Phalaenopsis amabilis gene PeARF3 for regulating phalaenopsis amabilis interstitial growth and application thereof
Through genetic engineering, the growth of Phalaenopsis and the down-regulation of expression of PeARF3 gene was solved, and the problem of unclear development mechanism of Phalaenopsis was cultivated, and more ornamental Phalaenopsis varieties were cultivated, which improved the flower distance formation rate.
Patent Information
- Application Number
- CN202411960501.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-30
- Publication Date
- 2025-07-22
- Estimated Expiration
- 2044-12-30
AI Technical Summary
In the prior art, the development mechanism of the distance between Phalaenopsis is unclear, making it difficult to breed more ornamental Phalaenopsis varieties through breeding.
Through genetic engineering, the pCymMv virus plasmid was constructed using the Phalaenopsis gene PeARF3 and transformed to Agrobacterium nodules EHA105, infecting Phalaenopsis leaves, downregulating the expression of PeARF3, and regulating flower distance growth.
The Phalaenopsis variety with higher ornamentality was successfully cultivated, providing theoretical basis and new ideas for the directional improvement of Phalaenopsis variety in the future, and significantly improving the flower distance formation rate.
Smart Images

Figure CN120350018A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of genetic engineering, and particularly relates to a Phalaenopsis gene PeARF3 for regulating the growth of Phalaenopsis flower spurs and its application. Background Art
[0002] Orchid flowers have unique morphologies and structures, making them not only popular in horticulture but also of great biological significance. Phalaenopsis orchids are known as the "queen of orchids" among tropical orchids and are very popular for their noble and elegant appearance and long flowering period. They are suitable for beautifying living rooms and bedrooms, have high ornamental value, and sell well in domestic and foreign markets. Orchid flowers play many roles in nature, including attracting pollinators, symbiotic relationships with insects, and occupying dominant ecological niches.
[0003] A flower spur is a conical or sac-like hollow protrusion structure extending from floral organs such as petals and sepals of angiosperms, usually containing nectar, and is also called a nectar spur. Flower spurs play important biological roles in plants, especially in relation to interactions with pollinators. The formation and development process of flower spurs involve a series of complex cellular and molecular mechanisms. Research shows that the development process of flower spurs can be roughly divided into two stages: first, cell division is concentrated around the position where the flower spur forms to form the initial shape of the flower spur; subsequently, cell division gradually stops, and the growth of the flower spur is promoted through the morphological elongation of cells until flowering. In terms of molecular mechanisms, some genes are considered to be involved in the formation of flower spurs, such as members of the KNOTTED1-like homeobox (KNOX) gene family, which play important roles in regulating the morphogenesis of plant organs. However, it is not yet clear which genes regulate the formation of flower spurs in orchids. However, the appearance of flower spurs is not a common phenomenon in orchids. For example, orchids in the genus Angraecum have very long flower spurs, while orchids in the genus Phalaenopsis do not have flower spurs. This may be related to a specific evolutionary history. In addition, as transcription factors, auxin response factors (ARFs) regulate the expression of early auxin response genes by specifically binding to auxin response elements. ARF proteins contain three conserved domains: a DNA binding domain (DBD), a middle region (MR), and a Phox and Bem1 (PB1). Auxin plays a key role in the process of flower development. In roses, it was found that the silencing of RhARF18 upregulated the expression of RhAG, resulting in the homeotic transformation from petals to stamens. In columbine, it has been reported that AqARF6 and AqARF8 are involved in the establishment of flower spurs. ARF family transcription factors may play important roles in the establishment of orchid flower spurs. Therefore, breeding Phalaenopsis based on molecular biology to cultivate Phalaenopsis with more beautiful flower shapes and higher ornamental value has attracted the attention of many scientific researchers. Summary of the Invention
[0004] The object of the present invention is to provide a gene PeARF3 for regulating the growth of the spur of Phalaenopsis and its application, to explore the mechanism of spur development of Phalaenopsis through genetic engineering means and cultivate Phalaenopsis with excellent varieties, so that Phalaenopsis is more ornamental, and to provide a theoretical basis and new ideas for the directional improvement of Phalaenopsis varieties in the future.
[0005] In the first aspect of the present invention, there is provided a gene PeARF3 for regulating the growth of the spur of Phalaenopsis, and the gene PeARF3 has a nucleotide sequence as shown in SEQ ID NO.1.
[0006] In the second aspect of the present invention, there is provided a viral plasmid, and the viral plasmid includes the above gene PeARF3.
[0007] Furthermore, the viral plasmid is a pCymMv viral plasmid including the gene PeARF3.
[0008] In the third aspect of the present invention, there is provided a recombinant transformant, and the recombinant transformant includes the above viral plasmid.
[0009] Furthermore, the recombinant transformant is Agrobacterium tumefaciens EHA105 including the viral plasmid.
[0010] In the fourth aspect of the present invention, there is provided the application of the above gene PeARF3, viral plasmid and recombinant transformant in regulating the growth of the spur of Phalaenopsis.
[0011] In the fifth aspect of the present invention, there is provided a method for regulating the growth of the spur of Phalaenopsis, including down-regulating the expression of the gene PeARF3 in the lip of Phalaenopsis.
[0012] Furthermore, down-regulating the expression of the gene PeARF3 in the spur of Phalaenopsis specifically includes:
[0013] Connecting the gene PeARF3 to a pCymMv viral plasmid to construct a viral plasmid;
[0014] Transforming the viral plasmid into Agrobacterium tumefaciens EHA105 to obtain a recombinant transformant;
[0015] Using the recombinant transformant to infect the leaves of Phalaenopsis and culturing to obtain Phalaenopsis with down-regulated expression of the gene PeARF3.
[0016] Furthermore, the Phalaenopsis is 'Cherry Tomato' Phalaenopsis.
[0017] Furthermore, the culturing includes: shading the Phalaenopsis for 12 h and then restoring the light, and culturing at 23 °C, and observing the growth of the spur.
[0018] Compared with the prior art, the present invention utilizes the gene PeARF3 of Phalaenopsis to explore the development mechanism of the spur of Phalaenopsis and cultivate Phalaenopsis with excellent varieties through genetic engineering means, so as to make Phalaenopsis more ornamental, providing a theoretical basis and new ideas for the future directional improvement of Phalaenopsis varieties. BRIEF DESCRIPTION OF THE DRAWINGS
[0019] Figure 1 is the phylogenetic tree of ARF3;
[0020] Figure 2 is the amino acid sequence alignment of PeARF3 with homologous proteins in Arabidopsis thaliana, rice, and maize;
[0021] Figure 3 is the expression of PeARF3 in various organs of the lip;
[0022] Figure 4 is the growth of the spur after the pCymMv-PeARF3 vector is transferred into Phalaenopsis;
[0023] Figure 5 is the proportion of the number of flowers with regenerated spurs on the lip to the total number of flowers after the pCymMv-PeARF3 vector is transferred into Phalaenopsis;
[0024] Figure 6 is the expression levels of the CP protein-coding gene and PeARF3 in various organs of EV and pCymMv-PeARF3;
[0025] Figure 7 Expression of polarity-related genes in the lip part of CymMv-PeARF3 compared with the control strain. DETAILED DESCRIPTION OF THE EMBODIMENTS
[0026] To make the objectives, technical solutions, and advantages of the present invention clearer, the following will combine the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, rather than all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts shall fall within the protection scope of the present invention.
[0027] For the experimental methods without specific conditions in the following embodiments, they are usually in accordance with conventional conditions, such as the conditions described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or the conditions recommended by the manufacturer. The reagents used, unless otherwise specified, are all commercially available or reagents that can be obtained through public channels.
[0028] Example 1: Obtaining the Phalaenopsis gene PeARF3
[0029] The total RNA of Phalaenopsis leaves of cherry tomato was extracted using the kit RNAplant (commercially available) with reference to the operating steps of the RNAprep Pure Plant Plus Kit (Polysaccharides&Polyphenolics-rich) manual. The total RNA was reverse transcribed into cDNA using a reverse transcription kit (commercially available). According to the genomic sequencing results, primers were designed (5’→3’ F (SEQ ID NO.2): ATGGGGATCGATCTGAACACG; 3’→5’ R (SEQ ID NO.3): TCAAGCAAGCTCCGGGAGATTAA). A 2160bp band was amplified from the cDNA by RT-PCR. The PCR product was recovered to obtain the gene PeARF3, and its nucleotide sequence is shown in SEQ ID NO.1.
[0030] Example 2: Sequence analysis of the PeARF3 gene
[0031] To clarify the phylogenetic relationship between the PeARF3 gene and homologous genes in model plants, we downloaded the amino acid sequence of PeARF3 in Phalaenopsis of cherry tomato from NCBI, searched for homologous sequences of the PeARF3 gene in NCBI, and used the software MEGA to perform a coding amino acid alignment of homologous sequences and construct a phylogenetic tree ( Figure 1 ), and analyzed the homology with ARF family members in Arabidopsis thaliana, rice, and maize. The results showed that PeARF3 had a relatively high similarity with AtARF3 in Arabidopsis thaliana, and the homology was about 34.87% ( Figure 2 ).
[0032] Example 3: Analysis of the expression level of the PeARF3 gene
[0033] To characterize the expression of PeARF3 in various tissues of the lip, the lower epidermis, lateral lobes, and callus were isolated from the lip of Phalaenopsis "cherry tomato" as templates. Primers PeARF3-F (SEQ ID NO.4): 5’-CAGGCCATGGATGCACTAGA-3’ and PeARF3-R (SEQ ID NO.5): 5’-AGTTGGTGAGAACGTAACCTCA-3’ were used to detect the expression level of the PeARF3 gene. The following procedure was used: pre-denaturation at 98°C for 30s, followed by 40 cycles (98°C for 10s, 58°C for 30s), and extension at 72°C for 10 min. The operation was carried out according to the instructions of the HiscriptII QRT SuperMix for qPCR (+gDNAwiper) (Vazyme Biotech Co., Ltd) kit.
[0034] The lateral lobes, callus, and lower epidermis on the lip of the Phalaenopsis aphrodite 'Cherry Tomato' flower were taken, and the expression of the PeARF3 gene was quantified( Figure 3 ). The results showed that the expression of the PeARF3 gene in the callus was significantly higher than that in the lower epidermis and lateral lobes, indicating that the PeARF3 gene may play a role in the formation of the callus. It also implies that without being silenced in the lower epidermis, it will not induce the formation of flower spur-like organs.
[0035] Example 4 Silencing of the gene PeARF3 using the pCymMv virus
[0036] (1) Using the gene PeARF3 as a template, VIGS primers were designed (5’→3’F(SEQ ID NO.6): CTTCCAAGGAAGGGGAGCTT; 3’→5’R(SEQ ID NO.7): CATATGCGGAAC TGGGGATTGG), and this part of the sequence was ligated to the pCymMv virus plasmid to form a virus plasmid.
[0037] (2) The virus plasmid was transferred into Agrobacterium tumefaciens EHA105, and the bacterial solution was obtained by culturing. The bacterial solution was injected into the leaves of Phalaenopsis aphrodite 'Cherry Tomato' by injecting the leaves. The gene PeARF3 was silenced by the method of virus-induced gene silencing (VIGS). At the same time, a control group of pCymMv empty bacterial solution was set for injection, that is, the virus pCymMv vector without the gene PeARF3 was transformed into Agrobacterium tumefaciens EHA105.
[0038] (3) After leaf infection, the Phalaenopsis aphrodite was shaded for 12 h and then restored to normal light, and cultured in an environment at 23 °C.
[0039] (4) Observe the growth of the organs on the back of the lip, and observe once every seven days. The observation results are as Figure 4 shown. It can be seen that there are significant differences in the growth of flower spurs between the plants of the experimental group pCymMv-PeARF3 and the control group CK plants. Finally, the percentage of flower spur mutations was analyzed based on the total number of petals and the number of flower spurs produced. The experimental group pCymMv-PeARF3 was significantly higher than the control group, with an average of 30%( Figure 5 ). Example 5 Analysis of the expression of the PeARF3 and CP protein-coding genes in the pCymMv-PeARF3-silenced Phalaenopsis aphrodite lines
[0040] Example 5 Analysis of the expression of the PeARF3 and CP protein-coding genes in the pCymMv-PeARF3-silenced Phalaenopsis aphrodite lines
[0041] 1. cDNA Preparation of Materials
[0042] Using the pCymMv-PeARF3 silenced line and the wild-type control line of Phalaenopsis "Cherry Tomato" as controls for each other. Respectively, select 200 mg of each part of the upper lip of the flower, namely the lower epidermis, callus, and lateral lobes of the lip, and extract RNA using the operating steps in the instruction manual of RNAprepPure Plant Plus Kit (Polysaccharides&Polyphenolics-rich). Then use HiScript II Enzyme Mix to prepare cDNA from the obtained RNA.
[0043] 2. Gene Expression Verification
[0044] To characterize the expression of PeARF3 in each organ of the lip in the silenced line and the accumulation of the viral CP protein, using the pCymMv-PeARF3 silenced line and the control line of Phalaenopsis "Cherry Tomato" as templates, and using primers PeARF3-F: 5’-CAGGCCATGGATGCACTAGA-3’ and PeARF3-R: 5’-AGTTGGTGAGAACGTAACCTCA-3’, CP-RT-F (SEQ ID NO.8):
[0045] 5’-GCCTGCTGAATGGCAGCG-3’ and CP-RT-R (SEQ ID NO.9): 5’-TCGGCAATGTTGGTGATGAGG-3’, detect the expression levels of PeARF3 and CP genes in the two lines. Use the following program: pre-denaturation at 98°C for 30 s, then through 40 cycles (98°C for 10 s, 58°C for 30 s), and extension at 72°C for 10 min. The operation is carried out according to the instruction manual of HiscriptIIQRT SuperMix for qPCR (+gDNA wiper) (Vazyme Biotech Co., Ltd) kit. The results show that in each part of the lip in the silenced line, whether it is the lateral lobe, callus or lower epidermis, the expression level of CP is significantly higher than that in the control line ( Figure 6 ). This indicates that the CymMV virus accumulates in large amounts in the silenced line and the virus works normally. While the expression level of PeARF3 in the lower epidermis, lateral lobes and callus of the lip is significantly decreased compared with the control line, which indicates that the expression of PeARF3 is silenced ( Figure 6 ). It shows that the PeARF3 gene may be involved in controlling the development of the lip and may play an important role in the formation of the nectary.
[0046] Analysis of the Expression of Genes Related to the Polarity Network in the Callus of the pCymMv-PeARF3 Silencing Line of Phalaenopsis
[0047] The polarity network genes of plants play important roles in the morphological establishment of plant organs and there are regulatory relationships among them. The callus on the lip of the flower of Phalaenopsis "Cherry Tomato" was taken to quantify the expression of PeARF3, PeARF4, PeKAN2, PeHOX32, PeYABBY2, and PeYABBY5 in the polarity network of Phalaenopsis. The results showed that the expression levels of the adaxial genes PeARF3, PeARF4, PeHOX32, PeYABBY2, and PeYABBY5 were all down-regulated ( Figure 7 ), suggesting that the formation of the organ similar to the spur might be due to the inhibition of the expression of genes related to the polarity network on the lip.
[0048] In summary, when the gene PeARF3 in the Phalaenopsis plant is silenced, an organ similar to the spur is induced on the back of the lip, providing a theoretical basis and new ideas for the future directional improvement of Phalaenopsis varieties.
[0049] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those of ordinary skill in the art should understand that they can still modify the technical solutions described in the foregoing embodiments, or perform equivalent replacements on some or all of the technical features; and these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.
Claims
1. A gene PeARF3 for regulating the growth of the spur of Phalaenopsis aphrodite, characterized in that, The gene PeARF3 has a nucleotide sequence as shown in SEQ ID NO.
1.
2. A viral plasmid, characterized in that, The viral plasmid includes the gene PeARF3 described in claim 1.
3. The viral plasmid according to claim 2, characterized in that, The viral plasmid is the pCymMv viral plasmid including the gene PeARF3.
4. A recombinant transformant, characterized in that, The recombinant transformant includes the viral plasmid described in any one of claims 2-3.
5. The recombinant transformant according to claim 4, wherein, The recombinant transformant is Agrobacterium tumefaciens EHA105 including the viral plasmid.
6. Use of the gene PeARF3 described in claim 1 in regulating the growth of the spur of Phalaenopsis aphrodite.
7. A method for regulating the growth of the nectary of Phalaenopsis aphrodite, characterized in that, By down-regulating the expression of the gene PeARF3 in the lip of Phalaenopsis aphrodite.
8. The method according to claim 7, wherein Down-regulating the expression of the gene PeARF3 in the leaves of Phalaenopsis aphrodite specifically includes: Connecting the gene PeARF3 to the pCymMv viral plasmid to construct a viral plasmid; Transforming the viral plasmid into Agrobacterium tumefaciens to obtain a recombinant transformant; Using the recombinant transformant to infect the leaves of Phalaenopsis aphrodite and culturing to obtain Phalaenopsis aphrodite with down-regulated expression of the gene PeARF3.
9. The method according to claim 7 or 8, characterized in that, The Phalaenopsis aphrodite is 'Cherry Tomato' Phalaenopsis aphrodite.
10. The method according to claim 8, characterized in that, The culturing includes: Performing shading treatment on Phalaenopsis aphrodite for 12 h and then restoring light, and culturing at 23 °C, and observing the growth of the spur.
Citation Information
Patent Citations
Gene PeNGA for regulating and controlling growth of butterfly orchid leaves, virus plasmid, recombinant transformant and application
CN116218871A
Gene PeCYC1 for breaking dormancy of axillary buds of phalaenopsis, virus plasmid, recombinant transformant and application
CN116479004A
Cited By
Chinese orchid growth regulation gene CsARF4 as well as coding sequence and application thereof
CN120988089A
Csarf4 gene, coding sequence and application thereof
CN120988089B