Application of broccoli BoMYC2 gene in regulation and control of thioglycoside biosynthesis

Abstract

The invention discloses application of a broccoli BoMYC2 gene in regulation and control of thioglycoside biosynthesis, and belongs to the technical field of genetic engineering.Overexpression and interference expression of broccoli transgenic plants are obtained by genetic transformation of the BoMYC2 gene, thioglycoside detection results show that the content of thioglycoside in broccoli is reduced by overexpression of the BoMYC2 gene, and the yield of the broccoli is improved. The increase of the glucosinolate content in the broccoli through interference expression proves that the BoMYC2 gene is a key gene for glucosinolate accumulation in the broccoli. The discovery enriches the understanding of a thioglycoside synthesis mechanism, and also provides a theoretical basis for broccoli high-thioglycoside breeding.

Description

Technical Field

[0001] The present invention belongs to the technical field of genetic engineering, and specifically relates to the application of the broccoli BoMYC2 gene in regulating the biosynthesis of glucosinolates. Background Art

[0002] Glucosinolates (abbreviated as glucosinolates) are sulfur-containing secondary metabolites widely present in cruciferous plants (such as rapeseed, cabbage, radish, etc.), and have important biological functions and application values. Their diversity and the complexity of metabolites make them of great significance in plant adaptation to the environment, human health and agricultural production. Future research will focus on precisely regulating glucosinolate metabolism, optimizing its health benefits, and promoting its innovative applications in the fields of food, medicine and environmental protection.

[0003] MYC2 encodes a bHLH transcription factor and is a key regulator of the jasmonic acid (JA) signaling pathway. MYC2 binds to the G-box site in the promoter of jasmonic acid-responsive genes and induces the expression of JAZ genes in a negative feedback loop. It has been found that GbMYC2_4 and GbMYC2_5 in Ginkgo biloba can be strongly induced by methyl jasmonate (MeJA). Overexpression of GbMYC2_4 and GbMYC2_5 in Ginkgo biloba increased the content of terpenoids and up-regulated the expression of key enzyme genes in multiple terpenoid synthesis pathways such as GGPPS, indicating that MYC2 positively regulates the biosynthesis of terpenoids. In citrus and distant germplasms of Rutaceae such as Zanthoxylum bungeanum and Murraya exotica, MYC2 and its interacting E3 ubiquitin ligase PUB21 form a disease resistance regulatory hub, activating multiple disease resistance protein and secondary metabolite synthesis pathways, enabling citrus to obtain high resistance or even immunity to Huanglong disease. In Salvia miltiorrhiza, SmbHLH60 is a negative regulator of the biosynthesis of phenolic acids and anthocyanins, and SrnbHLH60 and SmMYC2 regulate the biosynthesis of secondary metabolites in Salvia miltiorrhiza in a competitive antagonistic manner. In addition, the MYC2 gene is also involved in the response of plants to other stress conditions, such as participating in drought stress, salt stress and pest and disease defense by regulating the jasmonic acid (JA) signaling pathway and other hormone pathways; it also plays an important role in the process of plant growth and development, such as regulating the flowering time and root growth of plants.

[0004] Broccoli (Brassica oleracea var. italica) belongs to the Brassica genus of the Brassicaceae family and is a type of cabbage. Its edible product is the green flower head, which is rich in glucosinolates, vitamins, and antioxidants, and is an important part of a healthy diet. Currently, the main cultivated varieties of broccoli in China mainly rely on foreign introductions, while the domestic wild germplasm resources are relatively scarce, resulting in great challenges in cultivating broccoli varieties with wide adaptability, strong disease resistance, and excellent quality. In this context, molecular breeding technology provides an effective way for broccoli quality improvement. By regulating the biosynthesis of glucosinolates through molecular breeding means, not only can the disease resistance of broccoli be significantly improved, but its nutritional quality can also be further optimized, which has important application value. However, the regulatory mechanism of glucosinolate biosynthesis is not fully understood, especially the role of the BoMYC2 gene in it has not been systematically studied. In the existing technology, the efficiency of increasing the glucosinolate content through traditional breeding methods is low, and it is difficult to accurately regulate. The existing technology mainly focuses on the regulatory roles of other genes (such as MYB28, MYB29). However, there is currently no research on the relationship between the MYC2 gene in broccoli and glucosinolate synthesis. The research on the MYC2 gene varies in depth in different plants, and its functions and regulatory mechanisms in some crops still need to be further explored, and its complex interactions with other genes and signal pathways also need to be more comprehensively and systematically analyzed. By exploring the function and mechanism of the BoMYC2 gene in broccoli glucosinolate synthesis, a new way is provided for cultivating broccoli varieties with high nutrition or resistance to pests and diseases. Summary of the Invention

[0005] The purpose of the present invention is to provide the application of the broccoli BoMYC2 gene in regulating the biosynthesis of glucosinolates.

[0006] To achieve the above purpose, the technical solution of the present invention is as follows:

[0007] The present invention has found a broccoli BoMYC2 gene, and the CDS sequence of the BoMYC2 gene is shown in SEQ ID NO.1. It is 1833 bp in length, including 610 amino acids, and the amino acid sequence is shown in SEQ ID NO.2.

[0008] The present invention uses genetic transformation technology to overexpress and interfere with the BoMYC2 gene in broccoli respectively. By analyzing the glucosinolate content in the transgenic materials, the results prove that compared with wild-type broccoli, the glucosinolate content in the overexpressing lines of broccoli is significantly reduced, while the glucosinolate content in the gene interference lines of broccoli is significantly increased. This indicates that the BoMYC2 gene plays an important role in regulating the biosynthesis of glucosinolates.

[0009] The present invention also constructs a series of plant expression vectors, and the functions of the expression vector, recombinant vector or transgenic plant line containing the above-mentioned gene, as well as the host cell containing the vector in regulating the glucosinolate biosynthesis in plants also fall within the protection scope of the present invention.

[0010] The functions of the genes protected by the present invention not only include the above-mentioned BoMYC2 gene, but also include the functions of homologous genes having a high homology (homology higher than 80%) with the BoMYC2 gene in regulating the glucosinolate biosynthesis in plants.

[0011] According to the functions of the above-mentioned BoMYC2 gene, the present invention provides a method for increasing the glucosinolate content in broccoli, and the method is as follows (1) or (2):

[0012] (1) By reducing the activity of the BoMYC2 protein in the target plant, a plant with increased glucosinolate content is obtained;

[0013] (2) By inhibiting the expression of the BoMYC2 gene in the target plant, a plant with increased glucosinolate content is obtained; the CDS sequence of the BoMYC2 gene is as shown in SEQ ID NO.1, and the amino acid sequence of the BoMYC2 protein is as shown in SEQ ID NO.2.

[0014] Preferably, the way to inhibit the expression of the BoMYC2 gene in the target plant is RNAi technology or CRISPR / Cas9 technology.

[0015] More specifically, the present invention also protects a broccoli breeding method, and the method includes the following steps:

[0016] (1) According to the conserved region of the broccoli BoMYC2 gene, a specific interference fragment is designed (targeting the 300-500bp of the CDS region, forward primer: 5′-atgacggagccgacgatga-3′, reverse primer: 5′-accaatctttgagattaaac-3'); verify by Blast that this fragment has no homology with other genes in broccoli to avoid off-target effects;

[0017] (2) Clone the forward and reverse interference fragments containing the restriction enzyme sites XhoI / KpnI into the pCAMBIA1301 vector to construct the hpRNA interference vector pCAMBIA1301-BoMYC2-RNAi; transfer the recombinant vector into GV3101 by Agrobacterium electrotransformation method, and verify the positive colonies by PCR;

[0018] (3) Genetic transformation: Infect the axillary stem segments of sterile broccoli with Agrobacterium tumefaciens GV3101 carrying pCAMBIA1301-BoMYC2-RNAi to transform broccoli;

[0019] (4) Screening of positive plants: Through PCR amplification or quantitative detection, positive plants are screened to obtain broccoli plants with increased glucosinolate content.

[0020] In the present invention, there is no particular limitation on the plants applicable to the present invention, as long as they are suitable for gene transformation operations, such as various crops, flower plants, or forestry plants, etc. The plants described above can be (but not limited to): dicotyledonous plants, monocotyledonous plants, or gymnosperms.

[0021] As a preferred mode, the "plant" described above includes but is not limited to: broccoli, and any plant having this gene or a homologous gene thereto is applicable.

[0022] The "plant" mentioned in the present invention includes the whole plant, its parental and progeny plants, as well as different parts of the plant, including seeds, fruits, buds, stems, leaves, roots (including tubers), flowers, tissues, and organs, and in these different parts, there are our target genes or nucleic acids. The "plant" mentioned here also includes plant cells, suspension cultures, callus, embryos, meristematic regions, gametophytes, sporophytes, pollen, and microspores. Similarly, each of the aforementioned objects contains the target gene / nucleic acid.

[0023] The present invention includes any plant cell, or any plant obtained or obtainable by the methods therein, as well as all plant parts and their propagules. This patent also encompasses transfected cells, tissues, organs, or whole plants obtained by any of the aforementioned methods. The only requirement is that the progeny exhibit the same genotype or phenotypic characteristics, and the progeny characteristics obtained using the methods in this patent are the same.

[0024] The present invention also extends to the harvestable parts of the plants described above, but not limited to seeds, leaves, fruits, flowers, stems, roots, rhizomes, tubers, and bulbs. At the same time, it further relates to other derivatives after plant harvesting, such as dried granules or powders, oils, fats and fatty acids, starches, or proteins.

[0025] Advantages of the present invention:

[0026] (1) By using genetic transformation technology, the present invention obtains overexpressing and interfering transgenic broccoli plants through genetic transformation of the BoMYC2 gene. The glucosinolate detection results show that overexpression of the BoMYC2 gene reduces the glucosinolate content in broccoli, and interfering with its expression increases the glucosinolate content in broccoli, proving that the BoMYC2 gene is a key gene for glucosinolate accumulation in broccoli. This discovery enriches the understanding of the glucosinolate synthesis mechanism, provides a theoretical basis for high-glucosinolate breeding of broccoli, provides new gene resources for the research on glucosinolate trait quality breeding of broccoli, and has broad application prospects.

[0027] (2) In practical applications, by interfering with or knocking out the expression of the BoMYC2 gene, high-quality broccoli varieties with increased glucosinolate content are obtained, which also provides a research basis for the research and application of cruciferous vegetables. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 Comparison of the expression levels of the broccoli BoMYC2 gene in wild-type, overexpressed, and interference-transformed broccoli materials;

[0029] Figure 2 Comparison chart of the determination results of glucosinolate content in wild-type and overexpressed transgenic broccoli (BoMYC2-OE);

[0030] Figure 3 Comparison chart of the determination results of glucosinolate content in BoMYC2-RNAi transgenic broccoli. DETAILED IMPLEMENTATION MANNER

[0031] The present invention will be further described below in conjunction with specific embodiments, and the advantages and features of the present invention will become clearer with the description. However, the specific experimental methods involved in the following embodiments are all conventional methods or are implemented according to the conditions recommended by the manufacturer's instructions unless otherwise specified.

[0032] Unless otherwise specified, the technical means used in the embodiments are conventional means well-known to those skilled in the art. The test methods in the following embodiments are all conventional methods unless otherwise specified. Unless otherwise specified, the reagents and materials used can all be obtained by purchasing from the market.

[0033] Unless otherwise defined, all professional and scientific terms used herein have the same meaning as those familiar to those skilled in the art. In addition, any methods and materials similar or equivalent to the described content can be applied to the present invention. The preferred implementation methods and materials described herein are for illustrative purposes only.

[0034] Unless otherwise stated, the implementation of the present invention will use botanical conventional techniques, microorganisms, tissue culture, molecular biology, chemistry, biochemistry, DNA recombination, and bioinformatics techniques that are obvious to those skilled in the art. These techniques have been fully explained in the published literature. In addition, the methods adopted by the present invention, such as DNA extraction, construction of phylogenetic trees, gene editing methods, construction of gene editing vectors, and obtaining gene-edited plants, can be achieved by using the methods already disclosed in the existing literature in addition to the methods adopted in the following embodiments.

[0035] As used herein, the terms "nucleic acid", "nucleic acid sequence", "nucleotide", "nucleic acid molecule" or "polynucleotide" mean DNA molecules including isolated DNA molecules (e.g., cDNA or genomic DNA), RNA molecules (e.g., messenger RNA), natural types, mutant types, synthetic DNA or RNA molecules, DNA or RNA molecules composed of nucleotide analogs, and single-stranded or double-stranded structures. These nucleic acids or polynucleotides include gene coding sequences, antisense sequences, and regulatory sequences in non-coding regions, but are not limited thereto. These terms include a gene. The term "gene" or "gene sequence" is widely used to refer to a functional DNA nucleic acid sequence. Therefore, a gene may include introns and exons in the genomic sequence, and / or include the coding sequence in cDNA, and / or include cDNA and its regulatory sequences. In a particular embodiment, for example, with respect to an isolated nucleic acid sequence, it is preferably defaulted to cDNA.

[0036] Example 1: Construction of the overexpression vector of BoMYC2 gene

[0037] (1) Gene cloning

[0038] Referring to the CDS sequence of Brassica oleracea in the Brassica Database (BRAD, http: / / brassicadb.org), specific primers were designed using the NCBI primer design tool (forward BoMYC2-F: ATGACGGAGCCGACGATGAATC; reverse BoMYC2-R: TTAACCAATCTTTGAGATTAAACTC). Using the cDNA of broccoli inbred line BOP 15-51 as a template, the coding sequence of the BoMYC2 gene was obtained by PCR amplification. The PCR product was ligated to the pMD19-T vector, and the sequence was verified by sequencing.

[0039] (2) Vector construction

[0040] The verified CDS sequence of the BoMYC2 gene was amplified by subcloning and ligated downstream of the 35S promoter of the plant expression vector pCAMBIA1301 linearized by restriction endonuclease (XbaI) to construct the recombinant plasmid pCAMBIA1301-BoMYC2-OE. The recombinant plasmid was transferred into Agrobacterium tumefaciens LBA4404 by heat shock method, and positive clones were identified by PCR.

[0041] Example 2: Construction of the RNA interference vector of BoMYC2 gene

[0042] (1) Design of interference fragment

[0043] According to the conserved region of the broccoli BoMYC2 gene, a specific interfering fragment was designed (targeting the 300-500 bp of the CDS region, forward primer: 5′-atgacggagccgacgatga-3′, reverse primer: 5′-accaatctttgagattaaac-3′). The homology of this fragment with other broccoli genes was verified by Blast to avoid off-target effects.

[0044] (2) Vector construction

[0045] The forward and reverse interfering fragments (containing restriction enzyme sites XhoI / KpnI) were cloned into the pCAMBIA1301 vector (containing the 35S promoter and ChsA intron) to construct the hpRNA interference vector pCAMBIA1301-BoMYC2-RNAi. The recombinant vector was transferred into GV3101 by Agrobacterium electrotransformation, and positive colonies were verified by PCR.

[0046] Example 3: Obtaining transgenic broccoli lines

[0047] (1) Genetic transformation

[0048] Take the sterile hypocotyl stem segments of broccoli and infect them with Agrobacterium carrying pCAMBIA1301-BoMYC2-OE and pCAMBIA1301-BoMYC2-RNAi for 10 min respectively. After co-culturing for 2 days, transfer them to a differentiation medium (MS + 6-BA 3.0 mg / L + NAA 0.1 mg / L) containing hygromycin (10 mg / L). Resistant calli were obtained after 4 weeks and continued to be cultured into regenerated seedlings.

[0049] (2) Transgenic identification

[0050] Transgenic positive plants were verified by PCR (primers: 35S-F / MYC2-R) and quantitative detection. As shown in Figure 1 , after overexpression of the BoMYC2 gene, the transcriptional level of BoMYC2-OE#5 increased by 4.02 times compared with the wild type; the transcriptional level of BoMYC2-OE#9 increased by 7.93 times compared with the wild type; while in the interfering expression plant BoMYC2-RNAi#3 of the BoMYC2 gene, the transcriptional level decreased by 3.03 times compared with the wild type.

[0051] Example 4: Analysis of glucosinolate content in transgenic materials

[0052] The content of glucosinolates was determined by HPLC method: Using the transgenic receptor material BOP15-51 as a control, rosette-stage broccoli leaves were taken, and the content of glucosinolates in broccoli was determined and analyzed by liquid chromatography (HPLC) method. The content of glucosinolates was determined by the high performance liquid chromatography method for the determination of glucosinolates in broccoli flower balls of the industry standard of the People's Republic of China (NY / T 1582-2007).

[0053] The results are as Figure 2 , 3 shown. The glucosinolate content of BoMYC2-OE#5 and BoMYC2-OE#9 overexpression plants decreased significantly. The total glucosinolate content of BoMYC2-OE#5 was 6.32 μmol / g dry leaves, which was 50.5% lower than that of the wild type (12.79 μmol / g) in the same period; the total glucosinolate content of BoMYC2-OE#9 was 8.225 μmol / g dry leaves, which was 35.7% lower than that of the wild type (12.79 μmol / g) in the same period. However, the glucosinolate content of BoMYC2δRNAi#3 interference plants increased significantly, and its glucosinolate content was 22.61 μmol / g dry leaves, which was 25% higher than that of the wild type (18.078 μmol / g) in the same period. It can be seen that the BoMYC2 gene is a gene that negatively regulates the content of glucosinolates.

[0054] In summary, the BoMYC2 gene plays an important role in regulating the synthesis of glucosinolates in broccoli, providing a basis for high-glucosinolate breeding of broccoli.

[0055] The above-described embodiments are only preferred embodiments of the present invention, which are only used to explain the present invention and do not limit the scope of implementation of the present invention. For those skilled in the art of this technology, of course, other implementation manners can be easily made through replacement or change according to the technical content disclosed in this specification. Therefore, all changes and improvements made on the principle of the present invention should be included in the scope of the patent application of the present invention.

Claims

1. Use of the broccoli BoMYC2 gene or a recombinant vector containing the BoMYC2 gene in regulating glucosinolate biosynthesis, characterized in that, The CDS sequence of the BoMYC2 gene is shown as SEQ ID NO.

1.

2. The application according to claim 1, wherein The regulation of glucosinolate biosynthesis is specifically manifested as follows: compared with wild-type broccoli, the glucosinolate content in the overexpression lines of broccoli is significantly reduced, while the glucosinolate content in the gene interference lines of broccoli is significantly increased.

3. A method for increasing the content of glucosinolates in broccoli, characterized in that, The method is as follows (1) or (2): (1) obtaining plants with increased glucosinolate content by reducing the activity of BoMYC2 protein in the target plant; (2) obtaining plants with increased glucosinolate content by inhibiting the expression of BoMYC2 gene in the target plant; the CDS sequence of the BoMYC2 gene is shown as SEQ ID NO.1, and the amino acid sequence of the BoMYC2 protein is shown as SEQ ID NO.

2.

4. The method according to claim 3, wherein The way to inhibit the expression of BoMYC2 gene in the target plant is RNAi technology or CRISPR / Cas9 technology.

5. The method according to claim 3, wherein The target plant is broccoli.

6. A broccoli breeding method, characterized in that, The method includes the following steps: (1) Design specific interference fragments according to the conserved region of the broccoli BoMYC2 gene; (2) Clone the forward and reverse interference fragments containing the restriction enzyme sites XhoI / KpnI into the pCAMBIA1301 vector to construct the hpRNA interference vector pCAMBIA1301-BoMYC2-RNAi; transfer the recombinant vector into GV3101 by Agrobacterium electroporation method, and verify the positive colonies by PCR; (3) Genetic transformation: Infect the sterile hypocotyl stem segments of broccoli with Agrobacterium tumefaciens GV3101 carrying pCAMBIA1301-BoMYC2-RNAi to transform broccoli; (4) Screening of positive plants: Screen positive plants by PCR amplification or quantitative detection to obtain broccoli plants with increased glucosinolate content; the CDS sequence of the BoMYC2 gene is shown as SEQ ID NO.

1.

7. The broccoli breeding method according to claim 6, characterized in that, The primer sequences corresponding to the specific interference fragments are respectively: Forward primer: 5′-atgacggagccgacgatga-3'; Reverse primer: 5′-accaatctttgagattaaac-3'.

Images