library should be above 2 nM after calculation.

[0109] 2.6.2 Sequencing on the machine

[0110] For the library that has passed the quality inspection, we perform paired-end sequencing of 2 × 150 bp using the NovaSeq 6000 S4 Reagent Kit (300 cycles). First, gradient-dilute the library to be sequenced (with non-repeating Index) to 2 nM, and then mix the samples according to the required data volume ratio. The mixed library is denatured into single strands with 0.2 M NaOH for sequencing on the machine. The amount of the library loaded can be controlled at 1.1 - 1.3 pM according to the actual situation.

[0111] 2.7 Data analysis

[0112] After the library passes the quality inspection and the NovaSeq 6000 sequencing is completed, the data analysis process includes sequencing data quality control, alignment with the reference genome, identification of peak sites (call peak), annotation of peak-associated genes, enrichment analysis, differential Peak analysis of multiple samples, and motif enrichment analysis. The data analysis process is as follows:

[0113]

[0114] Example 2

[0115] Use ChIP experiments to enrich the DNA sequences of GAS6, EGR1, BTRC, and PD-L1 that interact with PD-L1, HMGA1, SMAD3, SP1, and STAT3 in MG63 cells and SW620 cells, and perform QPCR verification and analysis.

[0116] 1. Experimental materials and instruments

[0117] 1.1 Experimental instruments

[0118] Table 2

[0119] instrument brand model Desktop high speed centrifuge Xiangyi TGL-20M Digital display single row single control water bath Changzhou Guohua HH-3A Fluorescence quantitative PCR detection system Shanghai Hongshi SLAN-48P Ultra-micro-spectrophotometer Thermo Fisher NanoDrop2000 Multipurpose magnetic stand Shanghai Bioengineering C650035 Silent mixer Chilin Bell WH-986 Ultrasonic cell disruptor Ningbo Xinzhi JY92-IIN

[0120] 1.2 Experimental reagents

[0121] Table 3

[0122]

[0123]

[0124] 1.3 Buffer Formulation

[0125] 10X Glycine Solution: Dissolve 5.15 g of glycine in 50 ml of DEPC water and store at 4°C;

[0126] ChIP Lysis Buffer: 50 mM Tris-HCl pH 7.5, 150 mM NaCl, 1 mM EDTA, 1% SDS (add protease inhibitor before use);

[0127] ChIP Buffer: 50 mM Tris-HCl pH 7.5, 150 mM NaCl, 1 mM EDTA, 1% Triton X-100, 0.1% sodium deoxycholate (add 1 mM PMSF and 1 mM DTT before use);

[0128] High-Salt Wash Buffer: 1% Triton X-100, 1 mM EDTA, 50 mM Tris-HCl pH 7.5, 500 mM NaCl;

[0129] Low-Salt Wash Buffer: 1% Triton X-100, 1 mM EDTA, 50 mM Tris-HCl pH 7.5, 150 mM NaCl;

[0130] TE: 10 mM Tris-HCl (pH 8.0), 1 mM EDTA;

[0131] Elution Buffer: 1% SDS, 100 mM NaHCO3;

[0132] 5M NaCl: Dissolve 29.25 g of sodium chloride in 100 ml of DEPC water and store at 4°C;

[0133] Cross-Linking Buffer: 10 mM Tris-HCl (pH 8.0), 0.4 M sucrose, 1 mM EDTA, add 1% formaldehyde and 1 mM PMSF before use;

[0134] Nuclear Isolation Buffer: 20 mM Tris-HCl (pH 6.8), 0.25 M sucrose, 5 mM MgCl2, 60 mM KCl, 15 mM NaCl, 1 mM CaCl2, 0.8% Triton X-100, add 1 mM PMSF and 1x PIC before use;

[0135] Nuclear lysis buffer: 50 mM Tris-HCl (pH 7.5), 150 mM NaCl, 1 mM EDTA, 0.2% SDS, 0.1% sodium deoxycholate, 1% Triton X-100. Add 1 mM PMSF and 1x PIC before use;

[0136] LiCl washing buffer: 1% Triton X-100, 1 mM EDTA, 20 mM Tris-HCl pH 8.0, 250 mM LiCl.

[0137] 2. Experimental procedures

[0138] 2.1 MG63 and SW620 cells

[0139] 1) Crosslinking (operation in fume hood)

[0140] For adherent cells, when they grow to 80 - 90% confluence, add 250 μl of 37% formaldehyde to a dish containing 9 ml of medium (bright red) to make the final concentration 1%. Gently shake to mix well (the medium turns orange-yellow), incubate at room temperature for 10 min, and gently shake the culture dish during the incubation to make the formaldehyde crosslinking more sufficient; for suspension cells, add formaldehyde at a final concentration of 1% according to the volume of the medium, shake well, incubate at room temperature for 10 min. Cut 100 mg of animal tissue into small pieces about 2 mm with surgical scissors, and add PBS solution containing 1% formaldehyde;

[0141] 2) Terminate crosslinking (operation in fume hood)

[0142] Add 925 μl of 10X glycine to make the final concentration 0.125 M; gently shake to mix well and place at room temperature for 5 min. For adherent cells, directly discard the medium (light yellow); for suspension cells, centrifuge and then discard the medium;

[0143] 3) Cell collection (operation in fume hood)

[0144] For adherent cells, add 1 ml of pre-cooled PBS (add 0.5 mM PMSF immediately) to the culture dish, scrape the cells at the bottom of the dish with a cell scraper, and collect the obtained suspension into a 2 ml centrifuge tube; for suspension cells, directly add 1 ml of pre-cooled PBS (add 0.5 mM PMSF immediately), centrifuge at 3000 rpm and 4 °C for 5 min, and try to discard the supernatant to obtain cell pellet; (at this time, the sample can be stored at -80 °C);

[0145] 4) Lyse cells

[0146] (1) Add an appropriate amount of ChIP Lysis Buffer (estimated according to the cell amount, 200 μl of lysis buffer corresponds to 1×10 7Cells, (containing 10 ul of 100X protease inhibitor), were incubated with rotation at 4°C for 30 min or on ice for 30 min, and were mixed every 5 min during incubation.

[0147] (2) After incubation, 800 ul of CHIP Buffer was added and mixed well.

[0148] (3) Sonication was performed on ice (note that the depth of the sonication probe inserted into the liquid surface was basically uniform), with 20% power, and the time was set according to the pre-experiment exploration (5 - 10 min).

[0149] (4) At this time, 50 ul was separated as the subsequent input sample for reverse cross-linking - DNA purification and recovery, and was detected by 1.5% agarose gel electrophoresis to examine whether the DNA fragment was in the range of 200 - 700 bp. At the same time, the DNA concentration was measured, and the samples that were not used temporarily could be stored at -80°C.

[0150] Table 4: Concentration Detection after ChIP Enrichment (Qubit)

[0151] Sample name Concentration ng / μL Volume μL Total IgG 1.0 20 20 IP 1.6 20 32 Input 41.9 20 838

[0152] Example 3

[0153] Verify whether there is an interaction between proteins:

[0154] 1. Experimental Instruments and Materials

[0155] 1.1 Experimental Instruments

[0156] Table 5

[0157]

[0158]

[0159] 1.2 Experimental Reagents

[0160] Table 6

[0161]

[0162]

[0163]

[0164] 1.3 Preparation of Experimental Solutions

[0165] 6x Loading Buffer: 0.5 M / L Tris-HCL (pH 6.8), 0.5 M / L DTT (dithiothreitol), 10% SDS (m / v), 0.5% bromophenol blue (m / v), 30% glycerol (v / v). Make up to volume with pure water and store at -20°C.

[0166] 8 M / L Urea: Dissolve 24 g of urea in 50 ml of pure water and store at 4°C.

[0167] Blocking Solution:

[0168] 1.1% Casein: Dissolve 5 g of casein in 500 ml of 1x TBS, stir for 1 hour and store at 4°C.

[0169] 2.5% Non-fat Dry Milk: Dissolve 25 g of non-fat dry milk in 500 ml of 1x TBS, shake well and store at 4°C.

[0170] Antibody Diluent:

[0171] 1. 0.5% Casein: Dissolve 2.5 g of casein in 500 ml of 1x TBS, add 0.05% Tween-20 (250 μl), stir for 1 hour and store at 4°C.

[0172] 2. 2.5% Non-fat Dry Milk: Dissolve 12.5 g of non-fat dry milk in 500 ml of 1x TBS, add 0.05% Tween-20 (250 μl), shake well and store at 4°C.

[0173] 25x TBS: Dissolve 60.6 g of Tris and 200 g of NaCl in 700 ml of pure water, adjust the pH to 7.40 with hydrochloric acid and make up to 1 L. Store at room temperature.

[0174] 1x TBS: Dilute 40 ml of 25x TBS to 1 L with pure water and store at room temperature.

[0175] 1x TBST: Dilute 40 ml of 25x TBS, add 1 ml of Tween, make up to 1 L with pure water and store at room temperature.

[0176] 1x PBS: Dissolve 8 g of NaCl, 0.2 g of KCl, 1.44 g of Na2HPO4, 0.44 g of KH2PO4 and 0.056 g of NaOH in 1 L of water and store at room temperature.

[0177] Tris-HCL 7.5 Recipe (2 M / L):

[0178] 48.4 g of Tris, adjust the pH to 7.5 with hydrochloric acid and make up to 200 ml. Store at room temperature.

[0179] Tris-HCL 8.0 formulation (2M / L):

[0180] 48.4 g Tris, adjust the pH to 8.0 with hydrochloric acid, make up the volume to 200 ml, and store at room temperature.

[0181] Eluent: Aqueous solution of 1% sodium deoxycholate, 0.5% SDS, 0.5% CHAPS plus an equal volume of RIPA lysis buffer, freshly prepared.

[0182] Fixative: 500 mL ethanol + 100 mL acetic acid, make up the volume to 1 L, and store at room temperature.

[0183] Sensitizer: 330 mL ethanol + 68 g sodium acetate, make up the volume to 1 L, and store at room temperature.

[0184] (50 mL plus 250 μl glutaraldehyde, 250 μl 4% Na2S2O3)

[0185] Staining solution: H2O (ultrapure water)

[0186] (50 mL plus 500 μl 25% AgNO3, 30 μl 37% formaldehyde solution)

[0187] Developing solution: 25 g sodium carbonate dissolved in water, make up the volume to 1 L, and store at room temperature.

[0188] (50 mL plus 15 μl 37% formaldehyde solution)

[0189] Coomassie staining solution: 2.5 g R-250 (Coomassie Brilliant Blue), 500 ml ethanol, 100 ml acetic acid, make up the volume to 1000 ml with pure water, and store at room temperature.

[0190] Coomassie destaining solution: 50 ml ethanol, 100 ml acetic acid, make up the volume to 1000 ml with pure water, and store at room temperature.

[0191] Table 7

[0192]

[0193]

[0194] Note: IP dilution buffer and IP washing buffer are stored at 4°C.

[0195] Table 8: IP lysis buffer formulation (stored at 4°C)

[0196]

[0197] Note: Phosphatase inhibitor mixture (1 mM), protease inhibitor mixture (1 mM), PMSF (1 mM), DTT (1 mM) (all three or four are added before use, and the plant IP lysis buffer does not contain phosphatase inhibitor mixture). Both IP lysis buffers are stored at 4°C.

[0198] Table 9: Formula of IP Lysis Buffer Stock Solution (Stored at 4°C)

[0199]

[0200]

[0201] Table 10: Formula of Lysis Buffer (Stored at 4°C)

[0202]

[0203] Note: Phosphatase inhibitor mixture (1 mM), protease inhibitor mixture (1 mM), PMSF (1 mM), DTT (1 mM) (all three or four are added before use, and the plant IP lysis buffer does not contain phosphatase inhibitor mixture). Both IP lysis buffers are stored at 4°C.

[0204] Table 11: Formula of Lysis Buffer Stock Solution (Stored at 4°C)

[0205]

[0206]

[0207] 2. Experimental Procedures

[0208] 2.1 Protein Extraction

[0209] 2.1.1 Animal Tissues: (RIPA Lysis Buffer)

[0210] 1) Weigh approximately 0.2 g of animal tissue, wash the surface blood with PBS, put it into a 1.5 ml clean EP tube, and grind it into a homogenate state with a handheld high-speed homogenizer;

[0211] 2) Add 1 ml of RIPA lysis buffer containing phosphatase inhibitor mixture (1 mM), protease inhibitor mixture (1 mM), PMSF (1 mM), DTT (1 mM) (the concentrations are all final concentrations, and all four are added before use), and continue to grind with a handheld high-speed homogenizer for 10 s;

[0212] 3) Incubate on ice for 20 min, vortex every 10 min for 10 s each time;

[0213] 4) Sonicate with a sonicator for 5 min at a power of 20%, working for 3 s and intermittent for 3 s, sonicating on ice;

[0214] 5) Centrifuge at 12,000 r / min for 10 min at 4°C using a tabletop high-speed refrigerated centrifuge. The supernatant is the total protein.

[0215] 2.1.2 Cells: (RIPA lysis buffer)

[0216] 1) Add 1x10^7 cells (approx. 50 μl) to 0.5 ml of RIPA lysis buffer containing a phosphatase inhibitor mixture (1 mM), a protease inhibitor mixture (1 mM), PMSF (1 mM), and DTT (1 mM) (all at final concentrations, added just before use). Gently pipette up and down to mix well.

[0217] 2) Incubate on ice for 20 min, vortexing every 5 min for 10 s each time.

[0218] 3) Sonicate for 2 min using a sonicator at 20% power, working for 3 s and pausing for 3 s, with ice bath during sonication.

[0219] 4) Centrifuge at 12,000 r / min for 10 min at 4°C using a tabletop high-speed refrigerated centrifuge. The supernatant is the total protein.

[0220] 2.1.3 Plant tissues: (NS2T lysis buffer)

[0221] 1) Weigh approximately 0.3 g of washed plant tissues, cut them into small pieces as much as possible with sterilized scissors in a pre-cooled mortar sterilized with liquid nitrogen, grind them into powder and collect in a 1.5 ml EP tube.

[0222] 2) Add 1 ml of plant protein lysis buffer containing a plant protease inhibitor mixture (1 mM), PMSF (2 mM), and DTT (1 mM) (all at final concentrations, added just before use).

[0223] 3) Incubate on ice for 20 min, vortexing every 5 min for 10 s each time.

[0224] 4) Sonicate for 8 min using a sonicator at 20% power, working for 3 s and pausing for 3 s, with ice bath during sonication.

[0225] 5) Centrifuge at 12,000 r / min for 10 min at 4°C using a tabletop high-speed refrigerated centrifuge. The supernatant is the total protein.

[0226] Note: The entire process of protein extraction is carried out on ice to reduce protein degradation caused by high temperature. During sonication, it is best to avoid the generation of bubbles to reduce protein degradation. The total protein is stored at -20°C to avoid repeated freezing and thawing. A portion can be taken out and stored at 4°C.

[0227] 2.2 Measuring the total protein concentration by BCA method

[0228] 1) Dilute the BSA standard: Dilute the BSA standard (standard concentration is 2 mg / ml) with the same diluent as the protein sample to be measured (1x PBS solution or 0.9% normal saline) according to the following table.

[0229] 2) Reagents: The BCA reagent is divided into Solution A, Solution B, and Solution C. For each group of samples to be measured, the required amounts of the three solutions are 4 μl of Solution C, 100 μl of Solution B, and 104 μl of Solution A.

[0230] 3) Total amount of reagents: For n samples with unknown concentrations, n + 8 portions of reagents need to be prepared.

[0231] 4) Operation (taking one portion as an example): Take 198 μl of 1x PBS and add it to an EP tube labeled with the name of the sample to be measured; add 2 μl of the lysate of the sample to be measured; then add 200 μl of the prepared BCA mixed reagent (i.e., the mixture of 4 μl of Solution C, 100 μl of Solution B, and 104 μl of Solution A), for a total of 400 μl of solution. Mix well; load the microplate reader, take 300 μl of the mixed solution and add it to the microplate wells. Record the order of the samples to be measured in the microplate wells, stick the microplate wells with large label paper, and incubate in an oven at 60 °C for 1 hour.

[0232] 5) Use the microplate reader to measure the protein concentration, adjust the wavelength to 562 nm, select rapid measurement, and record the measurement data.

[0233] 6) Input the recorded measurement data into an EXCEL spreadsheet. If the measurement data of reference G is not zero, then the other reference data need to subtract the data value of reference G. Use the adjusted reference sample data and the concentrations in the table in step 1.1.4 to create a scatter plot, display the formula, and require R^2 > 0.99.

[0234] 7) Subtract the value of reference G from the measurement data of the sample to be measured, input the adjusted data into the formula obtained in 6), divide by 1000, and multiply by 100 to obtain the concentration of the sample to be measured in mg / ml.

[0235] Table 12

[0236]

[0237] Precautions:

[0238] 1) The detection range of protein concentration by the BCA method: 20 - 2000 μg / ml. When measuring the protein concentration, the absorbance value will continuously deepen with the extension of time. Therefore, all sample measurements need to be completed within 3 - 5 minutes, otherwise it will affect the accuracy of protein quantification.

[0239] 2) It is recommended to use a standard 96-well microplate for measurement, with 300ul / well being the best.

[0240] 3) The absorbance values of the standard (7 reference groups) and the samples to be tested should be subtracted from the absorbance value of the blank control (reference group G) and the readings should be used to draw the standard curve.

[0241] 4) Standard readings that deviate significantly from the linear curve due to operational errors should be discarded.

[0242] 5) The concentration of unknown samples can be calculated from the standard curve equation, and the actual concentration needs to be multiplied by the dilution factor of the sample.

[0243] 6) If the protein concentration obtained is not within the detection range, please dilute the sample and measure again.

[0244] 2.3 Western blot detection before CoIP

[0245] 2.3.14%-20% gradient precast gel preparation

[0246] Select a precast gel of appropriate concentration according to the molecular weight of the target protein to be tested.

[0247] 2.3.2 Sample electrophoresis

[0248] Write down the order of samples to be sampled, sample volume, name of primary antibody, size of target protein, primary antibody dilution ratio, and species of secondary antibody in the experimental notebook in advance. Use a 10ul / 50ul pipette to take an appropriate amount of the cooked sample and add it to the well. Electrophoresis at 100V for 60-70min, and stop electrophoresis when the purple bromophenol blue band in the sample is electrophoresed to 5-10mm from the bottom of the gel.

[0249] 2.3.3 Transfer

[0250] Mark the PVDF membrane in advance, soak it in methanol for 30s-60s, pour out the methanol, rinse the PVDF membrane with pure water, and finally soak it in the transfer solution and shake it. The transfer conditions are (can be adjusted appropriately):

[0251] Table 13

[0252] Protein molecular weight kd Transfer conditions 1～15 About 3 minutes 15～30 About 5 minutes 30～150 About 8 minutes 150～300 About 13 minutes More than 300 About 22 minutes

[0253] After transfer, soak the PVDF membrane in 1xTBS for 5 minutes, and then wash it with pure water for 10 minutes.

[0254] 2.3.4 Closure

[0255] Prepare the blocking solution in advance by mixing 5% non-fat milk powder or 1% casein. After transferring the membrane, take out the PVDF membrane from the transfer apparatus and soak it in TBS solution. Then place it in an incubation box containing the blocking solution (the blocking solution should just cover the PVDF membrane), and shake it at room temperature for 1 - 2 hours.

[0256] 2.3.5 Incubation with primary antibody

[0257] Pour out the blocking solution in the incubation box, dilute the antibody with antibody diluent. For the first time, follow the dilution ratio recommended in the antibody instruction manual. Subsequently, make appropriate adjustments according to the results. Then add it to the corresponding incubation box, and place the incubation box on a shaker at 4°C and incubate overnight.

[0258] 2.3.6 Wash the PVDF membrane

[0259] Pour out or recycle the primary antibody diluent, and wash it with TBST solution (the diluent should just cover the PVDF membrane). Wash it 3 - 4 times in total, about 10 minutes each time, and shake it on a shaker.

[0260] 2.3.7 Incubation with secondary antibody

[0261] Select the secondary antibody according to the source of the primary antibody, usually mouse anti- or rabbit anti-. Dilute it with antibody diluent, generally fixed at about 1:10000. Pour out the washing solution in the incubation box, add the diluted secondary antibody to the corresponding incubation box, and then place the incubation box on a shaker and incubate at room temperature for about 1 - 1.5 hours.

[0262] 2.3.8 Wash the PVDF membrane

[0263] Pour out or recycle the secondary antibody diluent, and wash it with TBST solution (the diluent should just cover the PVDF membrane). Wash it 3 - 4 times in total, about 10 minutes each time, and shake it on a shaker.

[0264] 2.3.9 Development

[0265] 1) Immerse the washed PVDF membrane in TBS solution, lay a piece of plastic wrap, place the PVDF membrane on filter paper, and prepare the luminescent solution. The luminescent solution is divided into solution A and solution B, and it should be prepared immediately before use (solution A: solution B = 1:1). Mix them well and keep them away from light for about 3 minutes. Place the PVDF membrane on filter paper, absorb the TBS solution, place the PVDF membrane neatly on the plastic wrap, add 1 ml of luminescent solution to each PVDF membrane. Re-lay the plastic wrap, place the PVDF membrane on the newly laid plastic wrap, then lay another layer of plastic wrap, cut it, and fix the cut PVDF membrane in the cassette with adhesive for development preparation.

[0266] 2) Enter the darkroom and press the film for five durations: 2 s, 10 s, 30 s, 2 min, and 10 min. First, place the film in the developer for about 30 s, and then place it in the fixer for about 30 s. Wash the film clean, dry it, draw a marker, and label the necessary information: the name of the primary antibody, the size of the target protein, the dilution ratio of the primary antibody, the project number, the developing time, and the date.

[0267] 2.3.10 Scan the film

[0268] 1) Use a scanner to scan the film and save it in TIFF format. The picture naming format is date + project number + developing time, and finally save it in the corresponding folder.

[0269] Note: The CoIP experiment can only be carried out after the target band is detected by WB before CoIP.

[0270] 2.4 CoIP (The lysis buffer used in this step is IP lysis buffer, which is different from the lysis buffer in WB before CoIP)

[0271] 2.4.1 Antibody-binding protein

[0272] 1) Prepare two clean centrifuge tubes labeled IP and IgG. Add 3 - 10 μg of the target antibody to the IP group, and add 3 - 10 μg of IgG of the same species as the target antibody to the IgG tube.

[0273] 2) Add 300 μg - 1 mg of protein solution (adjust according to the sample volume of the actual project) to the IgG and IP tubes respectively, and add IP dilution buffer to make the volume up to 500 - 800 μl. Mix gently overnight (about 16 h) at 4°C.

[0274] 2.4.2 Magnetic bead preparation

[0275] 1) Take out the Protein A / G magnetic beads from the 4°C refrigerator, invert them several times to mix the magnetic beads and the solution evenly. Take 50 μl each and transfer them to two clean 1.5 ml EP tubes, labeled IgG and IP.

[0276] 2) Add 0.5 ml of pre-cooled IP wash buffer to resuspend the magnetic beads, place them on the magnetic rack and let them stand for 1 min to separate the magnetic beads and the solution. Carefully pipette and discard the supernatant with a pipette.

[0277] 3) Repeat the washing 2 times, for a total of 3 washes.

[0278] 2.4.3 Binding of magnetic beads to the complex

[0279] 1) Add the mixed solutions after incubation of the two groups of protein antibodies to the corresponding magnetic bead tubes that have been washed, and mix gently at room temperature for 1.5 - 2 h.

[0280] 2) Place the 2 tubes on the magnetic stand and let stand for 1 min to separate the magnetic beads and the solution. Carefully aspirate and discard the supernatant with a pipette or recover it (the recovered sample solution is stored at -20 °C);

[0281] 3) Add 0.5 ml of pre-cooled IP washing solution, place it on the magnetic stand and let stand for 1 min to separate the magnetic beads and the solution. Carefully aspirate and discard the supernatant with a pipette;

[0282] 4) Repeat step 3) 2 times for a total of 3 washes.

[0283] 2.4.4 Elution

[0284] 1) Add 120 μl of boiling elution solution to both the IgG and IP tubes, incubate in a water bath at 95 °C for 5 min, centrifuge at 12000 rpm for 5 min, take the supernatant and record it as the eluate. Add 20 μl of 6* Loading buffer and boil in a water bath for 5 min, record it as IgG and IP;

[0285] 2) Take 100 μl of the total protein solution, add 20 μl of 6* Loading buffer, boil in a water bath for 8 - 10 min, record it as Input; IgG, IP and Input are stored at -20 °C for later use.

[0286] Note: When the Beads are for subsequent mass spectrometry experiment samples, take out 1 / 4 of the mixed magnetic bead elution solution during the last wash before boiling, wash 3 times with PBS and then discard the washing solution. The magnetic beads are stored at -20 °C.

[0287] 2.5 WB detection after CoIP

[0288] Refer to 2.3.

[0289] Differences in the expression of PD-L1, GAS6 and EGR1 mRNAs were found in the overexpression of the enhancer complex in MG63 cells and SW620 cells. Differences in the expression of PD-L1, GAS6 and EGR1 mRNAs were also found in the knockout of complex components in SW620 cells under both normoxic and hypoxic conditions.

[0290] MG63 and SW620 cells were divided into 5 groups and transfected with PD-L1, PD-L1+HMGA1+SP1, PD-L1+SMAD3+SP1, P300+STAT3+SP1 plasmids (Abbiver, Changsha, China) in sequence. Under normoxic conditions, PCR was used to detect and confirm their successful overexpression, and GAS6 and EGR1 mRNAs were measured. SW620 cells with sufficient basal PD-L1 expression were divided into 5 groups and transfected with control small interfering ribonucleic acid (siRNA) and siRNAs targeting SP1, PD-L1+SP1, HMGA1, and HMGA1+SMAD3 (Abbiver, Changsha, China) in sequence. After culturing for 48 hours under normoxic conditions, or after two cycles of 20-hour normoxic culture and 4-hour hypoxic culture, qPCR was performed to confirm their successful knockdown and measure GAS6 and EGR1 mRNAs. The specific method of PCR was to extract total RNA from the prepared cell samples using an RNA purification kit. Then, real-time fluorescence quantitative PCR (qRT-PCR) was used for detection. The total reaction system was 20 μL, and the following reaction was carried out on a PCR amplifier: 95°C for 2 min; 95°C for 5 s, 60°C for 35 s, for a total of 40 cycles, and the fluorescence signal was collected at the second step (60°C for 35 s) of each cycle. The primer sequences are as follows:

[0291] SMAD3-F: GGGGGTTGGACTTTCCTTCC

[0292] SMAD3-R: GACTCCAAGTGGCAGCAGAA

[0293] SP1-F: CCCTTGAGCTTGTCCCTCAG

[0294] SP1-R: TGAAAAGGCACCACCACCAT

[0295] P300-F: GCAGTGTGCCAAACCAGATG

[0296] P300-R: GGGTTTGCCGGGGTACAATA

[0297] GAS6-F: ACGACCCCGAGACGGATTAT

[0298] GAS6-R: GGCGAAGCCTGAGTTTTTGG

[0299] STAT3-F: TCTGTGTGACACCAACGACC

[0300] STAT3-R: TCCTCACATGGGGGAGGTAG

[0301] EGR1-F: CCCACCATGGACAACTACCC

[0302] EGR1-R: AAAGACTCTGCGGTCAGGTG

[0303] HMGA1-F: CATCCGCATTTGCTACCAGC

[0304] HMGA1-R: TCTCAGTGCCGTCCTTTTCC

[0305] PD-L1-F ACTGGCATTTGCTGAACG

[0306] PD-L1-R TCCTCCATTTCCCAATAGAC

[0307] The six irregular configurations are as follows:

[0308]

[0309] Although the embodiments of the present invention have been shown and described, it will be understood by those of ordinary skill in the art that various changes, modifications, substitutions and variations can be made to these embodiments without departing from the principles and spirit of the present invention, and the scope of the present invention is defined by the appended claims and their equivalents.

Claims

1. A new PD-L1 enhancer configuration for regulating the transcription of 114 target genes, characterized in that, Including the following configurations:

2. A novel PD-L1 enhancer configuration for regulating the transcription of 114 target genes according to claim 1, characterized in that PD-L1 does not directly bind to SP1 and STAT3 and then bind to DNA.

3. A novel PD-L1 enhancer configuration for regulating the transcription of 114 target genes according to claim 1, characterized in that, HMGA1, SMAD3, and P300 act as mediator molecules to mediate the basic configurations of PD-L1 binding to the complex and SP1 and STAT3 binding to DNA.

4. A novel PD-L1 enhancer configuration for regulating the transcription of 114 target genes according to claim 3, characterized in that HMGA1 and SMAD3 are mediators between PD-L1 and SP1, P300 is a mediator between SMAD3 and STAT3, and HMGA1 binds to P300 and pulls down SMAD3.

5. An experimental method for a new PD-L1 enhancer configuration that regulates the transcription of 114 target genes as described in claim 1, characterized in that, Including the following steps: S1. 114 PD-L1-enriched target genes were obtained by chromatin immunoprecipitation sequencing (Chip-sequence) of PD-L1. S2. The gene sequences enriched with PD-L1, HMGA1, SMAD3, SP1, and STAT3 in MG63 cells and SW620 cells were enriched by ChIP experiments, and qPCR verification and analysis were performed. S3. Proteins were extracted from animal tissues, cells, and plant tissues. The total protein concentration was measured by the BCA method. WB detection was performed before and after the immunoprecipitation (CoIP) experiment, and qPCR verification and analysis were carried out. S4. MG63 and SW620 cells were transfected with PD-L1, PD-L1 + HMGA1 + SP1, PD-L1 + SMAD3 + SP1, and P300 + STAT3 + SP1 plasmids in sequence. Under normoxic conditions, after PCR detection, SW620 cells were transfected with control small interfering ribonucleic acid (siRNA) and siRNAs targeting SP1, PD-L1 + SP1, HMGA1, and HMGA1 + SMAD3 in sequence, and cultured under oxygen conditions. The primer sequences were obtained by using real-time fluorescence quantitative PCR (qRT-PCR) method.

Images