Chaetomium globosum NCCG-2 and application thereof

Abstract

The invention discloses chaetomium globosum NCCG-2 and application thereof, and belongs to the technical field of microorganisms. The chaetomium globosum NCCG-2 is preserved in the China General Microbiological Culture Collection Center (CGMCC), and the preservation number is CGMCC: 40316. The chaetomium globosum NCCG-2 and the fermentation liquor thereof can inhibit various crop pathogenic bacteria. Compared with a reported chaetomium globosum strain, the chaetomium globosum NCCG-2 provided by the invention is a rice endophyte and has the advantage of host adaptability; meanwhile, the bacillus subtilis has triple functions of broad-spectrum bacteriostasis, soil micro-ecological regulation and control and crop growth promotion, breaks through the targeting limitation of a single crop, shows application potential in rice, oil plants and economic crops, and provides a multifunctional germplasm resource for developing biopesticides and microbial fertilizers.

Description

Technical Field

[0001] The present invention relates to the technical field of microorganisms, and particularly to a strain of Chaetomium globosum NCCG-2 and its applications. Background Art

[0002] Plant diseases seriously threaten crop growth and food security. Traditional chemical pesticides, once the main means to combat plant diseases, effectively controlled the spread of diseases in the short term. However, their long-term overuse has caused a series of intractable problems - pathogenic bacteria have generated drug-resistant populations through gene mutations; pesticide residues have accumulated along the food chain, and pesticide components have been detected in surface water, soil, and even polar organisms; non-target organisms such as pollinating insects and soil microorganisms in farmland ecosystems have been greatly reduced, and the ecological balance has been disrupted. These dilemmas have forced the agricultural field to urgently seek more sustainable disease prevention and control solutions.

[0003] In this context, the concept of using microorganisms for biological control has gradually become the research focus. Biocontrol microorganisms are regarded as an ideal alternative to chemical pesticides due to their strong specificity, environmental friendliness, and difficulty in inducing resistance. As a representative group among them, the fungus Chaetomium globosum can secrete various antibacterial substances such as chitinase and β-1,3-glucanase to inhibit the growth of pathogenic bacteria, and at the same time promote crop development by producing plant hormones or improving the root microenvironment, showing dual application values in the fields of biological control and plant growth promotion. In recent years, many strains of Chaetomium globosum have been isolated from habitats such as soil and the rhizosphere of plants, and their biocontrol effects have been verified in the prevention and control of diseases of crops such as cucumbers and tomatoes, providing a new technical path for green agricultural production.

[0004] However, the currently developed strains of Chaetomium globosum still have obvious defects in practical applications. Most strains only have inhibitory effects on one or a few pathogenic bacteria, and often cannot achieve the expected results in the face of complex disease multiple infections in the field; some strains are restricted in growth under abiotic stress conditions such as extreme temperatures, high salinity, or low nutrition, and it is difficult to stably colonize in different regions or farmlands with serious continuous cropping obstacles; in addition, the yield and activity of the metabolites of the strains are easily affected by environmental factors, resulting in large fluctuations in field control effects. These problems of single function and insufficient environmental adaptability have greatly restricted the large-scale popularization and application of Chaetomium globosum in agricultural production. It is urgent to screen high-quality strains and optimize their functions to develop biocontrol germplasm resources with broad-spectrum disease resistance and strong environmental adaptability. Summary of the Invention

[0005] The object of the present invention is to provide a strain of Chaetomium globosum NCCG-2 and its applications to solve the problems existing in the above-mentioned prior art. The Chaetomium globosum NCCG-2 provided by the present invention is an endophyte of rice and has the advantage of host adaptability; at the same time, it has three functions of broad-spectrum antibacterial, soil microecological regulation and crop growth promotion, breaking through the limitation of single crop targeting, and showing application potential in rice, oil crops and cash crops, providing a multifunctional germplasm resource for the development of biological pesticides and microbial fertilizers.

[0006] To achieve the above object, the present invention provides the following solutions:

[0007] The present invention provides a strain of Chaetomium globosum NCCG-2, which is preserved in the General Microbiological Center of the China Committee for Culture Collection of Microorganisms, and the preservation number is CGMCC: 40316.

[0008] The present invention also provides a microbial inoculum, which comprises the above-mentioned Chaetomium globosum NCCG-2 and / or its fermentation products.

[0009] The present invention also provides an application of the above-mentioned Chaetomium globosum NCCG-2 or the above-mentioned microbial inoculum in inhibiting crop pathogenic bacteria, which is characterized in that the crop pathogenic bacteria include Colletotrichum gloeosporioides, Fusarium oxysporum, Pythium ultimum, Macrophomina phaseoli Ashby, Phomopsis asparagi (Sacc.) Bubak, Pyricularia grisea (Cooke) Sacc., Verticillium dahliae, Phytophthora capsici, Fusarium fujikuroi, Sclerotium rolfsii Sacc., Sclerotium rolfsii, Macrophomina phaseolina, Fusarium solani (Mart.) Sacc. and Fusarium graminearum.

[0010] Optionally, the Chaetomium globosum NCCG-2 can inhibit Colletotrichum gloeosporioides, Fusarium oxysporum, Macrophomina phaseolina, Phomopsis asparagi, Pyricularia grisea, Verticillium dahliae, Phytophthora capsici, Fusarium fujikuroi, Sclerotium rolfsii, Rhizoctonia solani, Fusarium solani and Fusarium graminearum.

[0011] Optionally, the spore-producing culture medium components of the Chaetomium globosum NCCG-2 include rice straw, rice bran and corn flour, and the mass ratio of the rice straw, rice bran and corn flour is 5:2.5:2.5.

[0012] Optionally, the fermentation broth of the Chaetomium globosum NCCG-2 can inhibit Colletotrichum gloeosporioides, Fusarium oxysporum, Pythium ultimum, Macrophomina phaseolina, Phomopsis asparagi, Pyricularia grisea, Verticillium dahliae, Phytophthora capsici, Fusarium fujikuroi, Sclerotium rolfsii, Rhizoctonia solani, Fusarium solani and Fusarium graminearum; the Sclerotium rolfsii is Sclerotium rolfsii.

[0013] The present invention also provides an application of the Chaetomium globosum NCCG-2 or the microbial inoculum in preventing and treating crop diseases, and the crop diseases include citrus anthracnose, peanut root rot, sesame stem blight, asparagus stem blight, rice blast, cotton verticillium wilt, pepper phytophthora blight, rice bakanae disease, pepper southern blight, white rot of Stephania tetrandra, sesame root rot, rice sheath blight, peanut root rot and rice damping-off.

[0014] The present invention also provides an application of the Chaetomium globosum NCCG-2 or the microbial inoculum in promoting the growth of rice, and the promotion of rice growth includes increasing the seedling height of rice, increasing the number of rice roots and promoting the thickening of the main root.

[0015] The present invention also provides an application of the Chaetomium globosum NCCG-2 or the microbial inoculum in preventing and treating peanut brown spot, peanut black spot and peanut leaf spot.

[0016] The present invention also provides an application of the Chaetomium globosum NCCG-2 or the microbial inoculum in preventing and treating the root rot and stem rot of Huangju.

[0017] The present invention discloses the following technical effects:

[0018] The Chaetomium globosum NCCG-2 provided by the present invention not only exhibits significant inhibitory activity against Pyricularia grisea (Cooke) Sacc. (the control efficacy reaches over 80%), but also breaks through the limitations of the functions of the existing Chaetomium globosum. Experiments show that this strain has a broad-spectrum inhibitory effect on 15 pathogenic fungi of important crops, including Colletotrichum gloeosporioides (the causal agent of citrus anthracnose), Phomopsis asparagi (Sacc.) Bubak (the causal agent of asparagus stem blight), Botrytis cinerea (the causal agent of tomato gray mold), Fusarium fujikuroi (the causal agent of bakanae disease of rice), Verticillium dahliae (the causal agent of cotton verticillium wilt), etc. The antibacterial spectrum covers multiple groups such as Ascomycetes, Basidiomycetes and Deuteromycetes. Further research finds that Chaetomium globosum NCCG-2 can directionally regulate the soil microbial community structure, significantly inhibit soil-borne pathogens such as Fusarium spp., and at the same time promote the proliferation of beneficial microorganisms, forming a disease-suppressive microecology. In addition, this strain can significantly increase the biomass of rice seedlings and strengthen the roots, achieving the synergistic effect of disease prevention and growth promotion. In field trials, its control efficacies against peanut brown spot, black spot and leaf spot are 83.62%, 81.72% and 89.63% respectively, and the control efficacies against root rot and basal stem rot of chrysanthemum morifolium Ramat. are both over 70%, showing the characteristics of cross-crop and multi-target application.

[0019] Compared with the reported Chaetomium globosum strains, the Chaetomium globosum NCCG-2 provided by the present invention is an endophyte of rice and has the advantage of host adaptability; at the same time, it has three functions: broad-spectrum antibacterial, soil microecology regulation and crop growth promotion, breaks through the limitation of single-crop targeting, and shows application potential in rice, oil crops and cash crops, providing a multi-functional germplasm resource for the development of biological pesticides and microbial fertilizers. Brief Description of the Drawings

[0020] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required to be used in the embodiments. Obviously, the drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can be obtained based on these drawings.

[0021] Figure 1 It is a diagram of the colony morphology (A) and spore morphology (B) of Chaetomium globosum NCCG-2;

[0022] Figure 2 It is a phylogenetic tree diagram of ITS molecular identification of Chaetomium globosum NCCG-2;

[0023] Figure 3 Confrontation culture results of Chaetomium globosum NCCG-2 against 15 kinds of crop pathogenic fungi;

[0024] Figure 4 Antibacterial effect diagram of the fermentation broth of Chaetomium globosum NCCG-2 against 15 kinds of crop pathogenic fungi;

[0025] Figure 5 Diagram of the growth promotion effect of Chaetomium globosum NCCG-2 on rice seedlings. Among them, A is the diagram of the influence of Chaetomium globosum NCCG-2 on the seedling height, and B is the diagram of the influence of Chaetomium globosum NCCG-2 on the seedling roots;

[0026] Figure 6 Control effect diagram of the prevention and treatment of rice blast by colonizing the soil with live Chaetomium globosum NCCG-2;

[0027] Figure 7 Control effect diagram of the prevention and treatment of rice blast by spraying the fermentation broth of Chaetomium globosum NCCG-2;

[0028] Figure 8 Diagram of the inhibitory and regulatory effect of Chaetomium globosum NCCG-2 on harmful soil microorganisms;

[0029] Figure 9 Field control effect diagram of Chaetomium globosum NCCG-2 on the main diseases of peanut leaves;

[0030] Figure 10 Field control effect diagram of Chaetomium globosum NCCG-2 on root rot and stem rot of Wuyuan Huangju. Detailed implementation manners

[0031] Now, various exemplary implementation manners of the present invention will be described in detail. This detailed description should not be considered as a limitation of the present invention, but should be understood as a more detailed description of certain aspects, characteristics, and implementation schemes of the present invention.

[0032] It should be understood that the terms described in the present invention are only for describing specific implementation manners and are not used to limit the present invention. In addition, for the numerical ranges in the present invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Each intermediate value within any stated value or stated range, as well as each smaller range between any other stated value or intermediate value within the stated range, is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded from the range.

[0033] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Although this invention only describes preferred methods and materials, any methods and materials similar or equivalent to those described herein can also be used in the practice or testing of this invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials related to those documents. In case of conflict with any incorporated document, the content of this specification shall prevail.

[0034] Without departing from the scope or spirit of this invention, various improvements and changes can be made to the specific embodiments of the description of this invention, which will be obvious to those skilled in the art. Other embodiments obtained from the description of this invention will be obvious to those skilled in the art. The description and examples of this invention are merely exemplary.

[0035] Regarding the use of "comprising", "including", "having", "containing", etc. in this article, they are all open-ended terms, meaning including but not limited to.

[0036] Example 1 Isolation and Identification of Chaetomium globosum NCCG-2

[0037] 1. Isolation of Chaetomium globosum NCCG-2

[0038] The tissue isolation method was adopted. The panicle neck segments at the initial booting stage of the rice resistant variety "Tetep" were collected in the field, brought back to the laboratory, rinsed 2 - 3 times with clean water, and air-dried. On a sterile operating table, the panicle necks were cut into spike segments about 1 - 2 cm long with sterilized surgical scissors for later use. The surface was disinfected with 0.1% mercuric chloride solution for 45 seconds, then disinfected with 75% alcohol for 90 seconds, transferred to sterile water and rinsed 3 times, placed on sterilized filter paper to absorb water and air-dried. The small spike segments were picked up with forceps and inoculated onto PDA medium and cultured at 28°C for 3 - 4 days. When hyphae grew from the edges of the cut small spike segments, the edge hyphae were picked and transferred to a new PDA medium for purification culture. Finally, an endophytic bacterium of rice was obtained and denoted as strain NCCG-2.

[0039] 2. Morphological Identification of Chaetomium globosum NCCG-2

[0040] The strain NCCG-2 was inoculated onto a PDA plate and cultured at 28°C for 5 days to observe the colony morphology and color. The spores of the strain NCCG-2 in the petri dish were washed off with clean water, and a spore suspension was obtained by filtering through three layers of gauze. The color, morphology, and size of the spores were observed under a 10×40 optical microscope.

[0041] The culture results of the strain NCCG-2 showed that the mycelia on the PDA were initially white and later light brown ( Figure 1A). Optical microscope observation showed that the perithecia were grayish brown to olive brown, medium-sized, scattered or aggregated, ovoid; attached to the substrate by many dark olive brown root-like structures; the ascospores were lemon-shaped, dark brown to olive brown ( Figure 1 B).

[0042] 3. Molecular identification of Chaetomium globosum NCCG-2

[0043] Using ITS1 (TCCGTAGGTGAACCTGCGG, SEQ ID NO.1) and ITS4 (TCCTCCGCTTATTGATATGC, SEQ ID NO.2) as primers, the endophytic fungal strain NCCG-2 isolated from the rice panicle neck node was amplified, and the amplification product was sequenced. The sequencing result is shown in SEQ ID NO.3:

[0044] SEQ ID NO.3:

[0045] CATTACAGAGTTGCAAAACTCCCTAAACCATTGTGAACGTTACCTATACCGTTGCTTCGGCGGGCGGCCCCGGGGTTTACCCCCCGGGCGCCCCTGGGCCCCACCGCGGGCGCCCGCCGGAGGTCACCAAACTCTTGATAATTTATGGCCTCTCTGAGTCTTCTGTACTGAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCATCAAGCCCCCGGGCTTGTGTTGGGGACCTGCGGCTGCCGCAGGCCCTGAAAAGCAGTGGCGGGCTCGCTGTCGCACCGAGCGTAGTAGCATACATCTCGCTCTGGTCGCGCCGCGGGTTCCGGCCGTTAAACCACCTTTTAACCCAAGGTTGACCTCGGATCAGGTAGGAAGACCCGCTGAACTTAAGCATA。

[0046] Through blast search, the sequences were aligned. Using the Mega7.0 software, a phylogenetic tree was constructed by the ML algorithm with 500 bootstrap replicates, asFigure 2 As shown. This strain was identified as Chaetomium, presumably Chaetomium globosum.

[0047] Therefore, the isolated and screened strain was named Chaetomium globosum NCCG-2 and deposited in the China General Microbiological Culture Collection Center (abbreviated as CGMCC, address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences). The deposit number is CGMCC: 40316, and the deposit date is September 16, 2022.

[0048] Example 2 Determination of the antibacterial effect of Chaetomium globosum NCCG-2

[0049] 1. Dual culture assay of Chaetomium globosum NCCG-2 against 15 phytopathogenic fungi

[0050] The Chaetomium globosum NCCG-2 cultured on a PDA medium plate was made into discs with a diameter of 5 mm using a borer, and transferred to a new PDA plate at a position 2 cm away from the edge of the dish. In the same way, the discs of 15 cultured pathogenic fungi were respectively transferred to the PDA medium plate inoculated with Chaetomium globosum NCCG-2, keeping the two kinds of fungi on the same horizontal line and at the same distance from the edge of the dish. Additionally, a plate inoculated only with the pathogenic fungi was set as a control. Among them, the 15 pathogenic fungi include: Colletotrichum gloeosporioides (the anthracnose pathogen of citrus), Fusarium oxysporum (the root rot pathogen of peanut), Pythium ultimum, Macrophomina phaseoli Ashby (the sesame stem blight pathogen), Phomopsis asparagi (Sacc.) Bubak (the asparagus stem blight pathogen), Pyricularia grisea (Cooke) Sacc. (the rice blast pathogen), Verticillium dahliae (the cotton verticillium wilt pathogen), Phytophthora capsici (the pepper phytophthora blight pathogen), Fusarium fujikuroi (the bakanae pathogen of rice), Sclerotium rolfsii Sacc. (the southern blight pathogen of pepper), Sclerotium rolfsii (the southern blight pathogen of sweet potato), Macrophomina phaseolina (the sesame root rot pathogen), Thanatephorus cucumeris (the sheath blight pathogen of rice), Fusarium solani (Mart.) Sacc. (the root rot pathogen of peanut), and Fusarium graminearum (the rice seedling blight pathogen).

[0051] The inoculated plates were transferred to an incubator and incubated at a constant temperature of 28 °C for 5 days. The cross method was used to measure the colony diameter of the pathogenic fungi, and the inhibition rate of Chaetomium globosum NCCG-2 in confrontation culture against the pathogenic fungi was calculated.

[0052] After 5 days of culture, the results of the confrontation culture of Chaetomium globosum NCCG-2 against 15 crop pathogenic fungi are as Figure 3 shown. After measuring the colony diameter of the pathogenic fungi by the cross method, the inhibition rate of Chaetomium globosum NCCG-2 in confrontation culture against the pathogenic fungi was calculated as shown in Table 1.

[0053] Table 1 Determination results of the inhibitory effect of Chaetomium globosum NCCG-2 on the main pathogenic bacteria of crops

[0054]

[0055] The determination results showed that, except for having no inhibitory effect on Pythium ultimum, Chaetomium globosum NCCG-2 had growth inhibitory effects on the other 14 pathogenic fungi, and the inhibition rates were between 4.17% and 86.48%. Among them, the inhibition rates on 11 pathogenic fungi such as Colletotrichum gloeosporioides, Fusarium oxysporum, Macrophomina phaseoli Ashby, Phomopsis asparagi (Sacc.) Bubak, Pyricularia grisea (Cooke) Sacc., Phytophthora capsici, Fusarium fujikuroi, Macrophomina phaseolina, Thanatephorus cucumeris, Fusarium solani (Mart.) Sacc., and Fusarium graminearum were above 60%.

[0056] 2. Antibacterial determination of the fermentation broth of Chaetomium globosum NCCG-2 against 15 crop pathogenic fungi

[0057] The Chaetomium globosum NCCG-2 cultured well on the PDA medium plate was made into a 5-mm-diameter disc with a puncher, transferred to the PDB liquid medium for shake flask fermentation culture at a rotation speed of 150 r / min and a constant temperature of 28°C for 15 days. The fermentation broth was obtained by filtering the mycelium with three layers of gauze, and the sterile fermentation broth was obtained by sterilizing with a sterile filter for standby. The sterile fermentation broth was mixed and shaken well with the sterilized PDA liquid medium at a volume ratio of 1:9, and the drug-containing plate was obtained after pouring the plate. The discs of the 15 pathogenic fungi that had been cultured well were respectively transferred to the center of the drug-containing plate, and a plate without the fermentation broth was set as a control. It was cultured at a constant temperature of 28°C. When the control indicator bacteria were cultured to about 80% of the whole plate, the colony diameter was measured by the cross method, and the antibacterial rate of the fermentation broth of Chaetomium globosum NCCG-2 (diluted 10 times) against the pathogenic fungi was calculated.

[0058] After the culture was completed, the results of culturing 15 plant pathogenic fungi such as Pyricularia grisea on the drug-containing PDA plate made of the 10-fold dilution of the fermentation broth of Chaetomium globosum NCCG-2 were as follows Figure 4As shown in the figure, after measuring the colony diameter of the pathogenic fungi by the cross method, the inhibition rate of the drug-containing plates of the Chaetomium globosum NCCG-2 fermentation broth against the pathogenic fungi was calculated, and the results are shown in Table 2.

[0059] Table 2 Determination of the antibacterial effect of Chaetomium globosum NCCG-2 fermentation broth against the main pathogenic bacteria of crops

[0060]

[0061] The measurement results showed that the Chaetomium globosum NCCG-2 fermentation broth had a certain antibacterial effect on 14 other plant pathogenic fungi except for no antibacterial effect on Sclerotium rolfsii of pepper. Among them, the inhibition rate against Phomopsis asparagi was as high as 97.01%, and the inhibition rate against Magnaporthe oryzae was 81.43%, showing great potential for biocontrol application.

[0062] Example 3 Optimization and screening of the sporulation medium of Chaetomium globosum NCCG-2

[0063] Rice straw, rice bran, and corn flour were used as the main raw materials for the sporulation culture of Chaetomium globosum NCCG-2, and six formulations were designed according to different mass ratios to screen out the best sporulation solid medium. The six formulation combinations are as follows:

[0064] Formulation 1: Number of parts of rice straw ∶ Number of parts of rice bran ∶ Number of parts of corn flour = 3 ∶ 4 ∶ 3;

[0065] Formulation 2: Number of parts of rice straw ∶ Number of parts of rice bran ∶ Number of parts of corn flour = 4 ∶ 3 ∶ 3;

[0066] Formulation 3: Number of parts of rice straw ∶ Number of parts of rice bran ∶ Number of parts of corn flour = 5 ∶ 2.5 ∶ 2.5;

[0067] Formulation 4: Number of parts of rice straw ∶ Number of parts of rice bran ∶ Number of parts of corn flour = 6 ∶ 2 ∶ 2;

[0068] Formulation 5: Number of parts of rice straw ∶ Number of parts of rice bran ∶ Number of parts of corn flour = 5 ∶ 5 ∶ 0;

[0069] Formulation 6: Number of parts of rice straw ∶ Number of parts of rice bran ∶ Number of parts of corn flour = 5 ∶ 0 ∶ 5.

[0070] The Chaetomium globosum NCCG-2 spore suspension was inoculated into the solid media with different ratios at a rate of 2%, and cultured at a constant temperature of 28 °C for 15 days. After drying at room temperature, it was pulverized to obtain the Chaetomium globosum NCCG-2 spore powder. 1 g of the spore powder was weighed, eluted with clear water, filtered through double-layer gauze to obtain the spore suspension, and the spore amount per gram of spore powder was calculated after dilution at different gradients and counting under a microscope. The counting results are shown in Table 3.

[0071] Table 3 Results of optimization and screening of the sporulation medium of Chaetomium globosum NCCG-2

[0072]

[0073] The data in Table 3 show that the spore production of Formulation 1 is 1.44×10 8 cfu / g, the spore production of Formulation 2 is 1.41×10 8 cfu / g, the spore production of Formulation 3 is 6.83×10 8 cfu / g, the spore production of Formulation 4 is 5.12×10 8 cfu / g, the spore production of Formulation 5 is 1.32×10 8 cfu / g, the spore production of Formulation 6 is 1.65×10 8 cfu / g. From the above results, it can be determined that Formulation 3 (rice straw parts∶rice bran parts∶corn flour parts = 5∶2.5∶2.5) is the best spore-producing culture medium formula for Chaetomium globosum NCCG-2.

[0074] Example 4 Growth promotion effect of Chaetomium globosum NCCG-2 on rice seedlings

[0075] The spore powder preparation of Chaetomium globosum NCCG-2 was used for large-field machine transplanting seedling raising (seedling tray specifications: 58 cm×28 cm×2 cm) by mixing the fungus with the substrate (the mass ratio of fungal spore powder to substrate is 1:500) and irrigating the roots with spore solution (100-fold solution, 200 mL per pot), and prochloraz conventional seed soaking was used as the control agent.

[0076] The seedling quality was investigated 25 days after sowing, and the results are shown in Table 4 and Figure 5 as follows.

[0077] Table 4 Effects of Chaetomium globosum NCCG-2 on the quality of large-field rice seedlings

[0078]

[0079] Combined with Figure 5 and the data in Table 4, it can be seen that through the treatment of mixing the fungus with the substrate, Chaetomium globosum NCCG-2 is significantly higher than the blank control and prochloraz seed soaking treatment in terms of the average fresh weight of seedlings, and there is no difference in terms of seedling height and the number of seedling roots compared with prochloraz seed soaking and blank control treatments, but the main root is significantly thicker than the blank control and prochloraz seed soaking treatments; through the treatment of irrigating the seedbed with spore solution, Chaetomium globosum NCCG-2 is significantly higher than the blank control and prochloraz seed soaking treatment in terms of seedling height, and there is no difference in terms of the number of seedling roots and the fresh weight of seedlings. In summary, the conclusion is that Chaetomium globosum NCCG-2 has a significant growth promotion effect on rice seedlings.

[0080] Example 5 Determination of the control effect of Chaetomium globosum NCCG-2 against rice blast

[0081] The rice blast-susceptible variety "Yexiangyouhang 1573" was selected as the test variety.

[0082] Treatment 1: Mix the spores of Chaetomium globosum NCCG-2 with soil for seeding and raising seedlings at a mass ratio of fungal spore powder to soil of 1:200. Wait until the seedling grows to the three-leaf and one-heart stage, then spray and inoculate the spore suspension of Magnaporthe oryzae, and culture it at a constant temperature of 26°C with humidity maintained. After 7 days when the disease develops stably, investigate the disease grade and calculate the control efficacy.

[0083] Treatment 2: Sow the susceptible variety "Yexiangyouhang 1573" after normal seed soaking and germination promotion in small plastic pots (diameter 20 cm, height 10 cm). When the seedling grows to the three-leaf and one-heart stage, first spray the fermentation filtrate of Chaetomium globosum NCCG-2 (50-fold dilution, 30 mL per pot), place it at room temperature for 24 hours, then spray and inoculate the spore suspension of Magnaporthe oryzae (spray an appropriate amount as in Treatment 1), and spray until no liquid drips from the rice leaves. Culture it at a constant temperature of 26°C with humidity maintained. After 7 days when the disease develops stably, investigate the disease grade and calculate the control efficacy.

[0084] Among them, the preparation method of the fermentation filtrate is as follows: Punch the cultured Chaetomium globosum NCCG-2 PDA plate with a puncher to make discs with a diameter of 5 mm. Prepare a potato sucrose liquid medium (200 g of potato, 20 g of sucrose, 1000 mL of water), divide it into 250 mL Erlenmeyer flasks (100 mL per flask), and sterilize it with steam at 121°C for 20 minutes. When it cools to room temperature, inoculate the Chaetomium globosum NCCG-2 discs into the Erlenmeyer flasks containing the potato sucrose liquid medium under sterile conditions, place them in a shaker and culture at a constant temperature and constant speed for 15 days (temperature 27°C, rotation speed 180 rpm). Filter the mycelium with three layers of gauze to obtain the fermentation broth, dilute it 50 times, and add 1% Tween 20, which can be used for spraying treatment of rice seedlings.

[0085] The test results are shown in Table 5. The data in Table 5 show that colonizing the susceptible variety "Yexiangyouhang 1573" with the viable spores of Chaetomium globosum NCCG-2 mixed in soil has a control efficacy of 82.62% against seedling blast, and its fermentation broth has a control efficacy of 80.25% against leaf blast of rice blast. The results indicate that Chaetomium globosum NCCG-2 has a good control efficacy against rice blast ( Figure 6 and Figure 7 ).

[0086] Table 5 Control effect of Chaetomium globosum NCCG-2 on rice blast

[0087]

[0088] Example 6 Regulation and inhibition effect of Chaetomium globosum NCCG-2 on soil harmful microorganisms

[0089] Mix the viable spores of the rice endophytic fungus Chaetomium globosum NCCG-2 with soil to raise seedlings of the susceptible rice variety Yexiangyouhang 1573 for controlling rice blast (mass ratio of fungal spore powder to soil = 1:500), with no application of the fungus as the control.

[0090] The results are asFigure 8 As shown, a large number of hyphae of pathogenic fungi (Fusarium spp. observed under the microscope) grew in the roots of the rice seedlings and the soil in the control without inoculation of bacteria, causing the occurrence of rice seedling damping-off. In the potted plants treated with the endophytic fungus Chaetomium globosum NCCG-2 of rice, no disease occurred at the base of the rice stems, and no growth of other miscellaneous bacteria was observed in the culture soil. Thus, it can be seen that the endophytic fungus Chaetomium globosum NCCG-2 of rice has an inhibitory and regulatory effect on harmful microorganisms in the rhizosphere soil of rice.

[0091] Example 7 Control effect of Chaetomium globosum NCCG-2 on main diseases of peanut leaves

[0092] The fermentation broth of Chaetomium globosum NCCG-2 (50-fold dilution) was sprayed after the flowering stage of peanuts (spraying amount: 50 Kg / mu) to control the diseases of peanut leaves. The control effects are shown in Table 6 and Figure 9 as follows.

[0093] Table 6 Control effect of Chaetomium globosum NCCG-2 on main diseases of peanut leaves

[0094]

[0095] The results of the field experiment showed that the field control effects of the fermentation broth of Chaetomium globosum NCCG-2 (50-fold dilution) on peanut brown spot, black spot and leaf spot were 83.62%, 81.72% and 89.63% respectively. The results indicated that Chaetomium globosum NCCG-2 had significant control effects on main diseases of peanut leaves and had broad application prospects.

[0096] Example 8 Control effect of Chaetomium globosum NCCG-2 on root rot and stem rot of Huangju

[0097] Wuyuan Huangju was selected as the test variety. At the time of spring transplanting, the spore powder of Chaetomium globosum NCCG-2 (spore amount: 100 million cfu / g) was mixed with organic fertilizer (mass ratio of spore powder of NCCG-2: organic fertilizer = 1:500) and applied by hole application to control root rot and stem rot of Huangju. The control effects are shown in Table 7 and Figure 10 as follows.

[0098] Table 7 Control effect of Chaetomium globosum NCCG-2 on root rot and stem rot of Wuyuan Huangju

[0099]

[0100] The results of the field experiment showed that the average field control effects of the spore powder of Chaetomium globosum NCCG-2 on root rot and stem rot of Wuyuan Huangju were 85.91% and 78.65% respectively. It can be seen that Chaetomium globosum NCCG-2 had good control effects on root rot and stem rot of Huangju.

[0101] The embodiments described above are only descriptions of the preferred embodiments of the present invention and do not limit the scope of the present invention. Without departing from the design spirit of the present invention, various deformations and improvements made by those of ordinary skill in the art to the technical solutions of the present invention shall fall within the protection scope determined by the claims of the present invention.

Claims

1. A strain of Chaetomium globosum NCCG-2, characterized in that, It was deposited in the China General Microbiological Culture Collection Center on September 16, 2022, with the deposit number CGMCC: 40316.

2. A microbial inoculant, characterized in that, It includes the Chaetomium globosum NCCG-2 described in claim 1 and / or its fermentation product.

3. Use of Chaetomium globosum NCCG-2 according to claim 1 or the microbial inoculum according to claim 2 in inhibiting crop pathogenic bacteria, characterized in that, The crop pathogenic fungi include Colletotrichum gloeosporioides, Fusarium oxysporum, Pythium ultimum, Macrophomina phaseoli Ashby, Phomopsis asparagi (Sacc.) Bubak, Pyricularia grisea (Cooke) Sacc., Verticillium dahliae, Phytophthora capsici, Fusarium fujikuroi, Sclerotium rolfsii Sacc., Sclerotium rolfsii, Macrophomina phaseolina, Fusarium solani (Mart.) Sacc., and Thanatephorus cucumeris.

4. The application according to claim 3, wherein The Chaetomium globosum NCCG-2 can inhibit Colletotrichum gloeosporioides, Fusarium oxysporum, Macrophomina phaseoli, Phomopsis asparagi, Pyricularia grisea, Verticillium dahliae, Phytophthora capsici, Fusarium fujikuroi, Sclerotium rolfsii, Thanatephorus cucumeris, Fusarium solani, and Thanatephorus cucumeris.

5. The application according to claim 4, wherein The components of the sporulation medium of the Chaetomium globosum NCCG-2 include rice straw, rice bran, and corn flour, and the mass ratio of the rice straw, rice bran, and corn flour is 5:2.5:2.

5.

6. The application according to claim 3, characterized in that The fermentation broth of the Chaetomium globosum NCCG-2 can inhibit Colletotrichum gloeosporioides, Fusarium oxysporum, Pythium ultimum, Macrophomina phaseoli, Phomopsis asparagi, Pyricularia grisea, Verticillium dahliae, Phytophthora capsici, Fusarium fujikuroi, Sclerotium rolfsii, Thanatephorus cucumeris, Fusarium solani, and Thanatephorus cucumeris; the Sclerotium rolfsii is Sclerotium rolfsii.

7. Use of Chaetomium globosum NCCG-2 according to claim 1 or the microbial inoculum according to claim 2 in controlling crop diseases, characterized in that, The crop diseases include citrus anthracnose, peanut root rot, sesame stem blight, asparagus stem blight, rice blast, cotton verticillium wilt, pepper phytophthora blight, rice bakanae disease, pepper southern blight, kudzu southern blight, sesame root rot, rice sheath blight, peanut root rot, and rice damping-off.

8. Use of Chaetomium globosum NCCG-2 described in claim 1 or the microbial inoculum described in claim 2 in promoting the growth of rice, characterized in that, The promoting of rice growth includes increasing the seedling height of rice, increasing the number of rice roots, and promoting the thickening of the main root.

9. Application of the Chaetomium globosum NCCG-2 described in claim 1 or the microbial inoculant described in claim 2 in the prevention and control of peanut brown spot, peanut black spot, and peanut leaf spot.

10. Use of Chaetomium globosum NCCG-2 described in claim 1 or the microbial inoculum described in claim 2 in preventing and controlling root rot and stem rot of Dendranthema morifolium 'Huangju'.

Images