High-expression siderophore and application thereof

By constructing the overexpression of the bfmR gene of recombinant Pseudomonas aeruginosa, the problem of low bacterial iron vector production was solved, and efficient iron carrier production and heavy metal pollution repair were achieved, especially iron oxide dissolution in fly ash.

CN120349946APending Publication Date: 2025-07-22SICHUAN UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202410081503.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2024-01-19
Publication Date
2025-07-22

AI Technical Summary

Technical Problem

In the prior art, the yield of bacterial iron carriers is not high, which is difficult to meet the demand for iron for microbial growth, and iron carriers are limited in environmental applications.

Method used

By constructing recombinant Pseudomonas aeruginosa, overexpressing the bfmR gene, increasing the yield of iron vectors, culture recombinant Pseudomonas aeruginosa with specific culture medium and conditions, combined with purification steps to improve the yield and efficiency of iron vectors.

Benefits of technology

It significantly improves the yield of iron carriers, can efficiently grow and produce iron carriers in iron-deficient environments, adapt to high osmotic pressure, effectively repair heavy metal pollution, especially iron oxides in fly ash, and reduce heavy metal toxicity.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120349946A_ABST
    Figure CN120349946A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of gene engineering, in particular to a high-expression siderophore and application thereof. The invention provides a recombinant pseudomonas aeruginosa, which is characterized in that the recombinant pseudomonas aeruginosa takes pseudomonas aeruginosa as an original strain, and a bfmR gene is subjected to overexpression, so that the recombinant pseudomonas aeruginosa is obtained. Through overexpression of the bfmR gene, compared with wild type pseudomonas aeruginosa, the recombinant pseudomonas aeruginosa constructed by the invention has the advantage that the siderophore yield is obviously increased.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, and particularly relates to a high-expression siderophore and its uses. Background Art

[0002] Iron (Fe) is an element essential for the growth of almost all microorganisms, and plays a catalytic role in processes such as oxygen metabolism, electron transfer, and DNA and RNA synthesis. Although iron is the fourth most abundant element in the earth's crust, due to the fact that most iron exists in the form of oxidized state, its solubility is extremely low. The concentration of free iron ions in the environment is at the picomolar level, while microorganisms require iron at the millimolar level for growth. Therefore, microorganisms have evolved various iron uptake pathways, and the most important one is the siderophore-dependent iron uptake pathway. Siderophores are high-affinity low-molecular-weight metal chelators (200 - 2000 Da) produced by microorganisms. The main function of siderophores is to chelate iron, but they can also chelate other metal elements in the environment (such as Mo, Mn, Co, and Ni).

[0003] Although siderophores can play a certain role in environmental applications, the production of siderophores by bacteria is restricted by various factors, resulting in low yields of siderophores. Chinese Patent Application CN106544306A discloses a separated high-yield siderophore-producing bacterium. Although the yield of its siderophore is improved compared with ordinary strains in the prior art, its ability to produce siderophores is still limited. Summary of the Invention

[0004] In a first aspect, the present invention provides a recombinant Pseudomonas aeruginosa, characterized in that the recombinant Pseudomonas aeruginosa uses Pseudomonas aeruginosa as the starting strain and overexpresses the bfmR gene. By overexpressing the bfmR gene, the recombinant Pseudomonas aeruginosa constructed in the present invention has a significantly increased yield of siderophore compared with the wild-type Pseudomonas aeruginosa.

[0005] In the prior art, the siderophore production of bacteria with high siderophore-producing ability (expressed in siderophore units, SU) is usually less than 50%. In some embodiments, the siderophore production of the recombinant Pseudomonas aeruginosa constructed in the present invention is at least 60%. In some embodiments, the siderophore production of the recombinant Pseudomonas aeruginosa constructed in the present invention includes 60%, 70%, 80%, 90%, 100%, 110%, 120%, 130%, 140% or 150%. In some embodiments, the siderophore production of the recombinant Pseudomonas aeruginosa constructed in the present invention is ≥70%. In some embodiments, the siderophore production of the recombinant Pseudomonas aeruginosa constructed in the present invention is ≥100%. In some embodiments, under the same culture conditions, the siderophore production of the recombinant Pseudomonas aeruginosa constructed in the present invention is at least 2 times that of the wild-type Pseudomonas aeruginosa.

[0006] In some embodiments, the nucleotide sequence encoding the bfmR gene is as shown in SEQ ID NO:1. In the recombinant Pseudomonas aeruginosa constructed in the present invention, overexpression of the bfmR gene can enhance the production of siderophores by upregulating siderophore-related genes.

[0007] In some embodiments, the amino acid sequence of the bfmR gene is as shown in SEQ ID NO:2.

[0008] In some embodiments, the Pseudomonas aeruginosa includes the Pseudomonas aeruginosa PA14 strain. In some specific embodiments, the present invention uses the model strain Pseudomonas aeruginosa PA14 strain. It should be understood that other Pseudomonas aeruginosa strains can also be used to construct recombinant Pseudomonas aeruginosa.

[0009] In some embodiments, the method for constructing the recombinant Pseudomonas aeruginosa includes:

[0010] S101 Obtain the bfmR gene fragment;

[0011] S102 Obtain the linearized pRK415 vector;

[0012] S103 Connect the bfmR gene fragment to the linearized pRK415 vector to obtain the pRK415-bfmR plasmid;

[0013] S104 Transfer the pRK415-bfmR plasmid into the Pseudomonas aeruginosa to obtain the recombinant Pseudomonas aeruginosa.

[0014] In a second aspect, the present invention provides a method for producing siderophores, characterized in that the method includes mixing and culturing the above-mentioned recombinant Pseudomonas aeruginosa with a first culture medium, and collecting the siderophores.

[0015] In some embodiments, the first culture medium is an iron-deficient culture medium.

[0016] In some embodiments, the initial pH of the first culture medium ranges from 5.5 to 8.0.

[0017] In some embodiments, the initial pH of the first culture medium ranges from 6.0 to 7.5.

[0018] In some embodiments, the initial pH of the first culture medium ranges from 6.5 to 7.0.

[0019] In some embodiments, the carbon source in the first culture medium includes succinic acid or its salts.

[0020] In some embodiments, the concentration of succinic acid or its salts in the first culture medium ranges from 10 to 100 mM. In some embodiments, the concentration of succinic acid or its salts in the first culture medium ≤ 50 mM. In some embodiments, the concentration of succinic acid or its salts in the first culture medium is 40 mM. The above setting of the carbon source enables the recombinant Pseudomonas aeruginosa to maintain a semi-starved state, thereby more efficiently producing siderophores.

[0021] In some embodiments, the carbon source in the first culture medium further includes glycerol.

[0022] In some embodiments, the concentration of glycerol in the first culture medium ≤ 5% w / v.

[0023] In some embodiments, the concentration of Na + in the first culture medium ranges from 10 mM to 1000 mM. In some embodiments, the concentration of Na + in the first culture medium ranges from 150 mM to 500 mM.

[0024] In some embodiments, the concentration of Na + in the first culture medium ≤ 300 mM. It should be emphasized that the recombinant Pseudomonas aeruginosa provided by the present invention can adapt to a relatively high osmotic pressure and maintain a relatively high yield of siderophores, and is particularly suitable for repairing environments where the osmotic pressure may be relatively high.

[0025] In some embodiments, the first culture medium further includes one or more of NH4Cl, KH2PO4, KNO3, and MOPS.

[0026] In some embodiments, the first culture medium specifically includes succinate, NH4Cl, KH2PO4, KNO3, MOPS, NaCl.

[0027] In some embodiments, the first culture medium specifically comprises 40 mM succinate, 9.3 mM NH4Cl, 2.2 mM KH2PO4, 25 mM KNO3, 30 mM MOPS, and 280 mM NaCl.

[0028] The above settings of the first culture medium of the present invention enable the recombinant Pseudomonas aeruginosa to grow in a suitable environment while producing siderophores more efficiently.

[0029] In some embodiments, the recombinant Pseudomonas aeruginosa is inoculated into the first culture medium at a volume percentage of 1-5%.

[0030] In some embodiments, the addition amount of the recombinant Pseudomonas aeruginosa includes approximately 1.0–5.0×10 6 CFU / mL.

[0031] In some embodiments, the addition amount of the recombinant Pseudomonas aeruginosa includes approximately 4.0×10 6 CFU / mL.

[0032] In some embodiments, the culture time is at least 24 hours.

[0033] In some embodiments, the culture time includes 24-48 hours.

[0034] The setting of the addition amount of the recombinant Pseudomonas aeruginosa of the present invention enables the recombinant Pseudomonas aeruginosa to grow at a suitable rate while gradually adapting to the iron-deficient environment and producing siderophores.

[0035] In some embodiments, the method further comprises a step of purifying the collected siderophores. The purification step includes filtering and acidifying the collected siderophores, extracting with ethyl acetate; concentrating the ethyl acetate fraction, resuspending the ethyl acetate fraction in a first solvent, and eluting through a Sephadex column.

[0036] In some embodiments, the first solvent includes one or more of ddH2O, ultrapure water, deionized water, water for injection, and pure water.

[0037] In a third aspect, the present invention provides the use of the above recombinant Pseudomonas aeruginosa in the remediation of heavy metal pollution. The present invention proves through experiments that the recombinant Pseudomonas aeruginosa provided by the present invention and / or the siderophores produced by the recombinant Pseudomonas aeruginosa have excellent in-situ remediation ability for heavy metal pollution and can efficiently remove insoluble iron oxides.

[0038] In some embodiments, the uses include remediating heavy metal pollution in soil, water bodies, and / or solid waste. It should be emphasized that the recombinant Pseudomonas aeruginosa provided by the present invention can adapt to a relatively high osmotic pressure and maintain a relatively high production of siderophores, and is particularly suitable for remediating environments such as soil, water bodies, and / or solid waste where the osmotic pressure may be relatively high. In addition, the recombinant Pseudomonas aeruginosa provided by the present invention and / or the siderophores produced by the recombinant Pseudomonas aeruginosa can alleviate metal toxicity, and thus can provide essential nutrients such as iron for plants, enabling the plants to survive and grow more successfully in heavy metal-polluted soil.

[0039] In some embodiments, the uses include dissolving iron oxides. In some embodiments, the iron in the iron oxides includes trivalent iron. Iron-rich fly ash is a huge solid waste globally. Due to the driving force of iron for ROS generation, in addition to its serious environmental pollution risk, it also causes a significant increase in human bronchial cell toxicity and induces apoptosis. It has been verified that the recombinant Pseudomonas aeruginosa provided by the present invention and / or the siderophores produced by the recombinant Pseudomonas aeruginosa can effectively dissolve solid iron (such as iron oxides) from fly ash. Therefore, the recombinant Pseudomonas aeruginosa provided by the present invention and / or the siderophores produced by the recombinant Pseudomonas aeruginosa can dissolve and absorb iron oxides, and are particularly suitable for remediating minerals and / or toxic substances containing iron oxides.

[0040] In addition, the siderophores produced by the recombinant Pseudomonas aeruginosa provided by the present invention can also chelate various metals other than iron (such as Ag+, Cd+, Co2+, Cr2+, Cu2+, Eu3+, Ga3+, Hg2+, Mn2+, Ni2+, Pb2+, Sn2+, Tb3+, Tl+, and Zn2) to further reduce the toxicity of heavy metals.

[0041] Fourthly, the present invention provides a method for remediating heavy metal pollution, characterized in that the method includes:

[0042] Adding recombinant Pseudomonas aeruginosa to a pretreated solid waste suspension to obtain a first mixture, wherein the pretreated solid waste contains iron oxides, and the iron in the iron oxides includes trivalent iron;

[0043] Performing remediation on the first mixture under first environmental conditions to remove the iron oxides;

[0044] wherein the recombinant Pseudomonas aeruginosa uses Pseudomonas aeruginosa as the starting strain and overexpresses the bfmR gene.

[0045] In some embodiments, the pretreatment includes oxidizing the iron in the iron oxide in the solid waste to ferric iron to obtain the pretreated solid waste.

[0046] In some embodiments, the pretreatment further includes filtration and drying steps.

[0047] In some embodiments, the pretreatment further includes a sterilization step.

[0048] In some embodiments, the method of the pretreatment specifically includes adding the solid waste into a first solvent, heating and / or soaking until the iron in the iron oxide in the solid waste is oxidized to ferric iron.

[0049] In some embodiments, the suspension of the pretreated solid waste includes the pretreated solid waste and a first culture medium.

[0050] In some embodiments, the concentration of the pretreated solid waste ≤ 10% w / v.

[0051] In some embodiments, the concentration of the pretreated solid waste includes 1 - 5% w / v.

[0052] In some embodiments, the recombinant Pseudomonas aeruginosa is inoculated into the suspension of the pretreated solid waste at a volume percentage of 1 - 5%.

[0053] In some embodiments, the addition amount of the recombinant Pseudomonas aeruginosa includes approximately 1.0–5.0×10 6 CFU / mL.

[0054] In some embodiments, the addition amount of the recombinant Pseudomonas aeruginosa includes approximately 4.0×10 6 CFU / mL.

[0055] In the present invention, the first culture medium is set such that the recombinant Pseudomonas aeruginosa can grow in a suitable environment while more efficiently producing siderophores. The appropriate addition amount of the recombinant Pseudomonas aeruginosa in the present invention can enable the recombinant Pseudomonas aeruginosa to grow at a suitable rate while gradually adapting to the iron-deficient environment and producing siderophores. By controlling the concentration of the suspension of the pretreated solid waste in the present invention, it not only ensures the efficient dissolution of iron oxide by the recombinant Pseudomonas aeruginosa under this condition, but also avoids the toxicity caused by the recombinant Pseudomonas aeruginosa dissolving too much iron, so that the recombinant Pseudomonas aeruginosa can survive, produce siderophores, and dissolve and utilize iron in a suitable environment during the repair cycle.

[0056] In some embodiments, the initial pH of the first culture medium includes 5.5–8.0.

[0057] In some embodiments, the initial pH of the first culture medium ranges from 6.0 to 7.5.

[0058] In some embodiments, the initial pH of the first culture medium ranges from 6.5 to 7.0.

[0059] In some embodiments, the carbon source in the first culture medium includes succinic acid or its salts.

[0060] In some embodiments, the concentration of the succinic acid or its salts in the first culture medium ranges from 10 to 100 mM. In some embodiments, the concentration of the succinic acid or its salts in the first culture medium ≤ 50 mM. In some embodiments, the concentration of the succinic acid or its salts in the first culture medium is 40 mM. The above setting of the carbon source enables the recombinant Pseudomonas aeruginosa to maintain a semi-starved state, thereby producing siderophores more efficiently.

[0061] In some embodiments, the carbon source in the first culture medium further includes glycerol.

[0062] In some embodiments, the concentration of the glycerol in the first culture medium ≤ 5% w / v.

[0063] In some embodiments, the concentration of Na + in the first culture medium ranges from 10 mM to 1000 mM. In some embodiments, the concentration of Na + in the first culture medium ranges from 150 mM to 500 mM. In some embodiments, the concentration of Na + in the first culture medium ≤ 300 mM. It should be emphasized that the recombinant Pseudomonas aeruginosa provided by the present invention can adapt to a relatively high osmotic pressure and maintain a relatively high yield of siderophores, and is particularly suitable for repairing environments where the osmotic pressure may be relatively high.

[0064] In some embodiments, the first culture medium further includes one or more of NH4Cl, KH2PO4, KNO3, and MOPS.

[0065] In some embodiments, the first culture medium specifically includes succinate, NH4Cl, KH2PO4, KNO3, MOPS, and NaCl.

[0066] In some embodiments, the first culture medium specifically includes 40 mM succinate, 9.3 mM NH4Cl, 2.2 mM KH2PO4, 25 mM KNO3, 30 mM MOPS, and 280 mM NaCl.

[0067] In some embodiments, the first environmental conditions include normal air oxygen content, 30 - 37 °C, and pH 6.0 - 7.5.

[0068] In some embodiments, the recombinant Pseudomonas aeruginosa is cultured in the first medium before being added.

[0069] In some embodiments, the method further comprises adding a siderophore.

[0070] In some embodiments, the siderophore is produced by the recombinant Pseudomonas aeruginosa.

[0071] In some embodiments, the siderophore is purified.

[0072] In some embodiments, the addition amount of the siderophore ≤ 5×10 -4 g / mL.

[0073] In some embodiments, the repair time is at least 24 hours.

[0074] In some embodiments, the repair time includes 24 - 48 hours.

[0075] In some embodiments, the solid waste includes fly ash.

[0076] In summary, the recombinant Pseudomonas aeruginosa constructed in the present invention can highly express siderophores. The present invention creatively applies the recombinant Pseudomonas aeruginosa to the removal of heavy metal pollution including solid waste, and through experiments, it is confirmed that the method provided by the present invention can effectively dissolve iron oxides in fly ash, remove insoluble iron from the environment by forming soluble Fe 3+ complexes, and can be absorbed by the recombinant Pseudomonas aeruginosa. It has been verified that based on the method provided by the present invention, the iron extraction ability of the recombinant Pseudomonas aeruginosa can be increased by about 3 times. Compared with the costly traditional cleaning technologies, the method provided by the present invention can cope with heavy metal pollution caused by various solid wastes and will not cause additional hazards. BRIEF DESCRIPTION OF THE DRAWINGS

[0077] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for the description of the embodiments or the prior art. In all the drawings, similar elements or parts are generally identified by similar reference numerals. In the drawings, the elements or parts do not necessarily draw according to the actual scale. Obviously, the following described drawings are some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.

[0078] Figure 1 It is a result graph of the growth curves (solid lines) and siderophore yields (dashed lines) of the WT strain and the WT::bfmR strain under iron-limited conditions;

[0079] Figure 2 Results graph of siderophore production of WT strain and WT::bfmR strain under different osmotic pressure conditions;

[0080] Figure 3 Results graph of siderophore production of WT strain and WT::bfmR strain under different pH conditions;

[0081] Figure 4 Results graph of siderophore production of WT strain and WT::bfmR strain under different carbon source conditions;

[0082] Figure 5 Results graph of iron content in culture supernatants of different Pseudomonas aeruginosa strains;

[0083] Figure 6 Results graph of iron content in cells of different Pseudomonas aeruginosa strains;

[0084] Figure 7a Results graph of dissolution of iron in fly ash by siderophores from different Pseudomonas aeruginosa strains;

[0085] Figure 7b Results graph of dissolution of iron in fly ash by different Pseudomonas aeruginosa strains;

[0086] Figure 7c Results graph of siderophore production of different Pseudomonas aeruginosa strains. Detailed implementation manners

[0087] To make the objectives, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings in the embodiments of the present invention. Obviously, the described embodiments are some, but not all, of the embodiments of the present invention. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts shall fall within the scope of protection of the present invention.

[0088] In addition, the terms "first" and "second" are only used for descriptive purposes and cannot be construed as indicating or implying relative importance.

[0089] As used herein, "and / or" includes any and all combinations of one or more of the listed related items.

[0090] As used herein, "a plurality of" means two or more, i.e., it includes two, three, four, five, etc.

[0091] It should be noted that in this document, the terms "comprising", "including" or any other variants thereof are intended to cover non-exclusive inclusion, such that a process, method, article or device comprising a series of elements not only includes those elements but also other elements not expressly listed, or elements inherent to such process, method, article or device. Without further limitation, an element defined by the statement "comprising one..." does not exclude the presence of additional identical elements in the process, method, article or device comprising such element.

[0092] As used in this specification, the term "about" typically means + / - 5% of the stated value, more typically + / - 4% of the stated value, more typically + / - 3% of the stated value, more typically + / - 2% of the stated value, even more typically + / - 1% of the stated value, and even more typically + / - 0.5% of the stated value.

[0093] In this specification, certain embodiments may be disclosed in a format that is within a certain range. It should be understood that this description of "within a certain range" is merely for convenience and brevity and should not be construed as a rigid limitation on the disclosed range. Accordingly, the description of a range should be considered to have specifically disclosed all possible sub-ranges and the individual numerical values within that range. For example, the description of the range 1 - 6 should be considered to have specifically disclosed sub-ranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6, etc., as well as the individual numbers within that range, such as 1, 2, 3, 4, 5, and 6. This rule applies regardless of the breadth of the range.

[0094] Example 1: Materials and Methods

[0095] 1.1 Construction of wild-type Pseudomonas aeruginosa strain (WT), WT::bfmR, and ΔbfmR strains:

[0096] In this example, the wild-type Pseudomonas aeruginosa PA14 was selected as the starting strain. The WT::bfmR strain was constructed by introducing the plasmid pRK415-bfmR to overexpress the bfmR gene on the basis of the WT strain; the ΔbfmR strain was a bfmR gene knockout strain, which was constructed by knocking out the bfmR gene with the plasmid pEX18Gm on the basis of the WT strain.

[0097] The number of the bfmR gene in Pseudomonas aeruginosa PA14 is pa4101, and its DNA sequence is: ATGGAGCATGTCGATCACATCCTGATCGTCGACGATGACCGCGAGATTCGCGAGCTGGTAGGCAACTACCTGAAGAAGAACGGCCTGCGCACCACCATCGTCGCCGATGGCCGGCAGATGCGCGCGTTCCTCGAAGCCAACACGGTGGACCTGATCGTCCTCGACATCATGATGCCCGGCGACGACGGCCTGCTGCTCTGCCGCGAGCTGCGCGTCGGCAAGCACAAGGCCACGCCGGTGCTGATGCTCACCGCGCGCAACGACGAGACCGACCGCATCATCGGCCTGGAGATGGGCGCCGACGACTACCTGACCAAGCCCTTCTCCGCCCGCGAACTGCTTGCCCGGATCAACGCCGTGCTGCGGCGTACGCGGATGCTGCCGCCGAACCTCACCGTGAGCGAGAGCAGCCGGCTGATCGGCTTCGGCCAGTGGCAACTGGACACCAGCGCCCGCCACCTGCTCGACGACGCCGGCACCGTGGTCGCCCTCAGCGGCGCCGAGTACCGCCTGCTGCGGGTGTTCCTCGATCATCCGCAACGGGTACTCAGTCGCGACCAGTTGCTCAACCTGACCCAGGGCCGCGAGGCGGACATCTTCGACCGTTCCATCGACCTGCTGGTCAGCCGCCTGCGCCAACGCCTCGGCGACGACGCCCGCGAACCGGAGTACATCAAGACCGTGCGCAGCGAGGGCTATGTGTTCTCGCTGCCGGTGCGACTGGTCGAGGCCCATCCATGA(SEQ ID NO:1);The amino acid sequence is: MEHVDHILIVDDDREIRELVGNYLKKNGLRTTIVADGRQMRAFLEANTVDLIVLDIMMPGDDGLLLCRELRVGKHKATPVLMLTARNDETDRIIGLEMGADDYLTKPFSARELLARINAVLRRTRMLPPNLTVSESSRLIGFGQWQLDTSARHLLDDAGTVVALSGAEYRLLRVFLDHPQRVLSRDQLLNLTQGREADIFDRSIDLLVSRLRQRLGDDAREPEYIKTVRSEGYVFSLPVRLVEAHP (SEQ ID NO:2, a total of 246 amino acids).;

[0098] 1.1.1 Construction of plasmid pRK415-bfmR:

[0099] Primers were designed to clone the bfmR gene from the genome of Pseudomonas aeruginosa PA14. By seamless cloning, the bfmR gene fragment was ligated to the linearized pRK415 vector to complete plasmid construction. The sequences of the designed primers are as follows (underlined are the homologous arm sequences):

[0100] F: 5’- ATGACCATGATTACGCCAAGCTTG ATGGAGCATGTCGATCACATCC-3’ (SEQ ID NO:3)

[0101] R: 5’- TCGGTACCCGGGGATCCTCTAGA TCATGGATGGGCCTCGACCAG-3’ (SEQ ID NO:4)

[0102] PCR reaction system:

[0103] PCR reaction conditions:

[0104] The pRK415 plasmid was linearized by treatment with two restriction endonucleases, XbaI and HindIII, at 4°C for 30 min, and then DNA purification and recovery were performed. 2×Phanta Max Master Mix and One Step Directional Cloning Kit (seamless cloning) were from Nanjing Novoprotein Scientific Inc.

[0105] Prepare the seamless cloning reaction system on ice according to the following components:

[0106] Reaction conditions: 37°C for 30 min in a PCR instrument. After recombination was completed, the product was transformed into DH5α and sent to a sequencing company for sequencing.

[0107] 1.1.2 Construction of WT::bfmR strain:

[0108] (1) The constructed pRK415-bfmR plasmid was transformed into competent Escherichia coli S17-1 cells and spread on an LB plate with tetracycline resistance (15 μg / mL). The next day, a single colony was picked and cultured in LB until the OD reached 0.5 - 0.6;

[0109] (2) Preparation of competent cells of Pseudomonas aeruginosa: 3 mL of overnight-cultured Pseudomonas aeruginosa PA14 bacterial solution was placed in a 42°C water bath for 5 - 6 h;

[0110] (3) The S17-1 bacteria were collected and centrifuged, washed once with fresh LB medium, 500 μL of competent Pseudomonas aeruginosa cells were added and centrifuged, washed once with fresh LB medium, then resuspended in 80 μL of LB medium, aspirated with a pipette and dropped in the middle of an antibiotic-free LB plate, and cultured overnight at 37°C;

[0111] (4) Use a bacterium-picking loop to scrape one-fourth of the bacterial plaque on the antibiotic-free LB plate and spread it on an LB plate with tetracycline resistance (e.g., 120 μg / mL), and the grown single colonies were identified by colony PCR to determine whether the complementation was successful.

[0112] 1.1.3 Construction of pEX18Gm-bfmR:

[0113] The pEX18 plasmid carries the SacB sucrose-inducible suicide gene, which promotes double crossover between the plasmid and the genome to complete gene knockout. PCR was used to clone 600 bp homologous arms upstream and downstream of the bfmR gene, and the primers were as follows (the underlined sequences are homologous arm sequences):

[0114] pEX18Gm was linearized by PCR, and the primers were as follows:

[0115] F: 5'ATCCCCGGGTACCGAGCTCG3' (SEQ ID NO:9)

[0116] R: 5'AAGCTTGGCACTGGCCGTCG 3' (SEQ ID NO:10)

[0117] For the multi-fragment seamless cloning and recombination system, refer to the above pRK415-bfmR section.

[0118] 1.1.4 Construction of ΔbfmR knockout strain:

[0119] (1) Transform the constructed pEX18-bfmR plasmid into competent Escherichia coli S17-1 cells and spread them on LB plates with gentamicin resistance (15 μg / mL). Pick monoclonal colonies the next day and culture them in LB until the OD600 reaches 0.5 - 0.6;

[0120] (2) Preparation of Pseudomonas aeruginosa competent cells: Place 3 mL of overnight-cultured Pseudomonas aeruginosa PA14 bacterial solution in a 42 °C water bath for 5 - 6 h;

[0121] (3) Collect and centrifuge the S17-1 bacteria, wash them once with fresh LB medium, add 500 μL of Pseudomonas aeruginosa competent cells and centrifuge, wash them once with fresh LB medium, then resuspend them in 80 μL of LB medium, pipette and drop them in the middle of an antibiotic-free LB plate, and culture overnight at 37 °C;

[0122] (4) Use a bacterium-picking loop to scrape the bacterial plaque on one-fourth of the antibiotic-free LB plate and spread it on an LB plate with gentamicin resistance (50 μg / mL), culture overnight at 37 °C, then pick monoclonal colonies and streak them on a 10% sucrose (similar to LB, NaCl is replaced by 10% sucrose) plate, and culture overnight at 30 °C;

[0123] (5) Streak the monoclonal colonies on the sucrose plate on LB plates with gentamicin resistance (50 μg / mL) and PIA plates respectively. Pick the colonies that cannot grow on the former but can grow on the latter for colony PCR identification, and send the PCR bands of the successfully knocked-out colonies for sequencing for secondary identification.

[0124] The nucleotide sequence of the pRK415 vector is shown in SEQ ID NO:11, and the nucleotide sequence of the pEX18Gm vector is shown in SEQ ID NO:12.

[0125] Unless otherwise specified, the strains involved in the present invention can be cultured under the normal culture conditions of Pseudomonas aeruginosa, for example, cultured with shaking (220 r / min) at 37 °C under normal air oxygen content.

[0126] For plasmid maintenance, use the following concentrations of antibiotics: for Pseudomonas aeruginosa, 50 μg / mL of gentamicin, 120 μg / mL of tetracycline, 100 μg / mL of kanamycin, and / or 26 μg / mL of Irgasan in LB medium; for Escherichia coli, 50 μg / mL of ampicillin, 50 μg / mL of kanamycin, 15 μg / mL of tetracycline, and 15 μg / mL of gentamicin.

[0127] 1.2 Siderophore purification and determination:

[0128] The wild-type Pseudomonas aeruginosa PA14 and WT::bfmR, ΔbfmR strains were first cultured overnight in LB medium at 37°C, and then the cells of 1 mL of the culture were collected by centrifugation for 2 min and resuspended in iron-deficient succinate medium (medium: 40 mM succinate, 9.3 mM NH4Cl, 2.2 mM KH2PO4, 25 mM KNO3, 30 mM MOPS, pH 6.5) for culture. For siderophore measurement, the supernatant was filtered through a 0.45 μm PVDF syringe filter (microporous) and used for chrome azurol S (CAS) assay. Using the blank medium as a control, the color change from blue to orange was read at an absorbance of 630 nm with a UV spectrophotometer. The siderophore yield was expressed in siderophore activity units (SU), and the siderophore activity unit (%) = [(A r -A s ) / A r ×100. Ar is the OD 630 after mixing the blank medium with an equal volume of CAS, and As is the OD 630 after mixing the strain supernatant with an equal volume of CAS.

[0129] For siderophore purification, the culture supernatant was first filtered through a 0.45 μm PVDF syringe filter (microporous), acidified to pH 2.0 with HCl, and extracted with 0.4 volume of ethyl acetate. Then the ethyl acetate fraction was concentrated using a rotary vacuum evaporator, the dried fraction was resuspended in ddH2O, and eluted through a Sephadex LH-20 column (GE Healthcore), and finally eluted with 1 volume of 50% methanol. The fraction was concentrated using a rotary vacuum evaporator and stored at 20°C.

[0130] Pseudomonas aeruginosa was cultured in iron-deficient succinate medium (medium: 40 mM succinate, 9.3 mM NH4Cl, 2.2 mM KH2PO4, 25 mM KNO3, 30 mM MOPS, pH 6.5) for 24 h. 70 mL of the bacterial culture solution was taken, and after centrifugation at 4000 rpm for 15 min, 50 mL of the supernatant was taken to purify the siderophore (the purification method is as above). The obtained siderophore was concentrated and dried using a rotary vacuum evaporator, and its mass was measured on an analytical balance. The siderophore yield of the wild-type Pseudomonas aeruginosa was approximately 0.022 g, the siderophore yield of WT::bfmR was approximately 0.064 g, and the siderophore yield of ΔbfmR was approximately 0.010 g.

[0131] 1.3 Pretreatment of fly ash (CFA):

[0132] The high-speed rail CFA (particle diameter ≥ 50 μm) comes from Hengyuanxin Materials Industry, and the measured iron content is 7.2% (mass ratio). Exemplary pretreatment methods include: (1) Preliminary oxidation: Add CFA to water (1.2% w / v), stir the mixture and heat it to 95°C for 1 h, filter out the insoluble solid particles with filter paper and further dry for 2 h; (2) Sterilization: Sterilize all samples with an autoclave (121°C, 20 min) to remove any miscellaneous bacteria that CFA may carry; (3) Secondary oxidation: Immerse the samples in ddH2O at 10% w / v for 5 days, and adjust the pH of the suspension to 6.0 - 7.5. Filter out the insoluble solid particles from the pretreated CFA samples with filter paper and further dry for 2 h.

[0133] 1.4 Determine the iron removal effect of the siderophore from CFA:

[0134] Add the purified siderophore to 200 mL of iron-deficient succinate medium containing CFA (medium: 40 mM succinate, 9.3 mM NH4Cl, 2.2 mM KH2PO4, 25 mM KNO3, 30 mM MOPS, pH 6.5), place it in a glass Erlenmeyer flask, and culture it in a shaker (220 rpm) at 37°C. The concentration of CFA is 5% w / v. At different time intervals, extract 5 mL of the suspension and centrifuge for 2 minutes (10,000 rpm), then filter the supernatant using a 0.22 μm syringe filter (microporous). Bacteria or bacterial supernatants dissolve the iron in CFA under oscillating conditions (50 rpm) at 37°C. Determine the iron content in the solution using the flame atomic absorption spectrophotometer flame atomization method. The standard curve is measured by preparing a series of iron ion standards. Collect Pseudomonas aeruginosa cells, wash them with PBS, dry them, grind them into powder, and determine the iron content in the cells. The bacteria are acid-hydrolyzed with nitric acid solution, and the iron content is determined by the same method.

[0135] 1.5 Statistical analysis:

[0136] Analyze the collected data using GraphPad Prism 7.0 software and express it as the mean ± standard error of the mean (SEM). Each experiment is performed with at least three independent biological replicates. For the production of siderophores, one-way ANOVA with Bonferroni correction is used for multiple comparisons), and the difference is statistically significant (P < 0.05).

[0137] Example 2

[0138] This example first compares the siderophore production of the wild-type Pseudomonas aeruginosa strain and the constructed WT::bfmR strain.

[0139] Compared with the wild-type strain, under iron-limited conditions (medium: 40 mM succinate, 9.3 mM NH4Cl, 2.2 mM KH2PO4, 25 mM KNO3, 30 mM MOPS, pH 7.2) from 0 to 48 hours, rapid cell growth was observed in the WT::bfmR strain (overexpressing BfmR in the wild-type strain). Figure 1 ) This may be because the WT::bfmR strain adapted to the iron-deficient medium and simultaneously showed a higher siderophore production. Figure 1 ) Figure 1 In, the solid line represents the growth curve, the dashed line represents the siderophore production, the left y-axis represents OD 600 , and the right y-axis represents the siderophore production (%). The siderophore production of the WT::bfmR strain at 24 hours was 100%. Between 0 and 12 hours, the wild-type strain and the WT::bfmR strain produced only 22.5% and 76.7% of siderophores, respectively. After the initial 24 hours, the growth of both strains gradually slowed down. At 96 hours, the siderophore production of the wild-type strain and the WT::bfmR strain reached 53.2% and 136.6%, respectively. The above results indicate that the WT::bfmR strain constructed in the present invention can significantly improve the siderophore production.

[0140] Next, this example compared the siderophore production of the wild-type Pseudomonas aeruginosa strain and the constructed WT::bfmR strain under different osmotic pressures (medium: 40 mM succinate, 9.3 mM NH4Cl, 2.2 mM KH2PO4, 25 mM KNO3, 30 mM MOPS, pH 7.2; the total concentration of Na + in the medium ranged from 10 mM to 1 M, where 10 mM Na + represents low osmotic pressure, 150 mM Na + represents normal osmotic pressure, and 300 mM Na + represents high osmotic pressure)). The results are as Figure 2 shown. When the concentration of Na + and Cl - increased from 10 mM to 300 mM, the siderophore production of the wild-type strain (WT) and the WT::bfmR strain increased accordingly. However, when the Na + ion concentration exceeded 500 mM, the siderophore production of the wild-type strain (WT) and the WT::bfmR strain decreased accordingly, which may be due to the damage caused by high osmotic pressure during bacterial growth. The above results indicate that the WT::bfmR strain constructed in the present invention is more conducive to improving the siderophore production under an osmotic pressure of 150 mM to 500 mM (preferably 150 mM to 300 mM).

[0141] Next, this example compared the siderophore production of wild-type Pseudomonas aeruginosa strains and the constructed WT::bfmR strains at different initial pH values (medium: 40 mM succinate, 9.3 mM NH4Cl, 2.2 mM KH2PO4, 25 mM KNO3, 30 mM MOPS, 280 mM NaCl, pH ranging from 5.5 to 8.0). The results are as Figure 3 shown. When the initial pH was between 6.5 and 8.0, the siderophore production of the WT::bfmR strain was greater than that of the wild-type strain (WT), and the siderophore production reached the highest level at an initial pH of approximately 6.5. The above results indicate that the constructed WT::bfmR strain of the present invention is more conducive to enhancing siderophore production at an initial pH of 6.0 - 7.5.

[0142] Another important biological factor affecting siderophore production is the carbon source. This example compared the siderophore production of wild-type Pseudomonas aeruginosa strains and the constructed WT::bfmR strains in different carbon sources (medium: 9.3 mM NH4Cl, 2.2 mM KH2PO4, 25 mM KNO3, 30 mM MOPS, pH 6.5, and the carbon sources were 40 mM succinate, 2% w / v sucrose, 2% w / v glucose, 5% w / v glycerol, 40 mM succinate + 2% w / v sucrose, 40 mM succinate + 2% w / v glucose, 40 mM succinate + 5% w / v glycerol). The results are as Figure 4 shown. The WT::bfmR strain showed a higher level of siderophore production when using succinate or succinate + glycerol as the carbon source. The above data indicate that the high-osmolarity succinate medium is beneficial for improving siderophore production.

[0143] Example 3

[0144] To further verify the effect of the siderophore produced by the WT::bfmR strain overexpressing BfmR on iron absorption from the environment, this example further evaluated the ability of the WT and WT::bfmR strains to acquire iron from the environment.

[0145] First, different Pseudomonas aeruginosa strains were grown in an iron-deficient medium (medium: 40 mM succinate, 9.3 mM NH4Cl, 2.2 mM KH2PO4, 25 mM KNO3, 30 mM MOPS, pH 7.2) for 24 hours, and then 2 μM iron chloride was added to the medium and cultivation was continued for 6 hours. Figure 5Show the iron content in the culture supernatant of Pseudomonas aeruginosa. Different strains of Pseudomonas aeruginosa were first grown overnight in LB medium at 37 °C, then the cells of 1 mL of the culture were collected, washed three times with sterile PBS, and then resuspended in 1 mL of optimized medium (medium: 40 mM succinate, 9.3 mM NH4Cl, 2.2 mM KH2PO4, 25 mM KNO3, 30 mM MOPS, pH 6.5) and adjusted to an equivalent OD600. Then, the cells were added to 200 mL of the above optimized medium at a ratio of 1:100 and grown at 37 °C for 24 hours (220 rpm). Sterile iron chloride (FeCl3) solution was added to the culture and incubation continued for 6 hours. 10 mL of the sample was taken for iron determination, and the iron bound to Pseudomonas aeruginosa cells was measured ( Figure 6 ).

[0146] At Figure 5 any given time point, the iron content in the presence of Pseudomonas aeruginosa was lower than that of the control group. Notably, the WT::bfmR strain exhibited rapid iron scavenging ability. In the early stage (0 - 2 hours), its efficiency was 2 - 3 times that of the WT strain and reached equilibrium in only 1 hour, while the WT strain took 5 hours to reach a similar equilibrium. In contrast, compared with the WT and WT::bfmR strains, the ΔbfmR strain had significantly weaker iron uptake ability at all time points. Even after 6 hours, the ΔbfmR strain could not recover to the normal iron level, indicating that the knockout of the bfmR gene in Pseudomonas aeruginosa weakened its iron uptake ability.

[0147] In addition, this example also quantified the metals bound in Pseudomonas aeruginosa cells. The results showed ( Figure 6 ) that the WT::bfmR strain had significantly higher efficiency in absorbing Fe 3+ , and the absorption rate and saturation point were consistent with the trends observed in Figure 5 . Specifically, within 1 to 2 hours, the intracellular iron ions of the WT strain were 1.707 and 2.987 μM g -1 cells, significantly slower than that of the WT::bfmR strain (i.e., 2.770 and 3.290 μM g -1 cells). In contrast, the iron ion uptake ability of the ΔbfmR strain was weakened, and the intracellular iron ions were 1.055 and 1.302 μM g -1 cells within 1 to 2 hours. The above results showed that the WT::bfmR strain constructed in the present invention significantly accelerated and enhanced iron absorption, and it could effectively scavenge iron in the environment, demonstrating the potential of the bioremediation process for removing iron in contaminated sites, and thus could be used for the remediation of heavy metal pollution.

[0148] Specifically, within 1 to 2 hours, the intracellular iron ions of the WT strain were 1.707, 2.987, 3.175, 3.218, 3.200, 3.217 μM g -1 cells; the intracellular iron ions of the WT::bfmR strain were 2.770, 3.290, 3.440, 3.380, 3.570, 3.355 μM g -1 cells; the intracellular iron ions of the ΔbfmR strain were 1.055, 1.302, 1.757, 2.247, 2.525, 2.755 μM g -1 cells.

[0149] Example 4

[0150] Coal fly ash (CFA) is a large amount of solid waste generated by coal-fired power plants and is a waste containing potentially toxic elements (PTEs) and halides. Fly ash floating in water and soil usually consists mainly of spherical particles, and its chemical composition is amorphous silica and metal oxides such as Al2O3, Fe2O3, Fe3O4, TiO2, CaO, and MgO. In addition, there is evidence that iron-rich fly ash generates ROS through the Fenton chemical reaction in the human lung environment, thereby inducing human respiratory poisoning.

[0151] To test whether Pseudomonas aeruginosa can remove iron from solid waste, in this example, iron-rich fly ash was first treated with siderophores purified from WT and WT::bfmR strains (ddH2O as a negative control, siderophores were purified from 50 mL of bacterial culture supernatant, and the concentration of CFA was 5% w / v (200 mL)). As Figure 7a shown, the siderophores effectively released iron from solid fly ash into the solution. Compared with WT::bfmR, the purified WT siderophores showed 52.3% and 68.1% lower iron dissolution rates at 24 hours and 48 hours, respectively. Specifically, the iron concentrations of the WT strain group at 24 hours, 48 hours, and 72 hours were 1.355, 2.422, and 2.463 mg / L, respectively; the iron concentrations of the WT::bfmR strain group at 24 hours, 48 hours, and 72 hours were 2.588, 3.585, and 4.305 mg / L, respectively. The results showed that the iron concentration in the solution treated with WT siderophores reached the dissolution equilibrium within 48 hours, while the siderophores of the WT::bfmR strain group could continue to dissolve iron after 48 hours. The dissolved iron concentration in the sample containing CFA was below the detection limit, but the iron concentration in the sample containing CFA treated with EDTA was above the detection limit, indicating that the organometallic chelator may help release a small amount of iron, but its ability to dissolve iron is much lower than that of the WT::bfmR strain group.

[0152] To further evaluate the role of Pseudomonas aeruginosa in iron release from CFA, samples were cultured with Pseudomonas aeruginosa WT and WT::bfmR cells (bacterial addition was 3.8×10 6 CFU / mL, and the concentration of CFA was 5% w / v (200 mL)). After bacterial growth in iron-rich CFA, the iron concentration was measured in the supernatant. The preparation of bacteria was similar to that in Figure 5 .

[0153] In the first 24 hours of contact with CFA, the effects of WT and WT::bfmR on iron release were limited ( Figure 7b ), indicating that Pseudomonas aeruginosa needed some time to adapt to this unknown culture. Interestingly, rapid iron release was observed in the supernatant of the WT::bfmR strain, and within 48 to 72 hours, its efficiency of dissolving iron was 2.9 to 3.5 times higher than that of WT. Siderophore production assays also showed that WT::bfmR produced 3.7 to 4.2 times more siderophores in the supernatant at 48 hours and 72 hours respectively ( Figure 7c ). Therefore, compared with WT, iron dissolution and uptake were more accessible in the culture containing WT::bfmR. And succinate had little ability to dissolve iron. The above results showed that together with the high-affinity iron chelator produced in the culture containing CFA, WT::bfmR was able to promote iron removal from CFA and ecological restoration.

[0154] The embodiments of the present invention have been described above in conjunction with the accompanying drawings. However, the present invention is not limited to the above specific embodiments. The above specific embodiments are merely illustrative and not restrictive. Under the inspiration of the present invention, those of ordinary skill in the art can also make many forms without departing from the spirit and scope protected by the present invention and the claims. These all belong to the protection scope of the present invention.

Claims

1. A recombinant Pseudomonas aeruginosa, characterized in that, The recombinant Pseudomonas aeruginosa uses Pseudomonas aeruginosa as the starting strain and overexpresses the bfmR gene.

2. The recombinant Pseudomonas aeruginosa according to claim 1, characterized in that, The nucleotide sequence encoding the bfmR gene is shown in SEQ ID NO:

1.

3. The recombinant Pseudomonas aeruginosa according to claim 1, characterized in that, The Pseudomonas aeruginosa includes the Pseudomonas aeruginosa PA14 strain.

4. The recombinant Pseudomonas aeruginosa according to claim 1, wherein, The method for constructing the recombinant Pseudomonas aeruginosa includes: S101 Obtaining the bfmR gene fragment; S102 Obtaining the linearized pRK415 vector; S103 Connecting the bfmR gene fragment to the linearized pRK415 vector to obtain the pRK415-bfmR plasmid; S104 Transferring the pRK415-bfmR plasmid into the Pseudomonas aeruginosa to obtain the recombinant Pseudomonas aeruginosa.

5. A method for producing a siderophore, characterized in that, The method includes mixing and culturing the recombinant Pseudomonas aeruginosa according to any one of claims 1-4 with a first medium, and collecting the siderophore.

6. The method according to claim 5, characterized in that, The first medium is an iron-deficient medium.

7. The method according to claim 5, characterized in that, The carbon source in the first medium includes succinic acid or its salt.

8. Use of the recombinant Pseudomonas aeruginosa according to any one of claims 1-4 in the remediation of heavy metal pollution.

9. The use according to claim 8, characterized in that, The use includes remediating heavy metal pollution in soil, water bodies, and / or solid waste.

10. The use according to claim 8, characterized in that, The use includes dissolving iron oxides.

Citation Information

Patent Citations

  • Siderophore high-yielding strain and application thereof in terms of heavy metal remediation for farmland polluted soil

    CN106544306A