Sclerotinia sclerotiorum-related sRNA and application thereof
By targeting the sRNA ath-miR5658 of the SS1G_08750 gene, it inhibits the growth and development of SS1G_08750, solves the problems of environmental pollution and biological control caused by chemical control, and achieves efficient and green prevention and control of SSR.
Patent Information
- Application Number
- CN202510493100.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-18
- Publication Date
- 2025-07-22
AI Technical Summary
The prior art has problems of environmental pollution and drug resistance caused by chemical control in the prevention and control of sclerosis, and the effects of biological control methods are unstable and there is a lack of effective green prevention and control measures.
A specific small RNA (sRNA) ath-miR5658 targeted the regulation of the SS1G_08750 gene, inhibiting the growth and pathogenicity of SS1G_08750 through the RNA interference mechanism, and developing RNAi-based biopesticides.
It has achieved efficient prevention and control of sclerosis, reduced the risk of disease occurrence, provided a new strategy for green prevention and control, and achieved prevention and control efficiency of more than 50%.
Smart Images

Figure CN120350004A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of agricultural disease control, and specifically relates to an sRNA related to sclerotinia disease and its application. Background Art
[0002] Sclerotinia disease is a highly destructive global fungal plant disease that seriously threatens the yield and quality of various crops in agricultural production. Sclerotinia sclerotiorum is a saprophytic plant pathogenic fungus with a wide host range, which harms more than 400 plants such as rapeseed, soybean, sunflower, and kidney bean. The sclerotium is a special dormant structure formed by the pathogenic fungus of sclerotinia disease to resist harsh environments, and it has important biological and ecological significance in the fungal life cycle (such as growth and development) and disease cycle (such as primary infection). There are many types of fungi in nature that can form sclerotia, including plant pathogenic fungi (such as Sclerotinia in Ascomycota, Botrytis in Ascomycota, Rhizoctonia in Basidiomycota, and Sclerotium in Basidiomycota) and edible and medicinal fungi for health care (such as Cordyceps in Ascomycota and Wolfiporia in Basidiomycota). Based on the very important role of sclerotia in the occurrence and prevalence of various diseases caused by Sclerotinia sclerotiorum, Sclerotinia sclerotiorum is generally considered to be a model species of sclerotia-forming fungi.
[0003] At present, the prevention and control of sclerotinia disease mainly rely on chemical control, but due to problems such as drug resistance and environmental pollution, it threatens agricultural food safety. In addition, other control methods such as agricultural control and biological control also have problems such as unstable effects and high management requirements. Therefore, in order to break through the traditional prevention and control dilemmas and limitations of sclerotinia disease, emerging biotechnology will be expected to provide new options and solutions for the green prevention and control of sclerotinia disease.
[0004] With the development of research, sRNA (small RNA), as a class of non-coding RNA, can participate in various biological processes through regulatory mechanisms such as epigenetics. Recently, it has been found that a class of cross-kingdom sRNAs can break the boundaries between species and be transmitted between different species. After entering the recipient, these sRNAs regulate the expression of target genes specifically through the gene silencing regulatory mechanism RNAi (RNA interference), thereby participating in the regulation of molecular interactions between pathogens and hosts. Currently, it has been found that cross-kingdom RNAi of fungal origin enters host plants and participates in the interaction between Botrytis cinerea and Arabidopsis thaliana, thus enabling the infection of plant pathogens to cause diseases. Therefore, regulating the expression of such specific sRNAs is expected to affect the growth and development of fungi in order to interfere with the occurrence and epidemic of diseases and achieve the goal of reducing the damage of plant diseases. This disease control strategy using sRNAs through RNAi technology provides new ideas and methods for the green prevention and control of plant diseases and is expected to play an important role in future agricultural production. Therefore, it is of great theoretical and practical significance to discover a new sRNA involved in the growth, development and pathogenicity of Sclerotinia sclerotiorum and its functions. Summary of the Invention
[0005] To discover a new sRNA involved in the development of Sclerotinia sclerotiorum, the present invention provides an sRNA related to sclerotinia disease and its applications. The sRNA ath-miR5658 provided by the present invention targets the SS1G_08750 gene and is used to inhibit the growth, development and pathogenicity of Sclerotinia sclerotiorum, thereby achieving the effect of controlling sclerotinia disease.
[0006] The present invention provides an sRNA related to sclerotinia disease, the sRNA is ath-miR5658, and the nucleotide sequence of the ath-miR5658 is shown in SEQ ID NO.2, and its precursor sequence is shown in SEQ ID NO.1.
[0007] The present invention silences or inhibits the expression of the sRNA ath-miR5658, regulates its target gene, and inhibits the growth, development and pathogenicity of Sclerotinia sclerotiorum, thereby achieving the effect of controlling sclerotinia disease.
[0008] Furthermore, the target gene of the sRNA is selected from any one or a combination of several of SS1G_02470, SS1G_08750, SS1G_08090 and SS1G_11957;
[0009] The nucleotide sequence of SS1G_02470 is shown in SEQ ID NO.6;
[0010] The nucleotide sequence of SS1G_08750 is shown in SEQ ID NO.7;
[0011] The nucleotide sequence of SS1G_08090 is shown in SEQ ID NO.8;
[0012] The nucleotide sequence of SS1G_11957 is shown in SEQ ID NO.9.
[0013] The present invention also provides a mimic of sRNA, and the mimic is mir5658-STTM shown in SEQ ID NO.20.
[0014] The present invention also provides a product for silencing or knocking down sRNA ath-miR5658 related to Sclerotinia sclerotiorum, and the product uses the above-mentioned mir5658-STTM as an active ingredient.
[0015] The present invention also provides an application of the above-mentioned sRNA, the mimic of the sRNA or the product in the prevention and control of Sclerotinia sclerotiorum. By inhibiting the expression of sRNA, the growth, development and pathogenicity of Sclerotinia sclerotiorum are inhibited, and the occurrence of the disease is reduced.
[0016] Furthermore, by using the mimic of sRNA to target and negatively regulate the expression of target genes or competitively regulate the expression of related target genes, the regulatory function of sRNA is dysregulated, thereby inhibiting the growth and development of Sclerotinia sclerotiorum.
[0017] Furthermore, by silencing sRNA through the above-mentioned product, the growth, development and pathogenicity of Sclerotinia sclerotiorum are inhibited.
[0018] Furthermore, the above-mentioned application is to improve the control effect of plants against Sclerotinia sclerotiorum; the Sclerotinia sclerotiorum is caused by the infection of Sclerotinia sclerotiorum.
[0019] Furthermore, the plant is a plant infected with Sclerotinia sclerotiorum.
[0020] Furthermore, the plant is selected from any one of Cruciferae, Leguminosae and Compositae.
[0021] The present invention also provides an application of the above-mentioned sRNA in the breeding of plant varieties resistant to Sclerotinia sclerotiorum, for plants infected with Sclerotinia sclerotiorum.
[0022] Furthermore, the plant is selected from any one of Cruciferae, Leguminosae and Compositae.
[0023] The present invention also provides an application of the above-mentioned sRNA in the preparation of plant vaccines for preventing and controlling Sclerotinia sclerotiorum.
[0024] The present invention also provides an application of the above-mentioned sRNA in the screening of plant germplasms resistant to Sclerotinia sclerotiorum.
[0025] Compared with the prior art, the beneficial effects of the present invention are as follows:
[0026] The present invention provides an sRNA ath - miR5658 related to Sclerotinia disease, whose nucleotide sequence is shown in SEQ ID NO.2, and its precursor sequence is shown in SEQ ID NO.1. This sRNA targets and regulates the genes SS1G_02470, SS1G_08750, SS1G_08090, and SS1G_11957. By using sRNA mimics to affect the expression of sRNA, the growth, development, and pathogenicity of Sclerotinia sclerotiorum are regulated, achieving the effect of reducing the occurrence of Sclerotinia disease, providing a theoretical basis and technical support for the creation of RNAi - based biological pesticides.
[0027] The present invention acts on rape, soybean, and sunflower by spraying the mimic (mir5658 - STTM) of sRNA in an exogenous spraying manner, so that the control efficiency of the occurrence of Sclerotinia disease in rape, soybean, and sunflower reaches more than 50%. BRIEF DESCRIPTION OF THE DRAWINGS
[0028] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for the description of the embodiments or the prior art. Obviously, the following drawings are only some embodiments of the present invention. For those of ordinary skill in the art, other drawings can be obtained based on these drawings without creative efforts.
[0029] Figure 1 It is for the transcriptome - level expression and quantitative expression analysis of plant - derived sRNAs at different developmental stages of sclerotia (SI initial stage, SD development stage, SM mature stage); in the figure, A is the transcriptome - level expression analysis of plant - derived sRNA (ath - miR5658) at different developmental stages of sclerotia;
[0030] B is the quantitative qPCR expression analysis of plant - derived sRNA (ath - miR5658) at different developmental stages of sclerotia.
[0031] Figure 2 It is for the expression analysis of the target genes of plant - derived ath - miR5658 at different developmental stages of sclerotia (SI initial stage, SD development stage, SM mature stage);
[0032] In the figure, A is the quantitative qPCR expression analysis of the target gene SS1G_02470;
[0033] B is the quantitative qPCR expression analysis of the target gene SS1G_08750;
[0034] C is the quantitative qPCR expression analysis of the target gene SS1G_08090;
[0035] D is the quantitative qPCR expression analysis of the target gene SS1G_11957.
[0036] Figure 3 Observation of the effect of plant-derived ath-miR5658 on mycelial growth and sclerotium formation;
[0037] In the figure, A shows the sclerotium defect phenotype produced after inoculating the sclerotium-deficient strain S10 onto kidney beans;
[0038] B shows the phenotype of the inability to produce sclerotia in the sclerotium-deficient strain S10;
[0039] C shows the differential analysis of the quantitative PCR expression of plant-derived ath-miR5658 in the wild-type strain WT and the sclerotium-deficient strain S10;
[0040] D shows the mycelial growth 2 days after inoculating the wild-type strain WT and the sclerotium-deficient strain S10 on a PDA plate;
[0041] E shows the sclerotium formation 8 days after inoculating the wild-type strain WT and the sclerotium-deficient strain S10 on a PDA plate.
[0042] Figure 4 The effect of plant-derived ath-miR5658 on the pathogenic process and stress adaptability related to pathogenesis of Sclerotinia sclerotiorum;
[0043] In the figure, A shows the difference in lesion size caused at different times after inoculating the wild-type strain WT and the sclerotium-deficient strain S10;
[0044] B shows the growth difference between the wild-type strain WT and the sclerotium-deficient strain S10 inoculated into the treatment group (PDA medium containing stress adaptability-related reagents, including 0.3 M NaCl sodium chloride, 0.3 M KCl potassium chloride, 0.005% SDS sodium dodecyl sulfate, 300 μg / mL Congo Red CR Congo red, 300 μg / mL, 3 mM H2O2 hydrogen peroxide) and the control group (PDA without any stress adaptability-related reagents);
[0045] Figure 5 Discovery and annotation of differentially expressed genes affected by plant-derived ath-miR5658 at the transcriptome level;
[0046] In the figure, A shows the distribution of differentially expressed genes affected by plant-derived ath-miR5658 at the transcriptome level;
[0047] B shows the GO functional annotation of differentially expressed genes affected by plant-derived ath-miR5658;
[0048] C shows the KEGG pathway annotation of differentially expressed genes affected by plant-derived ath-miR5658.
[0049] Figure 6Clustering and quantitative expression analysis of the target gene SS1G_08750 of plant-derived ath-miR5658;
[0050] In the figure, A is the phylogenetic tree of the target gene SS1G_08750 of plant-derived ath-miR5658;
[0051] B is the quantitative qPCR expression analysis of the target gene SS1G_08750 of plant-derived ath-miR5658 at different developmental stages of mycelia (MV vegetative stage, MI initial stage, MD developmental stage, MM mature stage).
[0052] Figure 7 Sclerotium production and occurrence of sclerotinia blight caused by infection under the treatment of plant-derived ath-miR5658 mimics and sRNA quantitative expression analysis;
[0053] In the figure, A is the sclerotium production under the treatment of the plant-derived ath-miR5658 mimic mir5658-STTM and its control;
[0054] B is the control efficiency of sclerotinia blight of different crops (rape: Bn, soybean: Gm, sunflower: Ha) under the treatment of the plant-derived ath-miR5658 mimic mir5658-STTM and its control;
[0055] C is the quantitative qPCR expression analysis of sRNA under the treatment of the plant-derived ath-miR5658 mimic mir5658-STTM and its control. Detailed implementation mode
[0056] The following is a detailed description of the specific implementation mode of the present invention, but it should be understood that the protection scope of the present invention is not limited by the specific implementation mode. Based on the embodiments in the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts belong to the protection scope of the present invention. The experimental methods described in the embodiments of the present invention are all conventional methods unless otherwise specified. The materials, reagents, etc. used in the following embodiments can be obtained from commercial channels unless otherwise specified.
[0057] Example 1: Discovery of sRNA related to the epidemic of sclerotinia blight and its function.
[0058] I. Discovery and expression of plant-derived sRNA
[0059] By comparing the high-throughput sequencing data of Sclerotinia sclerotiorum small RNA (sRNA) with the plant-derived sRNA database, plant-derived sRNA in the fungus is discovered. The specific steps are as follows:
[0060] Total RNA was extracted from sclerotia formed by wild-type Sclerotinia sclerotiorum using Trizol (Takara), and its quality was analyzed using a NanoDrop spectrophotometer (Thermo Fisher) and an Agilent 2100 Bioanalyzer (Agilent). 100 μg of total RNA was electrophoresed on a 15% denaturing polyacrylamide gel to separate fragments sized 18 - 31 nt. Using the Illumina TruSeq small RNA kit (Illumina), adapters were specifically ligated to the 5′ and 3′ ends of the separated RNA to prepare a library, and deep sequencing was performed on the Illumina / Solexa platform (Wuhan Fraser). The obtained sequencing results were filtered and screened according to the following procedure: low-quality reads were removed, as well as reads with a high proportion of N and shorter than 17 nt, reads with contamination or polyA at the 5′ end, or reads without a primer or insertion tag at the 3′ end, to obtain clean sRNA sequences (Xia et al., 2029). These obtained sRNA sequences were subjected to in silico analysis by aligning with the miRBase and Rfam databases, and DESeq2 was used to identify plant-derived sRNAs. RNAfold was used to predict the precursor structure of the identified sRNAs. Using the pheatmap R package, significant differential expression of these identified plant-derived sRNAs was calculated (ratio < 1.5-fold change and p < 0.05 between any two developmental stages).
[0061] The wild-type Sclerotinia sclerotiorum strain numbered ACCC 35470 is preserved in the China Center for Agricultural Culture Collection.
[0062] The expression pattern of plant-derived sRNA (ath-miR5658) during sclerotial development was detected using quantitative qPCR analysis. sRNA was extracted from sclerotia at different developmental stages (SI initial stage, SD developmental stage, and SM mature stage) using EasyPure miRNA reagent (TransGen Biotech), and the extracted sRNA was reverse-transcribed using the TransScript miRNA First Strand cDNA Synthesis SuperMix kit (TransGen Biotech). Quantitative qPCR reactions were performed using the specific primer shown in SEQ ID NO.3 and the universal primer shown in SEQ ID NO.4.
[0063] SEQ ID NO.3: 5’-AUGAUGAUGAUGAAA-3’;
[0064] SEQ ID NO.4: 5’-GATCGCCTTCTACGTCGTAT-3’.
[0065] The 10 μL quantitative qPCR reaction system includes: 5 μL ChamQ SYBR qPCR Master Mix (Vazyme), 3 μL primer mixture (10 μM for each primer), and 2 μL template diluted 100-fold.
[0066] Reaction conditions: An initial denaturation step at 94 °C for 30 seconds; 40 cycles, with a reaction at 94 °C for 5 seconds and a reaction at 60 °C for 30 seconds. Relative expression analysis was performed using the 2-ΔΔCT method, with U6 as the internal reference. The U6 amplification primers include the specific primer shown in SEQ ID NO.5 and the universal primer shown in SEQ ID NO.4.
[0067] SEQ ID NO.5: 5’-CGATACAGAGAAGATTAGCATG-3’.
[0068] The results are as Figure 1 shown. Based on the currently available plant-derived sRNA database for comparison, 1 plant-derived sRNA was discovered to have a significantly different expression pattern during sclerotial development, named ath-miR5658. Its precursor sequence has the typical characteristics of sRNA, and its nucleotide sequence is as shown in SEQ ID NO.1, which can form a mature sRNA, and the sequence is as shown in SEQ ID NO.2. Through quantitative PCR analysis, with the reaction system and conditions the same as above, it was further clarified that the expression level (i.e., the in vivo accumulation level) of the plant-derived ath-miR5658 was relatively high at the initial stage of sclerotial formation (the initial stage of SI), as Figure 1 shown in A, indicating that the plant-derived ath-miR5658 is involved in sclerotial formation.
[0069] SEQ ID NO.1:
[0070] AGAUGAUGAUGAUGAUGAUGAAACAGAAUCAGUAAGAAGCUUCU UCUUCUUAGGAGGAGGAGGAAGAUUGGUUUCAUCAUCAUCACCAGUU GAA.
[0071] SEQ ID NO.2: AUGAUGAUGAUGAUGAUGAAA.
[0072] II. Prediction of Target Genes of Plant-Derived sRNAs and Their Regulatory Effects
[0073] Using the miRanda and RNAhybrid algorithms, the target genes of plant-derived sRNA (ath-miR5658) were predicted. It was found that there were four potential target genes for plant-derived ath-miR5658, namely SS1G_02470, SS1G_08750, SS1G_08090, and SS1G_11957. These genes are currently annotated as hypothetical proteins (molecules with only sequence information but unknown biological functions) in the NCBI database. In the UniProt database, only SS1G_08750 was predicted to be a C2H2-type protein, while the other three had no relevant annotations.
[0074] SS1G_02470:
[0075]
[0076] SS1G_08750:
[0077]
[0078] SS1G_08090:
[0079] ATGATATGCGAGGGAGGTATGAAGGAAGCAGATTTTGAGAAGATAACATTGAGATCTGAGGTAGGGGGAATGGATAACCCCAACCCCAAACCCAAACCCGGGCAGGCAGGCAGGCAAATAGCTAAATCCCACTCACATTCCGTACCCTTACCCTCCTCCTCCTCCTCCTCCTCCTTATCATCATCATCATCACCTAAAACACCTACTATATCACAACAAATATTCCGTGGTATTGGTATTGGTGTTGTTGAGGGTAAAGGAGAAGAAGAAAGTTGA(SEQ ID NO.8).
[0080] SS1G_11957:
[0081]
[0082] Using the quantitative qPCR analysis method, the expression patterns of target genes during sclerotial development were detected. Total RNA was extracted from sclerotia at different developmental stages (SI initial stage, SD developmental stage, and SM mature stage) using the Eastep Super Total RNA Extraction Kit (Promega). cDNA synthesis was performed using the GoScript Reverse Transcription System (Promega). Nucleic acid amplification was carried out using specific primers for the target genes SS1G_02470, SS1G_08750, SS1G_08090, and SS1G_11957, respectively. The reaction system and conditions were the same as above. Relative quantitative expression analysis was performed using the 2-ΔΔCT method, with actin as the internal reference.
[0083] The upstream primer of the target gene SS1G_02470 is shown as SEQ ID NO.10, and the downstream primer is shown as SEQ ID NO.11. The upstream primer of the target gene SS1G_08750 is shown as SEQ ID NO.12, and the downstream primer is shown as SEQ ID NO.13. The upstream primer of the target gene SS1G_08090 is shown as SEQ ID NO.14, and the downstream primer is shown as SEQ ID NO.15. The upstream primer of the target gene SS1G_11957 is shown as SEQ ID NO.16, and the downstream primer is shown as SEQ ID NO.17. The specific upstream primer of the actin internal reference is shown as SEQ ID NO.18, and the downstream primer is shown as SEQ ID NO.19.
[0084] SEQ ID NO.10: 5’-CCCCTTCATCCTACACCCTG-3’;
[0085] SEQ ID NO.11: 5’-CCACTCGAGAGCTTCTGCC-3’;
[0086] SEQ ID NO.12: 5’-CTGGGACTACTGATTCTACGGC-3’;
[0087] SEQ ID NO.13: 5’-CTTCCATCTCCTCACGCC-3’;
[0088] SEQ ID NO.14: 5’-CCCATATATCCCGTTGCCC-3’;
[0089] SEQ ID NO.15: 5’-GTTTGGGTTTGGGGTTGG-3’;
[0090] SEQ ID NO.16: 5'-GCATCTCGAATGGCAGC-3';
[0091] SEQ ID NO.17: 5'-GGATGTGAACTTCGGGGTG-3';
[0092] SEQ ID NO.18: 5'-AACTGGGATGATATGGAGAAG-3';
[0093] SEQ ID NO.19: 5'-GTTGGACTTTGGGTTGATTG-3'.
[0094] The results were as Figure 2 shown, and it was found that the expression pattern of the target gene was opposite to that of ath-miR5658, indicating that the plant-derived ath-miR5658 negatively regulated the expression of the target gene during sclerotial development.
[0095] III. The Influence of Plant-Derived sRNA on the Growth and Development of Sclerotinia sclerotiorum
[0096] To study the influence of plant-derived sRNA on the growth and development of Sclerotinia sclerotiorum, in accordance with the standard subculture protocol of the American Type Culture Collection (ATCC) strains, the wild-type Sclerotinia sclerotiorum (WT) strain was inoculated on PDA medium and cultured at 25 °C for 2 days. Mycelial plugs with a radius of 5 mm were cut from the colony edge using a puncher, and the mycelial plugs were transferred to another PDA petri dish and cultured for 2 days. Then, mycelial plugs with a radius of 5 mm were punched from the edge of the newly formed colony and transferred to a new dish for inoculation. This process of continuous dish transfer and subculture was repeated ten times, and a progeny strain S10 obtained through continuous subculture was obtained. Since the S10 strain showed an obvious phenotype of being unable to produce sclerotia, this strain was named the sclerotia-deficient strain S10.
[0097] To further confirm the phenotypic stability of the sclerotia-deficient strain S10 in terms of its inability to produce sclerotia, the conventional mycelial plug inoculation method of Sclerotinia sclerotiorum was used for inoculation, isolation, and symptom observation. Specifically, mycelial plugs (radius 5 mm) were cut from the colony of this strain growing on PDA using a puncher and inoculated on healthy kidney beans (Jiadouwang), and the production of sclerotia was observed.
[0098] The results were as Figure 3 shown in A. Compared with the wild-type Sclerotinia sclerotiorum (WT), the sclerotia-deficient strain S10 could infect but was unable to form sclerotia on kidney beans.
[0099] Use a sterile dissecting knife to cut diseased plant tissues. After treatment with 70% ethanol and washing with sterile water, place the treated diseased plant tissues on PDA medium for fungal isolation. After hyphae appear at the edge of the plant tissues, use a dissecting needle to pick up the PDA with hyphae and transfer it to a new PDA for cultivation, and continue to observe the production of sclerotia.
[0100] The results are as Figure 3 shown in B of , and the sclerotia-deficient strain S10 still shows the phenotypic defect of being unable to produce sclerotia, thus indicating the biological characteristics of the phenotypic stability of the sclerotia-deficient strain S10.
[0101] Using the quantitative qPCR analysis method, detect the expression of plant-derived ath-miR5658 in wild-type Sclerotinia sclerotiorum (WT) and the sclerotia-deficient strain S10. The results are as Figure 3 shown in C of . Compared with wild-type Sclerotinia sclerotiorum (WT), it was found that the in vivo accumulation of plant-derived ath-miR5658 in the sclerotia-deficient strain S10 was significantly reduced, indicating that the sclerotia-deficient phenotype is related to the decrease in the accumulation of plant-derived ath-miR5658.
[0102] In addition, compared with wild-type Sclerotinia sclerotiorum (WT), by observing the hyphal growth of the sclerotia-deficient strain S10 2 days after inoculation on a PDA plate and the production of sclerotia 8 days after inoculation on a PDA plate, the results are as Figure 3 shown in D of and E of 3. It was found that the sclerotia-deficient strain S10 showed slow hyphal growth rate and was unable to produce sclerotia and other phenotypic characteristics, indicating that the decrease in the accumulation of plant-derived ath-miR5658 affects the growth and development of Sclerotinia sclerotiorum.
[0103] IV. Plant-derived sRNAs affect the pathogenicity of Sclerotinia sclerotiorum and the stress adaptability related to pathogenesis
[0104] To further study the effect of plant-derived sRNAs on the pathogenic mechanism of Sclerotinia sclerotiorum, inoculate wild-type Sclerotinia sclerotiorum (WT) and the sclerotia-deficient strain S10 on kidney beans respectively using the mycelial block inoculation method. The specific inoculation steps are the same as above. After inoculation, observe the lesion size at different times and evaluate the occurrence of sclerotinia caused by the sclerotia-deficient strain S10. It was observed at different time points after inoculation that compared with wild-type Sclerotinia sclerotiorum WT, the lesions of the sclerotia-deficient strain S10 were significantly reduced. The results are as Figure 3 shown in C of .
[0105] In addition, evaluate the differences in the adaptability of wild-type Sclerotinia sclerotiorum (WT) and the sclerotia-deficient strain S10 to pathogenicity-related stresses. Specifically, inoculate the mycelia on the treatment group and the control group, and observe the relative mycelial growth amount 24 hours after inoculation. The formula for calculating the relative mycelial growth amount is: relative mycelial growth amount = treatment group / control group.
[0106] Treatment group: PDA medium containing stress adaptation-related reagents, and the stress adaptation-related reagents contain substances with the following final concentrations: 0.3 M NaCl (sodium chloride), 0.3 M KCl (potassium chloride), 0.005% SDS (sodium dodecyl sulfate), 300 μg / mL CR (Congo red), and 3 mM H2O2 (hydrogen peroxide).
[0107] Control group: PDA medium without any stress adaptation-related reagents.
[0108] The results are as Figure 4 shown in A and B of [reference], compared with the wild-type Sclerotinia sclerotiorum (WT), it was found that the lesion size of the sclerotial-deficient strain S10 was significantly reduced at different time points after inoculation, and the relative mycelial growth under stress conditions was significantly decreased, indicating that the pathogenicity of the sclerotial-deficient strain S10 was reduced and the disease progression was slowed down; at the same time, the stress adaptation ability related to pathogenicity was decreased, suggesting that the plant-derived ath-miR5658 is involved in regulating the pathogenicity and disease occurrence process of Sclerotinia sclerotiorum.
[0109] V. Molecular regulation mechanism of plant-derived sRNA
[0110] To further explore the molecular regulation mechanism involved in plant-derived ath-miR5658, comparative transcriptome analysis was performed using the wild-type Sclerotinia sclerotiorum (WT) and the sclerotial-deficient strain S10. The specific steps were as follows: Total RNA of the wild-type Sclerotinia sclerotiorum (WT) and the sclerotial-deficient strain S10 was extracted using RNAiso plus (Takara), and an RNA library was constructed using the Illumina TruSeqRNA Sample Preparation Kit (Illumina) and sequenced on the Illumina HiSeq 2500 platform (Annor). The raw sequencing reads were processed using Trimmermatic to remove adapter sequences and low-quality bases, the clean reads were aligned with the Sclerotinia sclerotiorum genome in the NCBI database using HISAT2, and transcript assembly and quantification were performed using StringTie (version 1.3.1). Differentially expressed genes (DEG fold > 1.5-fold) between the wild-type Sclerotinia sclerotiorum (WT) and the sclerotial-deficient strain S10 were compared using DESeq2 (version 1.16.1), and GO functions and KEGG pathways of the differentially expressed genes were annotated using Blast2GO.
[0111] The results are as Figure 5 shown in A of [reference], comparative transcriptome analysis found a total of 4503 differentially expressed genes, including 2240 up-regulated and 2263 down-regulated differentially expressed genes, among which the identified target gene (SS1G_08750) was included. GO functions and KEGG pathways of these differentially expressed genes were annotated, as Figure 5As shown in B of 5 and C of 5, it mainly includes GO functions such as proteolysis, nucleus regulation, and metal ion binding, as well as KEGG pathways such as transport and catabolism, carbohydrate metabolism, and signal transduction and senescence. These results indicate that plant-derived ath-miR5658 is involved in the growth, development, and pathogenicity of Sclerotinia sclerotiorum through multiple molecular regulatory networks.
[0112] Example 2: Identification and expression analysis of the target gene SsTF1 of plant-derived sRNA.
[0113] I. Clustering and expression of the target gene of plant-derived ath-miR5658
[0114] Phylogenetic analysis was performed using MEGA software. The expression patterns of wild-type Sclerotinia sclerotiorum (WT) mycelia at different developmental stages (MV vegetative stage, MI initial stage, MD developmental stage, MM mature stage) were detected by quantitative qPCR analysis method. Specifically, total RNA was extracted from mycelia at different developmental stages and reverse-transcribed into cDNA. Amplification was carried out using target gene-specific primers. The reaction system and conditions were the same as before. Relative quantitative expression analysis was performed using the 2-ΔΔCT method, with actin as the internal reference.
[0115] The results are as Figure 6 shown. The present invention found that the target gene SS1G_08750 of plant-derived ath-miR5658, named SsTF1, has a certain phylogenetic homology with a class of C2H2-type transcription factors (such as SS1G_06044) that have been identified. According to the existing research results, it is predicted that this target gene is involved in the growth, development, and pathogenicity of Sclerotinia sclerotiorum.
[0116] II. Artificial synthetic mimics of plant-derived sRNA
[0117] The sRNA mimic STTM was designed using the professional software GenePharma to ensure that it can mimic the function of natural sRNA. It was chemically synthesized by the solid-phase phosphoramidite method, and the analog was purified using HPLC technology to improve its purity. The synthetic plant-derived ath-miR5658 mimic STTM was named mir5658-STTM, and its nucleotide sequence is shown in SEQ ID NO.20.
[0118] SEQ ID NO.20:
[0119] AUCAUCAUCUACAUCAUCUUUGUUGUUGUUGUUAUGGUCUAAUU UAAAUAUGGUCUAAAGAAGAAGAAUUACAUCAUCAUCUACAUCAUC.
[0120] III. Application potential of plant-derived sRNA
[0121] To further explore the regulatory role of ath-miR5658 and the effect of its artificial synthetic mimics on the occurrence of sclerotinia rot, the mycelia of wild-type Sclerotinia sclerotiorum (WT) were used by the mycelial plug inoculation method and the sRNA mimic application method. Specifically, the mycelial plugs of Sclerotinia sclerotiorum were inoculated into important representative crops damaged by sclerotinia rot (Cruciferae: rapeseed, Leguminosae: soybean, and Compositae: sunflower). Subsequently, a sterile aqueous solution containing 0.2 μM mimic mir5658-STTM (treatment group) and sterile water without mimic (control group) were sprayed on the inoculation sites. Then, the lesion sizes were observed to evaluate the effect of the plant-derived ath-miR5658 mimic on the occurrence of sclerotinia rot caused by Sclerotinia sclerotiorum. Accordingly, by exogenous application of mir5658-STTM, the content of ath-miR5658 will be reduced, that is, the expression of ath-miR5658 is decreased, which is equivalent to the knockdown regulation of plant-derived ath-miR5658. In addition, by quantitative qPCR analysis method, the expression of sRNA and its target genes were detected to evaluate the interference effect and application potential of mimic mir5658-STTM on plant-derived ath-mir5658.
[0122] The results are as Figure 7 shown. Compared with the control group, the treatment with the plant-derived ath-miR5658 mimic mir5658-STTM caused a reduction in the sclerotia production of Sclerotinia sclerotiorum, and the lesions caused by the infection of Sclerotinia sclerotiorum on the inoculated rapeseed, soybean, and sunflower all became smaller. Accordingly, the control efficiency of sclerotinia rot occurrence in these three crops reached more than 50%. In addition, quantitative detection found that the treatment with the plant-derived ath-miR5658 mimic mir5658-STTM could reduce the expression of ath-mir5658.
[0123] These results indicate that the artificially synthesized plant-derived ath-miR5658 mimic can be applied based on RNAi technology, adsorbed by Sclerotinia sclerotiorum through spraying, interfere with plant-derived ath-miR5658, affect the regulatory role of ath-miR5658, and then affect the development and pathogenicity of Sclerotinia sclerotiorum, so as to achieve the reduction of the risk of sclerotinia rot occurrence, which will contribute to the development of RNA biological pesticides to realize a new strategy for the green prevention and control of sclerotinia rot.
[0124] Although the preferred embodiments of the present invention have been described, those skilled in the art can make additional changes and modifications to these embodiments once they know the basic creative concept.
[0125] Obviously, those skilled in the art can make various changes and deformations to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and deformations of the present invention fall within the scope of the claims of the present invention and their equivalent technologies, the present invention also intends to include these modifications and deformations.
Claims
1. An sRNA related to sclerotinia disease, characterized in that, The sRNA is ath-miR5658, and the nucleotide sequence of ath-miR5658 is shown in SEQ ID NO.2, and its precursor sequence is shown in SEQ ID NO.
1.
2. The sRNA related to Sclerotinia sclerotiorum according to claim 1, characterized in that, The target gene of the sRNA is selected from any one or a combination of several of SS1G_02470, SS1G_08750, SS1G_08090, and SS1G_11957; The nucleotide sequence of SS1G_02470 is shown in SEQ ID NO.6; The nucleotide sequence of SS1G_08750 is shown in SEQ ID NO.7; The nucleotide sequence of SS1G_08090 is shown in SEQ ID NO.8; The nucleotide sequence of SS1G_11957 is shown in SEQ ID NO.
9.
3. An analog of sRNA, characterized in that, The mimic is the mimic of ath-miR5658 in claim 1, and the mimic is mir5658-STTM shown in SEQ ID NO.
20.
4. A product for silencing or knocking down sRNA ath-miR5658 related to Sclerotinia sclerotiorum, characterized in that, The product uses the mir5658-STTM described in claim 3 as an active ingredient.
5. Use of the sRNA related to sclerotinia rot according to claim 1, the mimic of the sRNA according to claim 3, or the product according to claim 4 in the prevention and control of sclerotinia rot, characterized in that, By inhibiting the expression of sRNA, the growth, development and pathogenicity of Sclerotinia sclerotiorum are inhibited, and the occurrence of diseases is reduced.
6. The application according to claim 5, characterized in that, By using the mimic of sRNA to target and negatively regulate the expression of the target gene or competitively regulate the expression of the related target gene, the regulatory function of sRNA is dysregulated, thereby inhibiting the growth and development of Sclerotinia sclerotiorum.
7. The application according to claim 5, characterized in that By silencing sRNA with the product, the growth, development and pathogenicity of Sclerotinia sclerotiorum are inhibited.
8. The application according to claim 5, wherein The application is to improve the control effect of plants against Sclerotinia sclerotiorum; the Sclerotinia sclerotiorum is caused by the infection of Sclerotinia sclerotiorum.
9. Use of the sRNA according to claim 1 in breeding of plant varieties resistant to Sclerotinia sclerotiorum, characterized in that, The plant is a plant infected with Sclerotinia sclerotiorum.
10. An application of the sRNA according to claim 1 in the preparation of a plant vaccine for preventing and treating Sclerotinia sclerotiorum.