Recombinant silk fibroin fusion protein and its preparation method and application

Abstract

The present invention discloses a recombinant silk fibroin fusion protein, its preparation method, and application. The amino acid sequence of the recombinant silk fibroin is shown in SEQ ID NO: 3. The present invention utilizes genetic engineering methods to efficiently express silk fibroin, ultimately yielding highly expressed, highly purified recombinant silk fibroin or recombinant silk fibroin-like protein that retains the efficacy and activity of the natural protein, demonstrating high potential for industrial application.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a recombinant silk fibroin fusion protein and a preparation method and application thereof, for example, in the development of cosmetic raw materials. Background Art

[0002] Silk fibroin (SF) is a natural, high-molecular-weight fibrous protein extracted from silk, comprising approximately 70%-80% of silk. SF is the most important component of silk and is a fibrous protein. As a natural material, it possesses excellent biodegradability and oxygen permeability, is non-toxic and non-sensitizing in the human body, and exhibits good biocompatibility and low immunogenicity. Therefore, silk fibroin has a wide range of applications in biomaterials and medical devices. Natural silk fibroin can also inhibit LPS-induced inflammatory responses by regulating the TLR4 signaling pathway. It also has moisturizing properties and supports the proliferation of various cells, leading to its widespread application in cosmetics.

[0003] Silk fibroin is primarily obtained through natural extraction, with the main processes including degumming, hydrolysis, dialysis, and filtration. To convert silk into silk fibroin medical materials, it first needs to undergo degumming, which can be done by enzymatic or chemical treatment to remove the sericin. After degumming, the natural silk fibroin undergoes hydrolysis, dialysis, filtration, and desalination to produce a mixed regenerated silk fibroin. However, the silk fibroin produced by this method may destroy its natural structure. Furthermore, the quality and function of naturally extracted silk fibroin are easily affected by different batches, resulting in high purification costs and difficulty in controlling the quality of each batch.

[0004] With the advancement of genetic engineering and synthetic biology, heterologous protein production has become increasingly popular. Heterologous expression offers advantages such as a single product component, safety, a controllable production process, and minimal batch-to-batch variability. Heterologous expression through genetic engineering is an effective strategy for producing silk fibroin or fibroin-like proteins. The heavy chain protein is the primary component of the silk fibroin basic unit, accounting for 92%. Its amino acid sequence is primarily GX, with the X structure primarily consisting of Ala (64%), Ser (22%), and Tyr (10%). This results in a highly repetitive sequence and numerous hydrophobic regions, making it difficult to efficiently express recombinant silk fibroin. Wang Jiannan et al. generated fibroin-like proteins by fusing the silk fibroin heavy chain crystalline region basic unit 16 times with varying multiples of the non-crystalline region and the fusion-promoting protein GST, achieving a maximum yield of 53.2 mg / L.

[0005] Heterologous expression systems include Escherichia coli, Pichia pastoris, and mammalian expression systems. The Pichia pastoris expression system offers the same simplicity, ease of culture, and high expression levels as prokaryotic expression systems, along with post-translational modification capabilities such as glycosylation and phosphorylation. Its robust secretion reduces the need for post-processing, making it an ideal expression system for recombinant silk fibroin. Low silk fibroin yields are one of the factors limiting its industrial production. Another limiting factor is whether recombinant silk fibroin possesses similar activities and functions to naturally extracted proteins. CN118480553A reports that, after renaturation, the recombinant silk fibroin-like protein produced via an E. coli expression system exhibits whitening, UV protection, antioxidant, and moisturizing properties.

[0006] Currently, silk fibroin is primarily extracted naturally, and the extraction process is complex, resulting in low batch stability and variability in product quality. Furthermore, due to the high repetitiveness of silk fibroin sequences, it is difficult to recombinantly express silk fibroin or fibroin-like proteins with high yield, purity, efficacy, and activity, making its industrialization difficult. Summary of the Invention

[0007] To address the current shortage of high-purity, effective, and active silk fibroin or fibroin-like proteins, the present invention provides a recombinant silk fibroin fusion protein, its preparation method, and its application. The recombinant silk fibroin protein of the present invention is highly expressed and pure, while retaining the efficacy and activity of the native protein, and has great potential for industrial application.

[0008] Specifically, the inventors analyzed the silk fibroin sequence and optimized the recombinant silk fibroin fusion protein sequence by fusing collagen fragments with the silk fibroin sequence. This sequence was expressed in a Pichia pastoris expression system, purified, and tested for its efficacy and functional activity, ultimately yielding the recombinant silk fibroin fusion protein with adhesion, cell proliferation, and collagen metabolism activities.

[0009] The present invention solves the above technical problems through the following technical solutions.

[0010] A first aspect of the present invention provides a recombinant silk fibroin protein, the amino acid sequence of the recombinant silk fibroin protein is shown in SEQ ID NO: 3.

[0011] The second aspect of the present invention provides a polynucleotide encoding the recombinant silk fibroin as described in the first aspect.

[0012] In some embodiments of the present invention, the polynucleotide comprises the sequence shown in SEQ ID NO: 4 or is the sequence shown in SEQ ID NO: 4.

[0013] The third aspect of the present invention provides a recombinant expression vector comprising the polynucleotide as described in the second aspect.

[0014] The fourth aspect of the present invention provides a transformant, which expresses the recombinant silk fibroin as described in the first aspect, or contains the polynucleotide as described in the second aspect, or contains the recombinant expression vector as described in the third aspect; the transformant is not an animal variety or a plant variety.

[0015] In some embodiments of the present invention, the transformant is a eukaryotic cell or a prokaryotic cell.

[0016] In some embodiments of the present invention, the eukaryotic cell is selected from Pichia pastoris and Saccharomyces cerevisiae; and the prokaryotic cell is selected from Bacillus subtilis and Escherichia coli.

[0017] In some embodiments of the present invention, the Pichia pastoris is a GS115 cell.

[0018] The fifth aspect of the present invention provides a genetically engineered bacterium expressing recombinant silk fibroin, wherein the starting strain of the genetically engineered bacterium is Pichia pastoris, and the genetically engineered bacterium comprises the polynucleotide as described in the second aspect.

[0019] The sixth aspect of the present invention provides a use of the recombinant silk fibroin as described in the first aspect, the polynucleotide as described in the second aspect, the recombinant expression vector as described in the third aspect, the transformant as described in the fourth aspect, or the genetically engineered bacteria as described in the fifth aspect in the preparation of an agent for promoting keratinocyte adhesion and proliferation, promoting fibroblast proliferation or collagen metabolism, promoting skin repair, or promoting skin firming and anti-wrinkle.

[0020] It is known in the art that fibroblasts, cells found in the dermis of the skin, have the ability to synthesize and secrete collagen, elastic fibers, and hyaluronic acid, among other proteins. They participate in wound healing, tissue remodeling, and the synthesis of the extracellular matrix. Fibroblasts, located in the dermis, participate in maintaining skin elasticity, firmness, and moisturizing.

[0021] The seventh aspect of the present invention provides a composition, which comprises the recombinant silk fibroin as described in the first aspect, the polynucleotide as described in the second aspect, the recombinant expression vector as described in the third aspect, the transformant as described in the fourth aspect, or the genetically engineered bacteria as described in the fifth aspect, as well as a carrier and / or excipients.

[0022] In some embodiments of the present invention, the composition is a cosmetic composition, a wound dressing composition, or a wound repair composition.

[0023] An eighth aspect of the present invention provides a method for preparing recombinant silk fibroin, the method comprising:

[0024] The genetically engineered bacteria described in the fifth aspect are sequentially subjected to induced expression and induced culture.

[0025] In some embodiments of the present invention, the induced expression is cultured in YPD medium and then inoculated into BMGY medium for culture at 30° C. and 220 rpm;

[0026] The induction culture is carried out in BMMY medium with the addition of methanol, the culture conditions are 30° C., 220 rpm, and the final concentration of methanol is 1%, where the % is the volume percentage.

[0027] On the basis of conforming to the common sense in this field, the above-mentioned preferred conditions can be arbitrarily combined to obtain the preferred embodiments of the present invention.

[0028] The reagents and raw materials used in the present invention are commercially available.

[0029] The positive progress effect of the present invention is:

[0030] The recombinant silk fibroin of the present invention has high expression level and high purity, and can retain the adhesion, cell proliferation and collagen metabolism activities of natural protein, and has high industrial application potential. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 The results of SDS-PAGE detection of SF-22 induced by shake flask;

[0032] Lane 1 represents SF-22 induced for 72 h. Its SDS-PAGE molecular weight is higher than the theoretical molecular weight, which may be due to hydrophobicity and post-translational modification.

[0033] Figure 2 The results of SDS-PAGE detection of SF-22 induced in fermenter;

[0034] Lane 1: 24 h induction; Lane 2: 48 h induction; Lane 3: 72 h induction. The SDS-PAGE molecular weight is higher than the theoretical molecular weight, which may be caused by the strong hydrophobicity of amino acids and post-translational modification.

[0035] Figure 3 The results of SEC-HPLC after purification are shown.

[0036] Figure 4 Results of human immortalized keratinocyte adhesion experiments.

[0037] Figure 5 These are the results of fibroblast proliferation experiments.

[0038] Figure 6 These are the results of the immortalized keratinocyte proliferation experiment.

[0039] Figure 7 These are the results of the fibroblast collagen metabolism experiment. DETAILED DESCRIPTION

[0040] The present invention is further illustrated by way of examples below, but the present invention is not limited to the scope of the examples. Experimental methods in the following examples where specific conditions are not specified were performed according to conventional methods and conditions, or selected according to the product specifications.

[0041] Specifically, due to the high hydrophobicity and repetitive sequences of silk fibroin, which made recombinant expression difficult, the inventors conducted sequence analysis and identified a hydrophilic collagen peptide. This peptide was fused to the N-terminus of the silk fibroin "GX" repeat sequence and repeated six times (SEQ ID NO: 6), resulting in a recombinant silk fibroin-like protein named SF-22. A recombinant vector for SF-22 was then constructed and linearized, transformed into the GS115 host cell, and screened using MD plate culture to obtain the corresponding engineered bacteria. The engineered bacteria containing the SF-22 recombinant vector were induced to express the recombinant silk fibroin. Expression levels were compared, and the strains with the highest expression levels were selected for fermentation. The fermentation supernatant was then collected and filtered through membrane filtration, column chromatography, and freeze-vacuum drying to produce a high-purity recombinant silk fibroin fusion protein sponge. Finally, the prepared recombinant silk fibroin fusion protein sponge was diluted to various concentrations for efficacy testing on immortalized human keratinocytes and fibroblasts. The efficacy of the samples was compared with that of a control in terms of cell adhesion, cell proliferation, and collagen metabolism.

[0042] Example

[0043] Example 1: Construction of genetically engineered Pichia pastoris expressing recombinant silk fibroin fusion protein

[0044] 1.1 Screening of recombinant silk fibroin fusion protein sequences

[0045] Because the silk fibroin sequence is essentially a "GX" repeating sequence and the amino acids are highly hydrophobic, recombinant expression is difficult. Collagen sequences are highly hydrophilic and have low immunogenicity, and numerous studies have shown that recombinant collagen can achieve high expression levels. Fusion expression of collagen fragments with silk fibroin may yield highly expressed recombinant silk fibroin-like proteins. Therefore, the present inventors screened for hydrophilic collagen peptides, the amino acid sequence of which is shown in SEQ ID NO: 1, and silk fibroin "GX" repeating sequences, the amino acid sequence of which is shown in SEQ ID NO: 2, through sequence analysis and bioinformatics methods. The collagen peptides were fused to the N-terminus of the silk fibroin "GX" repeating sequence to yield a fusion sequence, which was repeated six times to yield a recombinant silk fibroin-like protein named SF-22, the amino acid sequence of which is shown in SEQ ID NO: 3. The nucleotide sequence corresponding to SF-22 is shown in SEQ ID NO: 4.

[0046] The amino acid sequence of the hydrophilic collagen peptide is as follows:

[0047] GPRGDKGETGER (SEQ ID NO: 1)

[0048] The fibroin "GX" repeat sequence is as follows:

[0049] GAGAGSGAGSGSGAGAGSGAGSGSGAGAGSGAGSGS (SEQ ID NO: 2)

[0050] The amino acid sequence of SF-22 is as follows:

[0051] GPRGDKGETGERGAGAGSGAGSGSGAGAGSGAGSGSGAGAGSGAGSGSGPRGDKGETGERGAGAGSGAGSGSGAGAGSGAGSGSGAGAGSGAGSGSGPRGDKGETGERGAGAGSGAGSGSGAGAGSGAGSGSGAGAGSGAGSGSGPRGDKGETGERGAGAGSGAGSGSGAGAGSGAGSGSGAGAGSGAGSGSGPRGDKGETGERGAGAGSGAGSGSGAGAGSGAGSGSGAGAGSGAGSGSGPRGDKGETGERGAGAGSGAGSGSGAGAGSGAGSGSGAGAGSGAGSGS*(SEQ IDNO: 3)

[0052] The nucleotide sequence corresponding to SF-22 is as follows:

[0053] GGTCCAAGAGGTGACAAGGGTGAAACTGGTGAAAGAGGTGCTGGTGCTGGTTCTGGTGCTGGTTCCGGTTCTGGTGCCGGTGCTGGTTCAGGTGCTGGTAGTGGTTCTGGTGCAGGTGCTGGTTCTGGAGCTGGTTCTGGTTCTGGTCCAAGAGGTGACAAGGGTGAAACTGGTGAAAGAGGTGCTGGTGCTGGTTCTGGTGCTGGTTCCGGTTCTGGTGCCGGTGCTGGTTCAGGTGCTGGTAGTGGTTCTGGTGCAGGTGCTGGTTCTGGAGCTGGTTCTGGTTCTGGTCCAAGAGGTGACAAGGGTGAAACTGGTGAAAGAGGTGCTGGTGCTGGTTCTGGTGCTGGTTCCGGTTCTGGTGCCGGTGCTGGTTCAGGTGCTGGTAGTGGTTCTGGTGCAGGTGCTGGTTCTGGAGCTGGTTCTGGTTCTGGTCCAAGAGGTGACAAGGGTGAAACTGGTGAAAGAGGTGCTGGTGCTGGTTCTGGTGCTGGTTCCGGTTCTGGTGCCGGTGCTGGTTCAGGTGCTGGTAGTGGTTCTGGTGCAGGTGCTGGTTCTGGAGCTGGTTCTGGTTCTGGTCCAAGAGGTGACAAGGGTGAAACTGGTGAAAGAGGTGCTGGTGCTGGTTCTGGTGCTGGTTCCGGTTCTGGTGCCGGTGCTGGTTCAGGTGCTGGTAGTGGTTCTGGTGCAGGTGCTGGTTCTGGAGCTGGTTCTGGTTCTGGTCCAAGAGGTGACAAGGGTGAAACTGGTGAAAGAGGTGCTGGTGCTGGTTCTGGTGCTGGTTCCGGTTCTGGTGCCGGTGCTGGTTCAGGTGCTGGTAGTGGTTCTGGTGCAGGTGCTGGTTCTGGAGCTGGTTCTGGTTCTTAA (SEQ ID NO: 4)

[0054] 1.2 Construction of recombinant silk fibroin fusion protein expression host bacteria

[0055] Six nucleotides ("AAAAGA") were added to the 5' end of the SF-22 nucleotide sequence and synthesized at Jiangsu Saisuofei Biotechnology Co., Ltd. The resulting product was cloned into the Xho I and Not I sites of the pPIC9F plasmid to construct the pPIC9F recombinant vector containing SF-22. The sequence of pPIC9F is shown in SEQ ID NO: 5.

[0056] The recombinant vector was linearized by Sal I digestion and then transformed into the GS115 host. The corresponding engineered bacteria were screened using MD plates (composition shown in Table 1). The specific steps are as follows:

[0057] First, place the electroporation cuvette on ice. Add 10 μL of the linearized plasmid to a 1.5 mL EP tube containing 80 μL of Pichia competent cells. Mix thoroughly and transfer to a 0.2 cm diameter electroporation cuvette. Incubate on ice for approximately 5 minutes. Perform the electroporation according to the programmed protocol. After the electroporation is complete, add 300 μL of ice-cold 1 M sorbitol solution and 300 μL of YPD medium to the electroporation cuvette and pipette to mix thoroughly. Then, transfer all the liquid in the electroporation cuvette to a new 1.5 mL EP tube and incubate on a shaker at 30°C for 2 hours. Centrifuge at 12,000 rpm for 1 minute to collect the cells, spread them onto MD plates, and incubate at 30°C for 3-4 days.

[0058] Table 1 MD medium formula

[0059]

[0060] Example 2: Expression and preparation of recombinant silk fibroin fusion protein

[0061] 2.1 Small-scale expression and identification of recombinant silk fibroin fusion protein

[0062] Induction of expression: Pick a single colony and inoculate it into 10 mL YPD medium (composition as shown in Table 2) at 30°C, 220 rpm for 20 h, then transfer it to 25 mL BMGY (composition as shown in Table 3) in a 250 mL sterile conical flask at 0.1% inoculum and incubate it at 30°C, 220 rpm overnight until the OD 600 = 2-6; centrifuge at 3500 rpm for 5 min, collect the cells, discard the supernatant, and resuspend the cells in BMMY medium (composition as shown in Table 4) to OD 600 =1, 30℃, 220 rpm induction culture; methanol was added every 24 h to a final concentration of 1% to induce expression, the total induction time was 72 h, and SDS-PAGE was used to detect the expression of SF-22. The results are as follows Figure 1 shown.

[0063] Table 2 YPD medium formula

[0064]

[0065] Table 3 BMGY medium formula

[0066]

[0067] Table 4 BMMY medium formula

[0068]

[0069] 2.2 Expression and purification of recombinant silk fibroin fusion protein in fermentation tank

[0070] The strain containing SF-22 was induced to express in a 2 L fermenter. The fermentation ended after 72 h of induction. After the fermentation, the supernatant was collected by centrifugation at 6500 rpm for 30 min and the expression was detected by SDS-PAGE. The results showed that the expression was successful and the expression level increased with the extension of the induction experiment (see SDS-PAGE). Figure 2 ).

[0071] 2.3 Purification and preparation of recombinant silk fibroin fusion protein

[0072] The supernatant from the fermentation tank was clarified using a 0.1 μm membrane, concentrated using a 3 kDa membrane, and replaced with ultrapure water to a conductivity of 2 mS / cm. The pH was adjusted to 4.0 to obtain the loading solution. The loading solution was purified multiple times using a cation exchange column, lexcapSP 6FF, to obtain the sample. Finally, the sample was replaced with ultrapure water using a 3 kDa membrane and freeze-dried in a vacuum for 48 h. After freeze-drying, the SF-22 lyophilized sponge was formed. The SF-22 sponge was dissolved in 5 mg / mL and analyzed by SEC-HPLC. The results showed that the purity of SF-22 by SEC-HPLC was 92.77% (SEC-HPLC test results are shown in the table). Figure 3 ).

[0073] Example 3: Cellular efficacy experiment of recombinant silk fibroin fusion protein

[0074] 3.1 Human immortalized keratinocyte (Hacat) adhesion assay

[0075] SF-22 was dissolved to 2 mg / mL with PBS, then diluted to different concentration gradients with PBS, coated in a 96-well plate, and incubated at 4°C overnight. Day 1, discard the protein solution, and wash the well plate twice with PBS, and discard all the supernatant by shaking the plate. Hacat cells (Cell Bank of the Chinese Academy of Sciences) were added at 3E4 / well and cultured in a 37°C incubator for 1 hour. Observe the cell adhesion, shake the plate to discard the cells, and wash twice with PBS. Add CCK8 solution prepared with DMEM basal culture medium, 100 μL / well. Place at 37°C for 1 hour, read on an enzyme reader, and use Graphpad to obtain the OD value for plotting. The experimental results show that the control substance has no cell adhesion effect, and the SF-22 of the present invention has a significant effect of promoting cell adhesion, which is better than the control substance and PBS control (see adhesion results). Figure 4 The control substances were the soluble regenerated silk fibroin produced by Nanjing Siyuan Medical Technology Co., Ltd., with a production date of April 2, 2024, hereinafter referred to as Siyuan; and the soluble silk fibroin produced by Zhejiang Xingyue Biotechnology Co., Ltd., with a production date of May 8, 2024, hereinafter referred to as Xingyue.

[0076] 3.2 Fibroblast (HDF-1) proliferation assay

[0077] Fibroblasts in the logarithmic growth phase (Guangdong Boxi Biological) were resuspended with 10% FBS at 5E3 / well and added to a 96-well plate. Day 1, the supernatant of the well plate was discarded, and samples of different concentrations diluted with 0.1% FBS were added and incubated at 37°C for 48 h. After the incubation was completed, the supernatant was discarded, the cells were washed 1-2 times with PBS, and CCK8 solution prepared with DMEM basal culture medium was added, incubated at 37°C for 1 h, read on an enzyme reader, and after obtaining the OD value, graphed using Graphpad. The results showed that both SF-22 and the reference substance of the present invention can promote the proliferation of HDF-1, and the effect of SF-22 is better than that of the Siyuan and Xingyue reference substances (see the HDF-1 proliferation results). Figure 5 ).

[0078] 3.3 Human immortalized keratinocyte proliferation assay

[0079] Hacat cells in the logarithmic growth phase (Cell Bank of the Chinese Academy of Sciences) were resuspended with 10% FBS at 1E4 / well and added to a 96-well plate. Day 1, the supernatant was removed, and samples of different concentrations diluted with 0.1% FBS were added and incubated at 37°C for 48 hours. After the incubation was completed, the supernatant was discarded, the cells were washed 1-2 times with PBS, and CCK8 solution prepared with DMEM basal medium was added. The cells were incubated at 37°C for 1 hour, and the OD values ​​were read on a microplate reader. After obtaining the OD values, the graphs were drawn using Graphpad. The experimental results showed that both SF-22 and the control substance could promote the proliferation of HDF-1, and the effect of SF-22 was similar to that of the control substance (see the Hacat proliferation results). Figure 6 ).

[0080] 3.4 Fibroblast collagen metabolism experiment

[0081] HDF-1 cells were resuspended in 10% FBS DMEM medium and added to 96-well plates at 3E5 / well. After the cells adhered, samples of different concentrations diluted with 0.1% FBS DMEM medium were added, mixed thoroughly, and placed in a 37°C incubator. After 24 hours, RNA was extracted and reverse transcribed to obtain cDNA for qPCR experiments. The results showed that SF-22 and competitors both promoted the metabolism of collagen I / III / VII (COL-1, COL-3, COL-7). Among them, SF-22 had a better promoting effect than the control Xingyue in collagen VII metabolism, and the control Xingyue had a slightly better promoting effect than SF-22 in collagen I / III metabolism (see collagen metabolism results). Figure 7 ).

Claims

1. A recombinant silk fibroin, characterized in that The amino acid sequence of the recombinant silk fibroin is shown in SEQ ID NO:

3.

2. A polynucleotide, characterized in that The polynucleotide encodes the recombinant silk fibroin according to claim 1.

3. The polynucleotide according to claim 2, wherein The sequence of the polynucleotide is shown in SEQ ID NO:

4.

4. A recombinant expression vector, characterized in that: The recombinant expression vector comprises the polynucleotide according to claim 2 or 3.

5. A transformant, characterized in that: The transformant expresses the recombinant silk fibroin according to claim 1, or comprises the polynucleotide according to claim 2 or 3, or comprises the recombinant expression vector according to claim 4; the transformant is not an animal species or a plant species.

6. The transformant according to claim 5, wherein The transformant is a eukaryotic cell or a prokaryotic cell.

7. The transformant according to claim 6, wherein The eukaryotic cells are selected from Pichia pastoris and Saccharomyces cerevisiae; and the prokaryotic cells are selected from Bacillus subtilis and Escherichia coli.

8. The transformant according to claim 7, wherein The Pichia pastoris is GS115 cells.

9. A genetically engineered bacterium expressing recombinant silk fibroin, characterized in that: The starting strain of the genetically engineered bacteria is Pichia pastoris, and the genetically engineered bacteria comprises the polynucleotide according to claim 2 or 3.

10. Use of the recombinant silk fibroin according to claim 1, the polynucleotide according to claim 2 or 3, the recombinant expression vector according to claim 4, the transformant according to any one of claims 5 to 8, or the genetically engineered bacteria according to claim 9 in the preparation of an agent for promoting skin repair or skin firming and anti-wrinkle.

11. A composition, characterized in that The composition comprises the recombinant silk fibroin according to claim 1, the polynucleotide according to claim 2 or 3, the recombinant expression vector according to claim 4, the transformant according to any one of claims 5 to 8, or the genetically engineered bacteria according to claim 9, as well as carriers and / or excipients.

12. The composition according to claim 11, wherein The composition is a cosmetic composition, a wound dressing composition or a wound repair composition.

13. A method for preparing recombinant silk fibroin, characterized in that: The method comprises: The genetically engineered bacteria as claimed in claim 9 are sequentially subjected to induced expression and induced culture.

14. The method according to claim 13, wherein The induced expression is to culture in YPD medium and then inoculate into BMGY medium for culture at 30°C and 220 rpm; The induction culture is carried out in BMMY medium with the addition of methanol, the culture conditions are 30° C., 220 rpm, and the final concentration of methanol is 1%, where the % is the volume percentage.

Images