Chlamydosporium sp. And application thereof

Abstract

The invention belongs to the technical field of microbial screening, and particularly relates to a strain of byssochlamydos sp. And application thereof, and the preservation number of the byssochlamydos sp. Is CGMCC (China General Microbiological Culture Collection Center) No.40543. The invention also relates to a preparation method of the byssochlamydos sp. When being used for solid-state fermentation of pinellia ternate, the chlamydosporium sp. Can improve digestion-aiding ability of pinellia ternate, reduce toxicity of pinellia ternate, increase content of active components capable of calming and relieving cough, such as amino acid, alkaloid and flavone, and increase content of anti-cancer components; when the fermentation medium is used for liquid-state fermentation of pinellia ternate, compared with traditional fermentation, total acid is increased, and soluble solids are increased; meanwhile, the chlamydomonas sp. Is stable in fermentation and can also be used for preparing feed containing mint fragrance.

Description

Technical Field

[0001] The present invention belongs to the technical field of microorganism screening, and particularly relates to a Byssochlamys sp. and its application. Background Art

[0002] Pinellia ternata is one of the precious traditional Chinese medicines. After microbial fermentation, its organic acids and nucleoside substances are significantly improved, the irritation to the oral cavity is reduced, and the flavor and digestion-promoting functions are increased after fermentation of the raw materials. The traditional fermentation method of Pinellia ternata is natural mixed bacteria fermentation, which requires six-spice medicated leaven as an inoculant to initiate fermentation. The quality of the six-spice medicated leaven used determines the fermentation cycle and quality of Pinellia ternata. At present, the quality of six-spice medicated leaven on the market is uneven, and Pinellia ternata depends on six-spice medicated leaven in the production process, often resulting in poor stability of Pinellia ternata and a low qualified rate. Also, due to the complex and variable nature of the mixed fermentation system, it is difficult to establish means and techniques for quality monitoring and detection, making the application effect of Pinellia ternata unstable.

[0003] The safety of using six-spice medicated leaven has been verified for hundreds of years and has important application value in the production process of Pinellia ternata. At present, multifunctional bacteria and fungal genera such as Bacillus subtilis with high amylase production, Saccharomycopsis fibuligera, Lichtheimia ramosa, and Pichia burtonii that can be used for the fermentation of Pinellia ternata have been isolated from six-spice medicated leaven. However, so far, the understanding of the roles of these microorganisms in the fermentation process of Pinellia ternata is still limited.

[0004] Research shows that Bacillus subtilis, Aspergillus, Paecilomyces, etc. in Pinelliae Rhizoma Praeparatum or Liushenqu are related to the promotion of the production of active substances such as polysaccharides and organic acids, and some species have been isolated and purified for use in the pure bacteria fermentation and processing of Pinelliae Rhizoma. Bacillus subtilis and Aspergillus are superior enzyme-producing genera commonly found in various fermented starters, especially the most common in Chinese liquor Daqu. In recent years, these genera have also been found in the analysis of the microbial flora of traditional Chinese medicine starters. For example, Guo Jiajia et al. (Guo Jiajia, Su Mingsheng, Wang Liyuan, et al. Identification of dominant microorganisms during the processing of Pinelliae Rhizoma Praeparatum [J]. China Journal of Chinese Materia Medica, 2016, 41(16)) isolated Meyerozyma guilliermondii, Aspergillus niger, Bacillus subtilis, etc. from Pinelliae Rhizoma Praeparatum, all of which are the main dominant strains in the fermentation of the starter. Liang Qi (Liang Qi. Fermentation technology, isolation and identification of dominant strains and pure culture fermentation research of modified Pinelliae Rhizoma Praeparatum [D]. Hunan Agricultural University, 2019.) also isolated Aspergillus with high enzyme activity from modified Pinelliae Rhizoma Praeparatum. Chen Yanlin et al. (Chen Yanlin, Wang Yunting, Guan Kaile, et al. Study on the microbial community structure during the fermentation of Liushenqu [J]. China Journal of Chinese Materia Medica, 2020, 45(21):7) found that Saccharomycopsis fibuligera and Rhizopus oryzae are the main sources of fermentation power in commercially available Liushenqu. So far, there is still a lack of understanding of the changes in the microbial flora structure and fermentation characteristics in Pinelliae Rhizoma Praeparatum, and no strains with good performance have been isolated for use in the pure bacteria fermentation of Pinelliae Rhizoma Praeparatum.

[0005] On the other hand, due to the inconsistent quality of Liushenqu products from different regions or even different batches of the same enterprise, the quality of Pinelliae Rhizoma Praeparatum varies greatly. And Pinelliae Rhizoma Praeparatum uses a natural mixed bacteria inoculation method and open fermentation, resulting in structural differences in the dominant microorganisms in the starter due to differences in environmental air microorganisms, temperature and humidity, etc. Therefore, it is easy to cause fluctuations in the quality of different batches of products and difficult to achieve standardized production. Summary of the Invention

[0006] In order to obtain a dominant strain with reduced toxicity and enhanced efficacy for use in the pure bacteria fermentation of Pinelliae Rhizoma Praeparatum and improve the stability of Pinelliae Rhizoma Praeparatum products, the present invention provides a Byssochlamys sp. screened and isolated from the fermentation process of Pinelliae Rhizoma Praeparatum in the workshop of Sichuan Ya'an Xunkang Pharmaceutical Co., Ltd.

[0007] The Byssochlamys sp. described in the present invention has a preservation number of: CGMCC No. 40543, and was preserved on March 29, 2023 at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, with a postal code of 100101.

[0008] The physiological characteristics of the above-mentioned *Byssochlamys* are as follows: after culturing on a PDA solid medium at 35 °C for 48 h, it forms a white hairy edge, a yellow circular center with a certain color difference from the surrounding area, dark brown on the back, not easily picked up, and has no obvious odor; the spores are oval, clustered in chains, with many branches around the main spore stalk, the branched phialides are curved, and there is only a bunch of fine branches at its top.

[0009] The formula of the PDA solid medium is as follows: 200 g of potato, 20 g of glucose, 20 g of agar, 1 L of water, 0.1 g of chloramphenicol, sterilized at 121 °C for 15 min.

[0010] The growth conditions of the above-mentioned *Byssochlamys* are as follows: temperature 35-38 °C, pH 6.0-7.0; more preferred growth conditions are 35 °C, pH 6.0-7.0, it can tolerate contamination by miscellaneous bacteria, and can cover the culture substrate within 24-36 h under suitable conditions.

[0011] The above-mentioned *Byssochlamys* includes the following IST1 and IST4 partial amplification sequences:

[0012] SEQ ID NO:1: IST1

[0013] CACTTGCGTACGGATACGTCGAGGGACTGCAAGATGTCATTGGAGGGGGGGGGGGCCCCCCGCCGCCCCCAACAAAAAACGCGGTTGGCCGGAGGGGGGTTCAACCCCCCCGGCCCAAAACCGCCGAAGACCCCTGGAACGCTGCCTGGAAGGTTGCCGTCTGAGTATACAATCAATCAATTAAAACTTTCAACAACGGATCTCTTGGTTCCGGGATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGCATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTAACCCTCCAGCCCGGCTGGTGTGTTGGGCCGCCGTCCCCCCTCCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCGTCGCGTCCGGTCCTCGAGCGTATGGGGCTCTGTCACACGCTTCAGTAGAACCGGCCGGCTTGCTGGCCATCACCTATATTTTTCTCTTAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAA。

[0014] SEQ ID NO:2: IST4

[0015] GGGCCCTTCGTACGTACCTGATCCGAGGTCACCTAAGAGAAAAATATAGGTGATGGCCAGCAAGCCGGCCGGTTCTACTGAAGCGTGTGACAGAGCCCCATACGCTCGAGGACCGGACGCGACGCCGCCGCTGCCTTTCGGGCCCGTCCCCCGGGGAGGGGGGACGGCGGCCCAACACACCAGCCGGGCTGGAGGGTTAGCAATGACGCTCGGACAGGCATGCCCCCCGGAATGCCAGGGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACGGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCGGAACCAAGAGATCCGTTGTTGAAAGTTTTAATTGATTGATTGTATACTCAGACGGCAACCTTCCAGGCAGCGTTCCAGGGGTCTTCGGCGGGCGCGGGCCCGGGGGCGTGAACCCCCCGGCGGCCGGGGCGTGAACCACGGCGGGCCCGCCGAAGCAACAGGTGTCAGGACAACACGGATGGGAGGTTGGGCCCCGAGGGACCCTCACTCGGTAATGATCCTTCCGCAGGTTCACCTACGGAAG。

[0016] The application of the above-mentioned Byssochlamys fulva in the solid-state or liquid-state fermentation of traditional Chinese medicine.

[0017] Preferably, the traditional Chinese medicine is selected from at least one of Pinelliae Rhizoma and Qingbanxia.

[0018] Preferably, the conditions for liquid fermentation are: the fermentation temperature is 33 °C, the inoculum amount is 6%, the ratio of material to liquid is 1:4, the rotation speed is 60 r / min, and the fermentation time is 72 h.

[0019] The application of the above-mentioned Byssochlamys fulva in the preparation of Banxia Qu and Liushen Qu.

[0020] The use of the above-mentioned Byssochlamys fulva in the fermentation production of feed.

[0021] Preferably, the feed raw materials include at least one of bran, flour, and Polygonum hydropiper L.

[0022] The application of the above-mentioned Byssochlamys fulva in the fermentation preparation of substances producing mint flavor, and the raw materials of the substances producing mint flavor include Polygonum hydropiper L.

[0023] Beneficial effects: A strain of Byssochlamys sp. was screened and isolated from the fermentation workshop of Sichuan Ya'an Xunkang Pharmaceutical Co., Ltd. Its preservation number is: CGMCC No. 40543.

[0024] 1. The Byssochlamys of the present invention is a fungus, isolated from the Pinellia ternata fermentation process, well adapted to the Pinellia ternata environment, and can quickly form a growth advantage in the Pinellia ternata fermentation substrate. Visible vigorous growing hyphae can be formed within 48 hours, while the traditional fermentation method generally takes 72 hours.

[0025] 2. The Byssochlamys of the present invention can improve the digestive ability of Pinellia ternata fermented medicated leaven. Compared with traditional mixed bacteria fermentation, the amylase activity of the Pinellia ternata fermented medicated leaven obtained by its fermentation is as high as 26% - 41%, and the protease activity is as high as 15% - 23%.

[0026] 3. The Byssochlamys fermentation of Pinellia ternata of the present invention can reduce the toxicity of Pinellia ternata. After fermenting Pinellia ternata, the calcium oxalate content decreases by 12% - 18%, reducing the irritation of calcium oxalate raphides in Pinellia ternata to the mucosa, achieving detoxification. The mannose content increases by 50%, and mannose can bind to the agglutinin that causes inflammation in Pinellia ternata (with a content between 2.6% - 4.1%), thereby reducing the toxicity of Pinellia ternata.

[0027] 4. The Byssochlamys fermentation of Pinellia ternata of the present invention can significantly increase the content of active components such as amino acids, alkaloids, and flavonoids for relieving cough and suppressing vomiting. The relative content increases by more than 10 times; the content of polysaccharides for relieving vomiting changes little, and the total organic acid content increases by 20 times. It is found that the content of other medicinally valuable components also increases significantly. For example, the anticancer component vitexin increases by more than 340 times. Fermentation with this fungus can effectively improve the quality of Pinellia ternata fermented medicated leaven.

[0028] 5. The Byssochlamys of the present invention has good stability, is suitable for solid - state fermentation and liquid - state fermentation environments, and the performance of liquid - state fermentation is superior to that of solid - state fermentation, providing the possibility for the development of modern pure - bacteria fermentation technology for Pinellia ternata fermented medicated leaven.

[0029] 6. The Byssochlamys of the present invention can be used for fermenting and producing feed. When fermenting and producing feed containing Polygonum hydropiper, it can produce a mint - flavored aroma. Description of the drawings

[0030] Figure 1 It is the colony morphology of the Byssochlamys of the present invention producing asexual spores after culturing on PDA solid medium at 35°C for 48 hours;

[0031] Figure 2 It is the feedback diagram of the calcium oxalate raphides stimulating the rabbit eye membrane in Example 2 of the present invention, where A: unfermented Pinellia ternata substrate; B: traditionally fermented Pinellia ternata fermented medicated leaven; C: Byssochlamys - fermented Pinellia ternata fermented medicated leaven;

[0032] Figure 3Substances with significant differences after solid-state fermentation of Pinellia ternata by Byssochlamys fulva in Example 2 of the present invention. In the figure, "hun" refers to the fermentation substrate mixed with the strain, "yuan" refers to the raw material without inoculating the strain, "a" is small peptide; "b" is fatty acid; "c" is flavonoid; "d" is organic acid; "e" is total sugar;

[0033] Figure 4 The Byssochlamys fulva seed culture prepared with bran + flour + Polygonum hydropiper in Example 4 of the present invention;

[0034] Figure 5 The Byssochlamys fulva seed culture prepared with pure bran in Example 4 of the present invention;

[0035] Figure 6 The Byssochlamys fulva seed culture prepared with bran + Polygonum hydropiper in Example 4 of the present invention.

[0036] Description of the preservation of Byssochlamys fulva of the present invention: The Byssochlamys fulva of the present invention has a preservation number of: CGMCC No. 40543. It was preserved on March 29, 2023, at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, with a postal code of 100101, and its taxonomic name is Byssochlamys sp. Detailed implementation manners

[0037] The Pinellia ternata planting park in Lushan, Ya'an is the main production area of Pinellia ternata fermented medicinal powder. Due to long-term domestication and selective enrichment, a unique fungal fermentation system has been formed, including fungal resources with special physiological functions. In the present invention, a strain of Byssochlamys fulva (Byssochlamys sp.) was screened and isolated from the fermentation process of fermented Pinellia ternata in the fermentation workshop of Sichuan Ya'an Xunkang Pharmaceutical Co., Ltd., and its preservation number is: CGMCC No. 40543.

[0038] Compared with traditional mixed - strain fermentation, the Byssochlamys fulva of the present invention can improve the digestive ability of Pinellia tuber fermented product. The amylase activity of the Pinellia tuber fermented product obtained by its fermentation is as high as 26% - 41%, and the protease activity is as high as 15% - 23%. The Byssochlamys fulva of the present invention can reduce the toxicity of Pinellia tuber when fermenting Pinellia tuber. After fermentation, the calcium oxalate content decreases by 12% - 18%, reducing the irritation of calcium oxalate raphides in Pinellia tuber to the mucosa, thus achieving detoxification. The mannose content increases by 50%, and mannose can bind to the agglutinin causing inflammation in Pinellia tuber (the content is between 2.6% - 4.1%), thereby reducing the toxicity of Pinellia tuber. The Byssochlamys fulva of the present invention can significantly increase the content of active components such as amino acids, alkaloids, and flavonoids with sedative and cough - relieving effects, and the relative content increases by more than 10 times; the content of anti - vomiting polysaccharides changes little, and the total organic acid content increases by 20 times. It is also found that the content of other medicinally valuable components also increases significantly. For example, the anticancer component vitexin increases by more than 340 times. Fermentation with this fungus can effectively improve the quality of Pinellia tuber fermented product. The Byssochlamys fulva of the present invention has good stability, is suitable for solid - state fermentation and liquid - state fermentation environments, and the performance of liquid - state fermentation is better than that of solid - state fermentation, providing the possibility for the development of modern pure - strain fermentation technology for Pinellia tuber fermented product.

[0039] More particularly, the Byssochlamys fulva of the present invention can be used for fermenting and producing feed. When fermenting and producing feed containing Polygonum hydropiper, it can produce a mint - flavored aroma.

[0040] The solutions of the present invention will be explained below in conjunction with examples. Those skilled in the art will understand that the following examples are only for illustrating the present invention and should not be regarded as limiting the scope of the present invention. For those not specified in the examples regarding specific techniques or conditions, they shall be carried out according to the techniques or conditions described in the literature in this field or according to the product specifications. For reagents or instruments not specified as to the manufacturer, they are all conventional products that can be obtained through commercial purchase.

[0041] The following are the medium formulations used in the following examples:

[0042] The formulation of PDA solid medium is: 200 g of potato, 20 g of glucose, 20 g of agar, 1 L of water, 0.1 g of chloramphenicol, sterilized at 121 °C for 15 min.

[0043] The formulation of PDA slant medium: 200 g of potato, 20 g of glucose, 20 g of agar, 1 L of water, 0.1 g of chloramphenicol, sterilized at 121 °C for 15 min.

[0044] Example 1 Isolation, screening and identification of the Byssochlamys fulva of the present invention

[0045] Collect the fermented Pinelliae Rhizoma Praeparatum for 24 hours from the fermentation workshop of Sichuan Ya'an Xunkang Pharmaceutical Co., Ltd. The specific collection steps are as follows: Crush raw Pinelliae Rhizoma, alum, and Six-Flavored Medicinal Leaven with a pulverizer, and sieve with an 80-mesh sieve for later use. Weigh ginger, add an equal weight of water to squeeze juice, filter out the ginger residue, and dilute the ginger juice with 3 times its weight of water for later use. Mix evenly according to the mass ratio of raw Pinelliae Rhizoma, ginger juice, flour, alum, and Six-Flavored Medicinal Leaven of 32:4:6.4:2:1 to make a fermentation substrate. Loosely spread the fermentation substrate on a tray with a thickness of 1 cm, a fermentation temperature of 35 - 36 °C, and a humidity of 80% - 85%. Ferment for 72 hours, and collect the fermentation samples of Pinelliae Rhizoma Praeparatum at 0 h, 17 h, 24 h, 48 h, and 71 h with a sample bag. One part is stored at 4 °C for subsequent separation, and one part is frozen at -20 °C and sent to Personalbio for total DNA extraction. Amplify the ITS1 and ITS4 sequences and sequence them. Filter the bases with a tail quality value below 20 and the sequences below 50 bp after quality control from the obtained sequences, then splice them. Screen out the non-conforming sequences according to the maximum mismatch ratio of 0.2. Extract the non-redundant sequences from the optimized sequences. Use the Usearch (version 7.1) software platform (http: / / drive5.com / uparse / ) to classify the non-redundant sequences (excluding single sequences) with a similarity above 97% into 1 operational taxonomic unit (OTU) and cluster them. Remove the chimeras during the clustering process to obtain the representative sequences of OTU. Align all the OTUs obtained by sequencing with the corresponding sequences of the type strains in Genbank (https: / / www.ncbi.nlm.nih.gov / ) to obtain the taxonomic units (including phylum, class, order, family, genus, and species) corresponding to the top 20 dominant species of OTU and their corresponding abundance information. It is found that the abundance of Byssochlamys fulva in the Pinelliae Rhizoma Praeparatum sample fermented for 24 hours exceeds 60%, and it is determined to isolate Byssochlamys fulva from this sample.

[0046] Preparation of the isolation medium: After adding 9 parts of water to 1 part of the fermentation substrate prepared by mixing raw Pinelliae Rhizoma, ginger juice, flour, alum, and Six-Flavored Medicinal Leaven evenly according to the mass ratio of 32:4:6.4:2:1, filter and sterilize it with a 0.22-μm filter, and aseptically collect the filtrate for later use. Sterilize the PDA solid medium at 121 °C for 20 minutes and then cool it to 60 °C. Add 5% of the above filtrate under aseptic conditions to prepare the isolation medium on the plate.

[0047] Isolation and identification: Use an inoculation needle to directly dip into the sample of Pinelliae Rhizoma Praeparatum fermented for 24 hours, and inversely spot-seed it onto the isolation medium. After incubating it in an inverted position at 28°C for 36 hours, pick the spores and purify them onto a new PDA solid medium. Repeat this process 3 times to obtain 8 pure cultures of filamentous fungi. Observe the colony and cell morphology of the 8 molds. By referring to "Manual of Fungal Identification" (written by Wei Jingchao), it is found that 3 of them are highly similar to Byssochlamys fulva. Send these 3 strains to Sangon Biotech in Shanghai to extract their DNA, amplify their ITS1 and ITS4 sequences, and compare the sequences with the corresponding sequences of the type strains in Genbank (https: / / www.ncbi.nlm.nih.gov / ) after sequencing. Since this fungal strain can produce sporangiospores, while Paecilomyces generally produces chlamydospores and conidia, it is identified as Byssochlamys fulva. Figure 1 This is the colony morphology of the asexual spores produced by Byssochlamys fulva of the present invention on the PDA solid medium after culturing at 35°C for 48 hours.

[0048] Inoculate the identified strains onto the above isolation medium, incubate them at 28°C for 36 hours, and then store them at 4°C for 3 months. The sand tube preservation method can also be used for preservation.

[0049] The slant culture was also preserved and sent to the China General Microbiological Culture Collection Center (CGMCC) on March 29, 2023. The preservation number is: CGMCC No. 40543.

[0050] Example 2 Solid-state fermentation of Pinelliae Rhizoma Praeparatum by Byssochlamys fulva of the present invention

[0051] 1. First, inoculate the preserved Byssochlamys fulva strain into the PDA solid medium using an inoculation needle, and culture it at 30°C for 3 days. When the culture dish is fully covered and shows a dark brown color, collect the mature spores using a sterile scraping ring, and then prepare a spore suspension with a concentration of 1×10 8 spores / mL for standby.

[0052] Inoculate the above spore suspension of Byssochlamys fulva strain into the Pinelliae Rhizoma Praeparatum cake (obtained by mixing Qing Banxia, ginger juice, alum, and flour in a ratio of 32∶4∶2∶6.4), and ferment it synchronously with the cake using Liushenqu as the strain (obtained by mixing Qing Banxia, ginger juice, alum, flour, and Liushenqu in a ratio of 32∶4∶2∶6.4∶1) for 72 hours. The fermentation process parameters are a fermentation temperature of 30°C, a material layer thickness of 2 cm, and a water content of 20%. Taking the traditional mixed fermentation of Pinelliae Rhizoma Praeparatum as a control, it is found that the Pinelliae Rhizoma Praeparatum fermented by Byssochlamys fulva of the present invention has a purer color, a significantly reduced sour taste, uniform granulation, and a special fragrance compared to the traditionally fermented Pinelliae Rhizoma Praeparatum.

[0053] 2. Use the pure strain of *Byssochlamys fulva* to solid-state ferment Pinellia tuber for 72 h at 28 °C (the fermentation conditions are the same as above). After the fermentation is completed, measure the protease activity, amylase activity, and total acid of the samples. It is found that the average protease activity of the three batches of fermentation substrates is 61.7 ± 8.4 U / g, the average amylase activity is 123.6 ± 7.5 U / g, and the total acid is 11.4 ± 1.2 mg / g. As shown in Table 1, there are no significant differences in the indicators of the three different batches of Pinellia tuber fermented with this fungus, indicating that the performance of this fungus is very stable.

[0054] Table 1 Process verification results of solid-state fermentation of Pinellia tuber with *Byssochlamys fulva*

[0055]

[0056]

[0057] Note: The same superscript letters indicate that the indicators in the same row do not have significant differences.

[0058] 3. After solid-state fermenting Pinellia tuber with the *Byssochlamys fulva* of the present invention, it is detected that the content of calcium oxalate needle crystals in the Pinellia tuber fermentation substrate decreases from 0.205 g / kg to 0.175 g / kg.

[0059] 4. Rabbit experiment

[0060] Sample solution preparation: Mix Qing Banxia, ginger juice, flour, alum, and Liushenqu in a mass ratio of 32:4:6.4:2:1, make it into fermentation raw materials, and store them frozen for later use; ferment the fermentation raw materials at 28 °C for 72 h to obtain traditional fermented Pinellia tuber, and store them frozen for later use; mix Qing Banxia, ginger juice, flour, and alum in a mass ratio of 32:4:6.4:2, inoculate 5% of the *Byssochlamys fulva* spore suspension (concentration 1×10 8 CFU / g), and ferment at 28 °C for 72 h to make *Byssochlamys fulva* Pinellia tuber, and store them frozen for later use. After thawing the above three kinds of samples, add 9 times the amount of water and vortex to mix evenly, and centrifuge at 1000 r / min for 5 min to obtain three kinds of sample solutions. Mix ginger juice, flour, and alum in a mass ratio of 4:6.4:2, add 9 times the mass of water, vortex to mix evenly, and centrifuge at 1000 r / min for 5 min as the control solution.

[0061] Randomly select 3 rabbits, and each rabbit is used for the test of 1 kind of sample solution. When testing, drop 2 drops of the sample solution into the right eye of the rabbit, and drop 2 drops of the control solution into the left eye. Then gently close the upper and lower eyelids of the rabbit with your hand, and then gently rub the rabbit's eyes to make the medicinal liquid fully contact with the conjunctiva, avoiding the overflow of the medicinal liquid. After rubbing for 3 min, immediately rinse the rabbit's eyes with physiological saline until there is no drug residue in the eyes and there is no abnormality. Subsequently, observe the rabbit's eyes every 0.5 h and score according to the content shown in Table 2.

[0062] Table 2 Sensory scoring table of the corneal irritation of Pinelliae Rhizoma Praeparatum in rabbits

[0063]

[0064] Figure 2 It is the feedback diagram of the stimulation of rabbit eye membranes by calcium oxalate needle crystals. Table 3 shows the detoxification effect of fermenting Pinelliae Rhizoma with Byssochlamys fulva in the present invention. It can be seen from Table 3 that compared with the blank (Pinelliae Rhizoma raw material), the mucosal irritation caused by calcium oxalate needle crystals in Pinelliae Rhizoma after traditional fermentation and fermentation with Byssochlamys fulva has been significantly reduced, and the irritation of Pinelliae Rhizoma Praeparatum after pure bacteria fermentation to the eye mucosa of rabbits is smaller, achieving detoxification. At the same time, it was detected that the content of mannose in the substrate of Pinelliae Rhizoma fermented by Byssochlamys fulva increased by 50%, and these mannoses can bind more agglutinin proteins that cause inflammation in Pinelliae Rhizoma, reducing the toxicity of Pinelliae Rhizoma.

[0065] Table 3 Scoring results of rabbit eye membrane

[0066] Congestion Edema Secretions Total score Traditional fermented Pinelliae Rhizoma preparatum 8 25 30 63 Byssochlamys fermented Pinelliae Rhizoma preparatum 11 20 27 58 Pinellia ternata raw material 18 30 35 83

[0067] 5. After solid-state fermentation of Pinelliae Rhizoma with Byssochlamys fulva in the present invention, it was also detected that, as shown in Table 4, it can significantly increase the content of active components such as amino acids, alkaloids, and flavonoids for relieving cough and calming the nerves. For example, the relative content of norephedrine, which can relieve nasal congestion symptoms, increased by 8 times; the content of polysaccharides for antiemetic changed little, and the total organic acid content increased by about 20 times. Among them, it was found that the content of other medicinal value components also increased significantly. For example, the components with anti-cancer activity, DL-stachydrine, scopolamine, and vitexin, increased by 30 times, 90 times, and 342 times respectively. It can be seen that using this fungal fermentation can effectively improve the quality of Pinelliae Rhizoma Praeparatum.

[0068] Table 4 Effects of solid-state fermentation of Pinelliae Rhizoma with Byssochlamys fulva on the component content of Pinelliae Rhizoma

[0069]

[0070]

[0071] 6. After solid-state fermentation of Pinelliae Rhizoma with Byssochlamys fulva in the present invention, the contents of organic acids, fatty acids, and flavonoids have been significantly improved, as Figure 3 shown. The production of organic acids generally increased. For example, 3-hydroxybutyric acid with neuroactivity increased by 21 times, and the content of phosphatidylcholine with anti-inflammatory effect in fatty acids increased by 13 times. Figure 3 Among them, hun refers to the fermentation substrate mixed with this strain; yuan refers to the raw material without inoculating this strain, that is, the prepared Qingbanxia fermentation material according to the formula.

[0072] Example 3 Liquid fermentation of Pinelliae Rhizoma Praeparatum with Byssochlamys fulva in the present invention

[0073] In the applicant's previous experiments, it was found that the effects of various technological parameters of liquid fermentation on fermentation were as follows: fermentation temperature > inoculum size > liquid-to-solid ratio > rotation speed > fermentation time. Through orthogonal experimental design, the process for liquid fermentation of Pinelliae Rhizoma Praeparatum by Byssochlamys fulva was obtained: the fermentation temperature was 33°C, the inoculum size was 6%, the liquid-to-solid ratio was 1:4, the rotation speed was 60 r / min, and the fermentation time was 72 h. Pinelliae Rhizoma Praeparatum was fermented in 3 batches according to the above technological parameters, and the protease activity, total acid, and soluble solids in the samples were measured. The results are shown in Table 5. It can be seen that the process for liquid fermentation of Pinelliae Rhizoma Praeparatum by pure Byssochlamys fulva bacteria is stable. Compared with traditional fermentation, the total acid increased slightly, the soluble solids increased, and the product was more pure in appearance and conducive to preservation.

[0074] Table 5 Fermentation of Pinelliae Rhizoma Praeparatum by Byssochlamys fulva

[0075]

[0076] Example 4 Fermentation of feed by Byssochlamys fulva of the present invention

[0077] The bran, flour, and Polygonum hydropiper were pulverized and sieved through an 80-mesh fine sieve, and then mixed evenly and sterilized according to the mass ratio of bran:flour:Polygonum hydropiper powder of 3:2:1. After sterilization, 3 times the weight of sterile water was added to moisten the culture medium to a state where it could be formed into a ball by squeezing and scattered when tossed. Then, the strain was inoculated from the PDA slant medium into the above bran medium (bran:flour:Polygonum hydropiper powder 3:2:1) with an inoculation needle and cultured at 32°C for 2 days. The surface of the koji cake was grayish-green, the color distribution of the cross-section was uniform, the white hyphae in the middle were strong and densely distributed, with a fragrance of mint and bran, and the texture was soft and compact, as Figure 4 shown. Its α-amylase activity was as high as 43.85 U / g, which was about twice that of the peak of pure bacteria fermentation of Pinelliae Rhizoma Praeparatum, but there was no obvious protease activity, probably due to the lack of stimulating factors in the raw materials. At the same time, pure bran ( Figure 5 ), bran + flour 2:1, and bran + Polygonum hydropiper 5:1 ( Figure 6 ) were used for pure bacteria fermentation of Byssochlamys fulva at 32°C for 48 h, and it was found that their amylase activities were 43.89 U / g, 41.52 U / g, and 43.15 U / g respectively. The research found that it was suitable for the feed fermentation industry, and the koji cake produced a minty aroma after adding Polygonum hydropiper.

Claims

1. Byssochlamys sp., characterized in that: The preservation number is: CGMCC No. 40543.

2. Use of the Thamnidium elegans as claimed in claim 1 in the solid or liquid fermentation of traditional Chinese medicine.

3. The application according to claim 2, characterized in that: The traditional Chinese medicine is selected from at least one of Pinellia ternata and processed Pinellia ternata.

4. The application according to claim 2, wherein: The conditions for liquid fermentation are: the fermentation temperature is 33 °C, the inoculum amount is 6%, the ratio of material to liquid is 1:4, the rotation speed is 60 r / min, and the fermentation time is 72 h.

5. Use of the Thamnidium elegans as claimed in claim 1 in the preparation of Banxia Qu and Liushen Qu.

6. Use of the Thamnidium elegans as claimed in claim 1 in the fermentation production of feed.

7. The application according to claim 6, wherein: The feed raw materials include at least one of wheat bran, flour, and Polygonum hydropiper.

8. Use of the Thielavia fimeti as claimed in claim 1 in the fermentation for preparing a substance with a minty aroma, characterized in that: The raw material for the substance producing a minty aroma includes Polygonum hydropiper.

Images