Novel low-cadmium rice mutant and application thereof

Abstract

The invention discloses a novel low-cadmium rice mutant and application thereof. The invention relates to the field of biotechnology breeding, in particular to a novel low-cadmium rice mutant and application thereof. The invention provides a method for cultivating rice with reduced grain cadmium content, which comprises the following steps: carrying out base substitution on an OsNramp5 gene of a target rice genome by utilizing gene editing, knocking out the OsNramp5 gene to obtain knocked-out rice, and obtaining low-cadmium rice from the knocked-out rice, compared with target rice, the grain cadmium content is reduced; a CRISPR / Cas9 system adopted by gene editing contains sgRNA or a sgRNA gene, and the target sequence of the sgRNA is the 1514 to 1533 nucleotides of a sequence 6 and / or the 6771 to 6790 nucleotides of a sequence 8. The method is used for screening low-cadmium normal-manganese rice mutant strains, achieves the purposes that rice grains are low in cadmium and the yield is not reduced, and has important significance on food crop safety and agricultural sustainable development.

Description

Technical Field

[0001] The present invention relates to the field of biotechnological breeding, and particularly to a new low-cadmium rice mutant and its application. Background Art

[0002] Cadmium (Cd) is a heavy metal element with extremely strong biological toxicity and wide distribution, and has characteristics such as accumulation, concealment, long-term nature and irreversibility. The World Health Organization has listed cadmium as a food contaminant for key research. Cadmium in farmland not only affects the growth and development of crops, but also can enter the human body through the food chain. When enriched to a certain extent, it will endanger human health, cause lesions in the kidneys and liver, and then trigger cancer and "itai-itai disease". With the rapid development of modern industry and agriculture and the advancement of the urbanization process, the problem of soil heavy metal pollution has become increasingly serious and has become an important environmental issue faced globally. Therefore, the country has adopted various soil remediation measures to reduce the impact of soil Cd pollution, but the progress is relatively slow. Rice is one of the three major food crops in the world and the staple food of more than half of the world's population. It is the cornerstone of world food security. At the same time, it is also one of the major cereal crops with the strongest cadmium absorption. Under low-concentration cadmium stress, the quality of rice will be affected. When rice is planted in cadmium-polluted soil with high concentration, its growth and development will be poor, resulting in reduced yield. Cadmium accumulated in rice grains will enter the human body through the food chain and cause various diseases. In recent years, the "cadmium rice" incident has occurred frequently in many countries around the world. Cadmium pollution in rice has become a serious problem that has attracted much social attention. Therefore, safely utilizing cadmium-polluted farmland soil and reducing the cadmium content in brown rice have become urgent food security issues to be solved.

[0003] In view of the large global population and the small per capita cultivated land area, it is obviously unrealistic to stop farming large areas of moderately and lightly cadmium-polluted farmland for long-term phytoremediation or other costly engineering repairs. Moreover, although soil remediation and agronomic measures have certain operability in practical production, they often have problems such as high input costs and low returns, large labor intensity, long time, and difficult subsequent pollution treatment. Promoting the "VIP" technology system that combines low-cadmium-accumulating varieties, flooding irrigation throughout the growth period, and adjusting the soil pH value to reduce cadmium availability is a common measure for treating farmland with excessive heavy metal cadmium pollution at present. However, since the effect of low-cadmium-accumulating varieties is not as obvious as that of water management and pH value regulation, the breeding and promotion of low-cadmium-accumulating rice varieties are usually not given due attention, resulting in slow progress in the breeding of low-cadmium-accumulating rice varieties. Through the practice of safe production in cadmium-polluted farmland, it is found that low-cadmium-accumulating rice varieties are necessary for safe production in severely cadmium-polluted farmland. Therefore, cultivating low-cadmium-accumulating rice varieties is the best choice to quickly solve the problem of cadmium pollution in rice at low cost at present. Summary of the Invention

[0004] The main problem to be solved by the present invention is how to solve the problem of cadmium pollution in rice and breed rice varieties with low cadmium accumulation.

[0005] To solve the above problems, the present invention first provides a method for cultivating rice with reduced cadmium content in grains.

[0006] The method for cultivating rice with reduced cadmium content in grains provided by the present invention includes using gene editing to cause a base substitution in the OsNramp5 gene of the target rice genome, knocking out the OsNramp5 gene to obtain knockout rice, and obtaining low-cadmium rice from the knockout rice; compared with the target rice, the cadmium content in the grains of the low-cadmium rice is reduced; the gene editing is carried out using the CRISPR / Cas9 system, the CRISPR / Cas9 system contains sgRNA or the sgRNA gene, and the target sequence of the sgRNA is the 1514-1533rd nucleotides of Sequence 6 and / or the 6771-6790th nucleotides of Sequence 8.

[0007] The present invention also provides a method for reducing the cadmium content in rice grains, the method includes using gene editing to cause a base substitution in the OsNramp5 gene of the target rice genome, knocking out the OsNramp5 gene to obtain knockout rice, and obtaining low-cadmium rice from the knockout rice; compared with the target rice, the cadmium content in the grains of the low-cadmium rice is reduced; the gene editing is carried out using the CRISPR / Cas9 system, the CRISPR / Cas9 system contains sgRNA or the sgRNA gene, and the target sequence of the sgRNA is the 1514-1533rd nucleotides of Sequence 6 and / or the 6771-6790th nucleotides of Sequence 8.

[0008] In the above, the method further includes self-crossing the knockout rice to obtain self-crossed offspring, and screening the knockout rice without transgenic elements from the self-crossed offspring, and the knockout rice without transgenic elements is the low-cadmium rice.

[0009] In the above, the CRISPR / Cas9 system can be any of the following:

[0010] (b1) including the sgRNA and Cas9 protein;

[0011] (b2) including a specific DNA molecule and the coding gene of Cas9 protein, and the specific DNA molecule is the gene of the gRNA;

[0012] (b3) including a vector with the specific DNA molecule in (b2) and a vector with the coding gene of Cas9 protein;

[0013] (b4) Comprises a specific recombination vector, which contains the specific DNA molecule described in (b2) and the coding gene of Cas9 protein.

[0014] In the present invention, the OsNramp5 gene encodes the OsNramp5 protein, and the amino acid sequence of the OsNramp5 protein is Sequence 7. The coding sequence (CDS) of the OsNramp5 gene is Sequence 6. The genomic nucleotide sequence of the OsNramp5 gene may specifically be Sequence 8.

[0015] The CRISPR / Cas9 system is a product. Specifically, the product may be a reagent.

[0016] The target sequence recognition region in the specific sgRNA may be the 1514-1533rd nucleotides of Sequence 6 in the sequence listing and / or the 6771-6790th nucleotides of Sequence 8, and / or as shown in SEQ ID No.1, SEQ ID No.2, SEQ ID No.3, SEQ ID No.4 or SEQ ID No.5.

[0017] In the above method, making a base substitution in the OsNramp5 gene of the target rice genome means the following mutation occurs: replacing 5’-CCGTCGTCGACGCCGAGAAG-3’ in the coding gene of the protein in the rice genome DNA with 5’-CCATCATCAACGCCGAGAAG-3’, thereby knocking out the gene encoding the protein.

[0018] The vectors described herein are well-known to those skilled in the art, including but not limited to: plasmids, phages (such as λ phage or M13 filamentous phage, etc.), cosmids (i.e., cosmid plasmids), Ti plasmids or viral vectors. Specifically, it may be vector pH-PABE-7.

[0019] For the convenience of identifying and screening transgenic plant cells or plants, the plant expression vectors used can be processed, such as adding genes (such as GUS gene, luciferase gene, etc.) encoding enzymes or luminescent compounds that can produce color changes and can be expressed in plants, antibiotic markers with resistance (such as gentamicin marker, kanamycin marker, etc.) or anti-chemical reagent marker genes (such as herbicide-resistant genes). Considering the safety of transgenic plants, no selective marker gene may be added, and the transformed plants can be directly screened under stress.

[0020] The present invention also provides a substance for reducing the cadmium content in rice grains, which is a CRISPR / Cas9 system for gene editing as described above; the target corresponding sequence for gene editing of the CRISPR / Cas9 system is the 6771-6790th positions of Sequence 8.

[0021] The present invention also provides the use of the substance for reducing cadmium content in rice grains described above in rice breeding, and the purpose of the breeding is to prepare a rice variety with reduced cadmium content in grains.

[0022] The present invention also provides a DNA molecule, which is a DNA molecule formed by the following mutations of the DNA molecule shown in Sequence 8:

[0023] 1) Replace 5'-CCGTCGTCGACGCCGAGAAG-3' in the coding gene of the protein in the rice genome DNA with 5'-CCATCATCAACGCCGAGAAG-3', so as to mutate Val, Val and Asp at positions 506, 507 and 508 of the OsNramp5 protein into Ile, Ile and Asn.

[0024] 2) Replace 5'-TCGTCTACCTCACCATCAGG-3' in the coding gene of the protein in the rice genome DNA with 5'-TCGTCTGCCTCACCATCAGG-3', so as to mutate Tyr at position 486 of the OsNramp5 protein into Cys;

[0025] 3) Replace 5'-CCTCCTTCCTTCTCAAGGTC-3' in the coding gene of the protein in the rice genome DNA with 5'-CCTCCCCCCTTCTCAAGGTC-3', so as to mutate Phe at position 314 of the OsNramp5 protein into Pro;

[0026] 4) Replace 5'-CTATTACCGGCACATACGCT-3' in the coding gene of the protein in the rice genome DNA with 5'-CTATTGCCGGCACATACGCT-3', so as to mutate Thr at position 342 of the OsNramp5 protein into Ala;

[0027] 5) Replace 5'-CGCCGCCGTCGTCGACGCCG-3' in the coding gene of the protein in the rice genome DNA with 5'-CGCCGCCGTCGCCGACGCCG-3', so as to mutate Val at position 507 of the OsNramp5 protein into Ala.

[0028] The specific sgRNA or the specific DNA molecule described above also belongs to the scope of protection required by the present invention.

[0029] The present invention also provides the use of the method, the DNA molecule, the specific sgRNA and / or the specific DNA molecule described above in any one of the following:

[0030] (1) Application in reducing cadmium content in rice;

[0031] (2) Application in cultivating rice varieties with low cadmium accumulation;

[0032] (3) Application in improving rice germplasm resources.

[0033] The present invention creates allelic lines with different types of OsNramp5 by saturating the editing of the OsNramp5 gene in the rice genome through gene editing technology, and cultivates and screens them using cadmium-containing hydroponic solution and cadmium-polluted soil to obtain low-cadmium normal-manganese rice varieties. The present invention uses the CRISPR / Cas9 technology to saturate the mutation of the cadmium and manganese absorption gene OsNramp5 in japonica rice, and screens out rice mutants with low cadmium and normal manganese, solving the contradiction between cadmium accumulation and yield in the process of rice breeding, achieving the purpose of low cadmium in rice grains without reducing the yield, providing a guarantee for the safety of food crops in China, and having important significance for the sustainable development of agriculture. Description of the Drawings

[0034] Figure 1 It is the homozygous mutant OsNramp5 genotype of the T1 generation.

[0035] Figure 2 It is the content of Cd and Mn in the stems of homozygous mutant OsNramp5 plants after 2-week-old mutant seedlings and WT seedlings are treated with cadmium-containing hydroponic solution containing 0.5 um CdCl2 for one week. Among them, A is: the content of cadmium in the seedling stems; B is: the content of manganese in the seedling stems.

[0036] Figure 3 It is the identification of T2-generation OsNramp5 mutants without T-DNA insertion. Lanes 1-24 are individual plants of the T2 generation of OsNramp5 VVD506IIN mutants, among which lanes 5, 9, 11, and 16 are homozygous mutant single plants without T-DNA insertion; lanes 1, 2, 3, 4, 6, 7, 8, 10, 12, 13, 14, 15, 17, 18, 19, 20, 21, 22, 23, and 24 are homozygous mutant single plants with T-DNA insertion.

[0037] Figure 4 It is for mutant OsNramp5 VVD506IIN and the Cd and Mn contents of brown rice of the control WT; the materials are potted in cadmium soil at 5 mg / kg, with 3 replicates. Among them, A is: the content of cadmium in rice grains; B is: the content of manganese in rice grains.

[0038] Figure 5 It is for mutant OsNramp5 VVD506IINComparison of yield traits with the control WT; The materials were planted in the field, with 24 individual plants planted for each strain. A: Yield per plant; B: Plant height; C: Tillering number; D: 1000-grain weight. Detailed implementation manners

[0039] The present invention will be further described in detail below in conjunction with the detailed implementation manners. The provided embodiments are only for clarifying the present invention and not for limiting the scope of the present invention. The following provided embodiments can be used as a guide for those of ordinary skill in the art to make further improvements and do not constitute any limitation to the present invention in any way.

[0040] The experimental methods in the following embodiments are all conventional methods unless otherwise specified, and are carried out according to the techniques or conditions described in the literature in this field or according to the product specifications. The materials, reagents, etc. used in the following embodiments can be obtained from commercial channels unless otherwise specified.

[0041] In the following embodiments, unless otherwise specified, all quantitative experiments are set with three repeated experiments.

[0042] The pH-PABE-7 plasmid in the following embodiments has been described in: Li, C. et al. Expanded base editing in rice and wheat using a Cas9-adenosine deaminase fusion. Genome Biol 19, 59 (2018), and is from the laboratory of Gao Caixia. The public can obtain this biological material from the applicant. This biological material is only used for repeating the experiments of the present invention and cannot be used for other purposes.

[0043] The japonica rice ZH11 in the following embodiments belongs to the conventional japonica rice variety. The public can obtain this biological material from the applicant. This biological material is only used for repeating the experiments of the present invention and cannot be used for other purposes.

[0044] The following embodiments use SPSS 11.5 statistical software to process the data. The experimental results are expressed as mean ± standard deviation, and are tested by One-way ANOVA. P < 0.05 (*) indicates significant difference, and P < 0.01 (**) indicates extremely significant difference.

[0045] Example 1: Creation of low-cadmium rice

[0046] The coding sequence (CDS) of the OsNramp5 gene in rice is SEQ ID No. 6, and it encodes the OsNramp5 protein with the amino acid sequence of SEQ ID No. 7. In the genomic DNA of rice, the genomic sequence encoding the OsNramp5 protein is shown as SEQ ID No. 8. The 1st - 111th positions of SEQ ID No. 8 are the first exon, the 378th - 456th positions are the second exon, the 585th - 625th positions are the third exon, the 924th - 1002nd positions are the fourth exon, the 1085th - 1189th positions are the fifth exon, the 2189th - 2298th positions are the sixth exon, the 2523rd - 2704th positions are the seventh exon, the 2804th - 2873rd positions are the eighth exon, the 3164th - 3337th positions are the ninth exon, the 3619th - 3723rd positions are the tenth exon, the 4710th - 4841st positions are the eleventh exon, the 5437th - 5532nd positions are the twelfth exon, and the 6542nd - 6874th positions are the thirteenth exon.

[0047] The present invention provides the following method for creating low - cadmium rice, which can effectively improve the trait of cadmium accumulation in grains. The specific steps are as follows:

[0048] 1. Selection of target sequences

[0049] According to the exon sequences of the OsNramp5 gene, 5 target sequences are designed, namely Nramp5 - A1 (SEQ ID No. 1) to Nramp5 - A5 (SEQ ID No. 5). The specific information is shown in Table 1.

[0050] Table 1. Detailed information of target sequences

[0051] Target Name Position in Sequence Listing Sequence (5’-3’) Nramp5-A1 SEQ ID No.1 CCGTCGTCGACGCCGAGAAG Nramp5-A2 SEQ ID No.2 TCGTCTACCTCACCATCAGG Nramp5-A3 SEQ ID No.3 CCTCCTTCCTTCTCAAGGTC Nramp5-A4 SEQ ID No.4 CTATTACCGGCACATACGCT Nramp5-A5 SEQ ID No.5 CGCCGCCGTCGTCGACGCCG

[0052] Note: The forward strand or reverse complementary strand of the above 5 target sequences contains the 5’-(N)X - NGG - 3’ structure.

[0053] 2. Synthesis of double - stranded target sequences with sticky ends as adapter primers

[0054] Synthesize sgRNA (Nramp5 - A1 to Nramp5 - A5), including synthesizing the forward oligonucleotide strands Nramp5 - AF1 to Nramp5 - AF5 and the complementary reverse oligonucleotide strands Nramp5 - AR1 to Nramp5 - AR5. The specific sequence information is shown in Table 2.

[0055] Table 2. Detailed information of primers used for synthesizing target sequences

[0056]

[0057]

[0058] Among them, the partial target sequences of the capital letters are the sequences obtained by removing NGG from Nramp5-A1 (SEQ ID No.1) to Nramp5-A5 (SEQ ID No.5) or their complementary sequences, and the lowercase letter part is the sticky end used to connect the vector.

[0059] 3. Construction of the pH-PABE-7 recombinant vector

[0060] 1) Preparation of adapters: Dissolve the adapter primers Nramp5-AF1 to Nramp5-AF5 and their complementary reverse oligonucleotide strands Nramp5-AR1 to Nramp5-AR5 into 100 μM mother liquors respectively. Take 1 μL of each and mix them in pairs to obtain the Nramp5-A1 to Nramp5-A5 mixed solutions. Dilute these 5 mixed solutions to 1 μM. Place them at 95 °C for 30 s, then turn off the PCR instrument and slowly cool to complete annealing.

[0061] 2) Digest the pH-PABE-7 vector with enzymes: Digest 20000 ng of the pH-PABE-7 vector with 25 U of Bsa I in a 500 μL reaction system for 5 h, and then purify it to obtain the digested pH-PABE-7 vector.

[0062] 3) Perform a ligation reaction between the adapter obtained in step 1) and the digested vector obtained in step 2): Take 1 μL of 10×T4 DNA ligase buffer, 1 μL of T4 DNA ligase, 0.5 μL of the diluted sgRNA mixed solution of Nramp5-A1 to Nramp5-A5, 1 μL of the digested linear vector, and finally add ddH2O to a total volume of 10 μL. Ligate overnight at 16 °C to obtain the pH-PABE-7 recombinant vector.

[0063] The structure of the pH-PABE-7-A1 recombinant vector is described as follows: The sequence of Nramp5-A1 (i.e., SEQ ID No.1) is inserted between the restriction enzyme Bsa I digestion sites of the starting vector pH-PABE-7, and the other sequences of the empty pH-PABE-7 are kept unchanged to obtain the recombinant vector. The recombinant expression vector pH-PABE-7-A1 has an Nramp5-A1 gene expression cassette with a nucleotide sequence of SEQ ID No.1 and a Cas protein expression cassette.

[0064] The structure of the recombinant vector pH-PABE-7-A2 is described as follows: The sequence of Nramp5-A2 (i.e., SEQ ID No.2) was inserted between the restriction enzyme Bsa I cleavage sites of the starting vector pH-PABE-7, and the other sequences of the empty vector pH-PABE-7 were kept unchanged to obtain the recombinant vector. The recombinant expression vector pH-PABE-7-A2 contains the Nramp5-A2 gene expression cassette with the nucleotide sequence of SEQ ID No.2 and the Cas protein expression cassette.

[0065] The structure of the recombinant vector pH-PABE-7-A3 is described as follows: The sequence of Nramp5-A3 (i.e., SEQ ID No.3) was inserted between the restriction enzyme Bsa I cleavage sites of the starting vector pH-PABE-7, and the other sequences of the empty vector pH-PABE-7 were kept unchanged to obtain the recombinant vector. The recombinant expression vector pH-PABE-7-A3 contains the Nramp5-A3 gene expression cassette with the nucleotide sequence of SEQ ID No.3 and the Cas protein expression cassette.

[0066] The structure of the recombinant vector pH-PABE-7-A4 is described as follows: The sequence of Nramp5-A4 (i.e., SEQ ID No.4) was inserted between the restriction enzyme Bsa I cleavage sites of the starting vector pH-PABE-7, and the other sequences of the empty vector pH-PABE-7 were kept unchanged to obtain the recombinant vector. The recombinant expression vector pH-PABE-7-A4 contains the Nramp5-A4 gene expression cassette with the nucleotide sequence of SEQ ID No.4 and the Cas protein expression cassette.

[0067] The structure of the recombinant vector pH-PABE-7-A5 is described as follows: The sequence of Nramp5-A5 (i.e., SEQ ID No.5) was inserted between the restriction enzyme Bsa I cleavage sites of the starting vector pH-PABE-7, and the other sequences of the empty vector pH-PABE-7 were kept unchanged to obtain the recombinant vector. The recombinant expression vector pH-PABE-7-A5 contains the Nramp5-A5 gene expression cassette with the nucleotide sequence of SEQ ID No.5 and the Cas protein expression cassette.

[0068] Example 2: Rice genetic transformation and acquisition and screening of positive knockout plants

[0069] 1. Acquisition of rice genetic transformation and positive knockout plants

[0070] The five recombinant vectors of pH-PAVE-7-A1, pH-PAVE-7-A2, pH-PAVE-7-A3, pH-PAVE-7-A4, and pH-PAVE-7-A5 constructed in Example 1 were introduced into Agrobacterium tumefaciens GV3101 to obtain recombinant Agrobacterium tumefaciens GV3101 / pH-PAVE-7-A1, GV3101 / pH-PAVE-7-A2, GV3101 / pH-PAVE-7-A3, GV3101 / pH-PAVE-7-A4, and GV3101 / pH-PAVE-7-A5.

[0071] Mature seeds of japonica rice ZH11 were used to induce callus on the induction medium. The specific steps are as follows:

[0072] The recombinant Agrobacterium tumefaciens GV3101 / pH-PAVE-7-A1, GV3101 / pH-PAVE-7-A2, GV3101 / pH-PAVE-7-A3, GV3101 / pH-PAVE-7-A4, and GV3101 / pH-PAVE-7-A5 were inoculated in LB culture medium containing kanamycin and rifampicin resistance and cultured for 2 days. The collected culture solution was added to NB liquid medium containing 100 μmol / L acetosyringone, and the OD was adjusted 600 to 0.5 to obtain the bacterial solution. The rice callus was soaked in the above bacterial solution for 30 min, rinsed 3 - 5 times with sterile water, blotted dry with sterile filter paper, air-dried, and transferred to NB agar medium for dark culture at 26°C - 28°C for 3 days. Then the callus was transferred to a medium containing 50 mg / L hygromycin for dark culture at 26°C - 28°C, subcultured every 15 days for a total of 2 subcultures. After resistance screening, it was transferred to the differentiation medium for continued culture at 25°C - 28°C with a light intensity of 14 h / d. When the seedlings differentiated were about 3 - 5 cm tall, they were transferred to the rooting medium to strengthen the seedlings at 25°C - 28°C with a light intensity of 14 h / d. After 3 - 4 weeks, an appropriate amount of distilled water was added, the seedlings were acclimatized for 3 days, the medium on the roots of the seedlings was washed off, the seedlings were hydroponically cultured in an incubator for 1 week, and then transplanted to the experimental field. Normal-growing plants were selected for hygromycin PCR detection, and a total of 150 transgenic positive plants were obtained.

[0073] 2. Identification of Mutation Sites in Transgenic Positive Rice Plants

[0074] Plants to be identified: wild-type ZH11, transgenic positive rice plants lc-1, lc-2, lc-3, lc-4, and lc-5.

[0075] 1) Genomic DNA of the above transgenic positive plants was extracted.

[0076] 2) For DNA fragments within 800 bp containing the target site, design 6 pairs of specific primers on the genome. Using the genomic DNA of the T0 generation transgenic rice as a template, amplify the DNA fragment containing the target site. The specific steps are as follows:

[0077] Using the DNA extracted in step 1) as a template, and the upstream and downstream primers in Table 3, amplify the DNA fragment containing the target site with 2×KOFU high-fidelity enzyme Mix. The OsNramp5 gene has 13 exons and 12 introns, with a full length of 6874 bp. Design 6 pairs of primers to amplify these 13 exon sequences. The specific primer information is shown in Table 3 below.

[0078] Table 3. Detailed information of primers used for mutation identification

[0079]

[0080] PCR reaction system: 0.5 μL DNA template, 1 μL N5-F(1-6), 1 μL N5-R(1-6), 20 μL ddH2O, 25 μL 2×kofu high-fidelity enzyme Mix. Reaction program: Pre-denature at 95°C for 3 min, 32 cycles: Denature at 96°C for 10 s, extend at 68°C for 30 s. Extend at 68°C for 5 min.

[0081] Purify the amplified PCR product and send it to the company for sequencing. Compare the sequencing results with the sequence of the wild-type plant ZH11. If there is only one type of PCR amplification product in the regenerated plant and it is consistent with the nucleotide sequence of the PCR amplification product of the wild-type plant ZH11, the regenerated plant is wild-type. If there are two types of PCR amplification products in the regenerated plant, one is consistent with the nucleotide sequence of the PCR amplification product of the wild-type plant ZH11, and the other has a mutation compared to the nucleotide sequence of the PCR amplification product of the wild-type plant ZH11 (the mutation includes deletion, insertion, or substitution of one or more nucleotides), the regenerated plant is heterozygous. If there are two types of PCR amplification products in the regenerated plant, both of which have mutations compared to the nucleotide sequence of the PCR amplification product of the wild-type plant ZH11 (the mutation includes deletion, insertion, or substitution of one or more nucleotides), the regenerated plant is a bi-allelic mutant. If there is one type of PCR amplification product in the regenerated plant and it has a mutation compared to the nucleotide sequence of the PCR amplification product of the wild-type plant ZH11 (the mutation includes deletion, insertion, or substitution of one or more nucleotides), the regenerated plant is a homozygous mutant. If there are more than three types of PCR amplification products in the regenerated plant, the regenerated plant is a chimeric type. Heterozygous, bi-allelic mutant, homozygous mutant, and chimeric type plants are collectively referred to as edited plants.

[0082] The sequencing results are as follows: There are a total of 31 seedlings of the transgenic positive rice plant lc-1. Among them, 25 are unedited, and 6 are successfully edited. Moreover, these 6 mutant individuals are all heterozygous. Compared with the wild-type rice ZH11, the heterozygous mutant plant OsNramp5-A1 has the following mutations in the OsNramp5 gene: The bases G at positions 1516, 1519, and 1522 in sequence 6 of the OsNramp5 gene on one chromosome (corresponding to positions 6773, 6776, and 6779 of SEQ ID No. 8) are replaced by the base A.

[0083] There are a total of 34 seedlings of the transgenic positive rice plant lc-2. Among them, 24 are unedited, and 10 are successfully edited. Moreover, these 10 mutant individuals are all heterozygous. Compared with the wild-type rice ZH11, the heterozygous mutant plant OsNramp5-A2 has the following mutations in the OsNramp5 gene: The base A at position 1457 in sequence 6 of the OsNramp5 gene on one chromosome (corresponding to position 6714 of SEQ ID No. 8) is replaced by the base G, and the sequence of the other chromosome is the same as that of the wild type.

[0084] There are a total of 45 seedlings of the transgenic positive rice plant lc-3. Among them, 37 are unedited, and 8 are successfully edited. Moreover, these 8 mutant individuals are all heterozygous. Compared with the wild-type rice ZH11, the heterozygous mutant plant OsNramp5-A3 has the following mutations in the OsNramp5 gene: The bases TT at positions 940 and 941 in sequence 6 of the OsNramp5 gene on one chromosome (corresponding to positions 3326 and 3327 of SEQ ID No. 8) are replaced by the bases CC, and the sequence of the other chromosome is the same as that of the wild type.

[0085] There are a total of 21 seedlings of the transgenic positive rice plant lc-4. Among them, 7 are unedited, and 17 are successfully edited. Moreover, these 4 mutant individuals are all heterozygous. Compared with the wild-type rice ZH11, the heterozygous mutant plant OsNramp5-A4 has the following mutations in the OsNramp5 gene: The base A at position 1024 in sequence 6 of the OsNramp5 gene on one chromosome (corresponding to position 3691 of SEQ ID No. 8) is replaced by the base G, and the sequence of the other chromosome is the same as that of the wild type.

[0086] There are a total of 28 seedlings of the transgenic positive rice plant lc-5, among which 21 are unedited and 7 are successfully edited, and both of these two mutant single plants are heterozygous. Compared with the wild-type rice ZH11, the heterozygous mutant plant OsNramp5-A5 has the following mutations in the OsNramp5 gene: the base T at position 1520 in sequence 6 of the OsNramp5 gene on one chromosome (corresponding to position 6777 of SEQ ID No. 8) is replaced by the base C, and the sequence of the other chromosome is the same as that of the wild type.

[0087] For the samples with mutant sequencing results, select the T0 generation mutant single plants that can cause amino acid substitution for planting, because the function of the protein with amino acid substitution will probably also change; the single plants with nonsense mutations are not studied further because they do not change the function of the protein; the strong mutant single plants that cause the complete loss of protein function are also not studied further. Plant the corresponding T0 generation plants in the field and harvest the T0 generation seeds.

[0088] Example 3. Phenotypic Identification of Transgenic Rice Plants

[0089] Plants to be identified: Wild-type ZH11, T1 generation plants of transgenic positive rice lc-1, lc-2, lc-3, lc-4 and lc-5.

[0090] Plant 16 seeds of each mutant T0 generation, and then extract the genomic DNA of 16 single plants of the T1 generation. Use the upstream primer N5-F(1-6) and the downstream primer N5-R(1-6) to amplify the DNA fragment containing the target site with KOFU high-fidelity enzyme Mix. Reaction system: 0.5 μL DNA template, 1 μL N5-F(1-6), 1 μL N5-R(1-6), 20 μL ddH2O, 25 μL 2×kofu high-fidelity enzyme Mix. Reaction program: Pre-denature at 95°C for 3 min, 32 cycles: Denature at 96°C for 10 s, extend at 68°C for 30 s. Extend at 68°C for 5 min. The amplified PCR products are purified and sent to the company for sequencing. The sequencing results are compared with the wild-type plant sequence to screen the samples with homozygous mutations, and the T1 generation seeds of the homozygous mutant plants are harvested later. See the mutation type in Figure 1 .

[0091] Compared with the wild-type rice ZH11, the homozygous mutant plant lc-1 had the following mutations in the OsNramp5 gene: the bases G at positions 1516, 1519, and 1522 in sequence 6 of the OsNramp5 gene (corresponding to positions 6773, 6776, and 6779 of SEQ ID No. 8) were replaced by bases A, and this nucleotide substitution caused a change in the function of the OsNramp5 protein, thereby creating a new OsNramp5 allele.

[0092] Compared with the wild-type rice ZH11, the homozygous mutant plant lc-2 had the following mutations in the OsNramp5 gene: the base A at position 1457 in sequence 6 of the OsNramp5 gene on one chromosome (corresponding to position 6714 of SEQ ID No. 8) was replaced by the base G, and this nucleotide substitution caused a change in the function of the OsNramp5 protein, thereby creating a new OsNramp5 allele.

[0093] Compared with the wild-type rice ZH11, the homozygous mutant plant lc-3 had the following mutations in the OsNramp5 gene: the bases TT at positions 940 and 941 in sequence 6 of the OsNramp5 gene on one chromosome (corresponding to positions 3326 and 3327 of SEQ ID No. 8) were replaced by the bases CC, and this nucleotide substitution caused a change in the function of the OsNramp5 protein, thereby creating a new OsNramp5 allele.

[0094] Compared with the wild-type rice ZH11, the homozygous mutant plant lc-4 had the following mutations in the OsNramp5 gene: the base A at position 1024 in sequence 6 of the OsNramp5 gene on one chromosome (corresponding to position 3691 of SEQ ID No. 8) was replaced by the base G, and this nucleotide substitution caused a change in the function of the OsNramp5 protein, thereby creating a new OsNramp5 allele.

[0095] Compared with the wild-type rice ZH11, the homozygous mutant plant lc-5 had the following mutations in the OsNramp5 gene: the base T at position 1520 in sequence 6 of the OsNramp5 gene on one chromosome (corresponding to position 6777 of SEQ ID No. 8) was replaced by the base C, and this nucleotide substitution caused a change in the function of the OsNramp5 protein, thereby creating a new OsNramp5 allele.

[0096] 1. Hydroponic experiments with cadmium-containing hydroponic solutions were conducted to screen for rice mutants with low cadmium accumulation.

[0097] The specific steps of the hydroponic experiment with cadmium-containing hydroponic solution are as follows:

[0098] Seeds of the 5 mutants edited and wild-type seeds, after germination, grew in hydroponic solution for 2 weeks, and then were transferred to hydroponic solution containing 0.5 μm CdCl2 for treatment for one week. The above-ground stem parts were taken, dried, weighed about 100 mg, digested with HNO3, and the contents of Cd and Mn in the stems were identified by inductively coupled plasma emission spectrometer ICP.

[0099] The results are as Figure 2 shown in A and B in, the Cd content in the stems of the lc-1 mutant line was significantly reduced compared with the control, and there was no effect on the manganese metal element.

[0100] Twenty-four pure mutant seeds lc-1 harvested in the T1 generation were planted in the field. Rice genomic DNA was extracted, and the Hpt transgenic element was detected by PCR. The detection primers were: F: 5’-ATGAAAAAGCCTGAACTCACCGCGACG-3’ and R: 5’-ATGGGGATCAGCAATCGCGCATATGAAA-3’. The edited mutants without transgenic components were screened out. By PCR detection of 24 individual plants in the T2 generation of the mutant line lc-1 in the field, it was found that ( Figure 3 ), no Hpt band was amplified in the 5th, 9th, 11th and 16th individual plants, and the Hpt gene band was amplified in the other 20 individual plants. The 5th, 9th, 11th and 16th individual plants in the T2 generation were all of the same mutant type, and they were named rice line OsNramp5 VVD506IIN .

[0101] Homozygous mutant plant OsNramp5 VVD506IIN Compared with the wild-type rice ZH11, the following mutations occurred in the OsNramp5 gene: 5’-CCGTCGTCGACGCCGAGAAG-3’ in the OsNramp5 gene of rice genomic DNA was replaced by 5’-CCATCATCAACGCCGAGAAG-3’, that is, the base G at positions 1516, 1519 and 1522 of sequence 6 (corresponding to positions 6773, 6776 and 6779 of SEQ ID No.8) was replaced by base A. The above nucleotide substitution caused a change in the function of the OsNramp5 protein, thus creating a new OsNramp5 allele. The sequencing results of the mutation site and its surrounding nucleotides are shown in Figure 1 .

[0102] 2. Pot experiment under cadmium stress

[0103] A cadmium stress pot experiment was conducted. The soil was flower nutrient soil. Cd (CdCl2) was added to the flower nutrient soil in the form of a solution to make the cadmium concentration in the soil 5 mg / kg, and the soil pH value was adjusted to about 5 - 6 with concentrated H2SO4. One low cadmium-accumulating homozygous mutant OsNramp5 screened in step 1 VVD506IIN and the control rice ZH11 were planted in cadmium-polluted pots, with 3 plants planted in each pot, 2 plants being mutants and 1 plant being the control, and replicated 5 times. Samples were taken at the rice maturity stage and dried to a constant weight at 80 °C. The brown rice was ground, digested with HNO3, and the cadmium content and other related mineral element contents in the brown rice were identified by an inductively coupled plasma emission spectrometer ICP. The results are shown in Figure 4 A and B in

[0104] The results showed that the Cd content in the brown rice of the OsNramp5 VVD506IIN mutant lines was significantly lower than that of the control, and there was no effect on manganese and other metal elements.

[0105] 3. Study on the agronomic traits at the rice maturity stage

[0106] The low cadmium-accumulating homozygous mutant OsNramp5 screened in step 1 VVD506IIN and the control rice ZH11 were planted in the field, and the agronomic traits were statistically analyzed at the rice maturity stage. The results are shown in Figure 5 A - D in

[0107] Figure 5 The results of A - D in VVD506IIN showed that there were no significant differences in plant height, yield, and tillering between the OsNramp5

[0108] The above details the present invention. For those skilled in the art, without departing from the purpose and scope of the present invention and without unnecessary experiments, the present invention can be implemented within a relatively wide range under equivalent parameters, concentrations, and conditions. Although specific embodiments of the present invention are given, it should be understood that the present invention can be further improved. In short, according to the principle of the present invention, this application intends to include any changes, uses, or improvements to the present invention, including changes made using conventional techniques known in the art that depart from the scope disclosed in this application.

Claims

1. A method for cultivating rice with reduced cadmium content in grains, characterized in that, The method includes using gene editing to cause a base substitution in the OsNramp5 gene of the target rice genome, knocking out the OsNramp5 gene to obtain a knockout rice, and obtaining low-cadmium rice from the knockout rice; compared with the target rice, the cadmium content in the grains of the low-cadmium rice is reduced; The gene editing is carried out using the CRISPR / Cas9 system, the CRISPR / Cas9 system contains sgRNA or the sgRNA gene, and the target sequence of the sgRNA is the 1514-1533rd nucleotides of Sequence 6 and / or the 6771-6790th nucleotides of Sequence 8.

2. Method for reducing cadmium content in rice grains, characterized in that, The method includes using gene editing to cause a base substitution in the OsNramp5 gene of the target rice genome, knocking out the OsNramp5 gene to obtain a knockout rice, and obtaining low-cadmium rice from the knockout rice; compared with the target rice, the cadmium content in the grains of the low-cadmium rice is reduced; The gene editing is carried out using the CRISPR / Cas9 system, the CRISPR / Cas9 system contains sgRNA or the sgRNA gene, and the target sequence of the sgRNA is the 1514-1533rd nucleotides of Sequence 6 and / or the 6771-6790th nucleotides of Sequence 8.

3. The method according to claim 1 or 2, characterized in that, The method further includes self-crossing the knockout rice to obtain self-crossed offspring, and screening the knockout rice without transgenic elements from the self-crossed offspring, and the knockout rice without transgenic elements is the low-cadmium rice.

4. The method according to any one of claims 1 to 3, characterized in that, The CRISPR / Cas9 system is any one of the following: (b1) includes the sgRNA and Cas9 protein; (b2) includes the coding gene of the specific DNA molecule and Cas9 protein, and the specific DNA molecule is the gene of the gRNA; (b3) includes the vector with the specific DNA molecule in (b2) and the vector with the coding gene of Cas9 protein; (b4) includes the specific recombinant vector, and the specific recombinant vector contains the specific DNA molecule in (b2) and the coding gene of Cas9 protein.

5. The method according to any one of claims 1-4, characterized in that, The causing a base substitution in the OsNramp5 gene of the target rice genome is to cause the following mutation: replacing 5'-CCGTCGTCGACGCCGAGAAG-3' in the coding gene of the protein in the rice genome DNA with 5'-CCATCATCAACGCCGAGAAG-3', thereby knocking out the gene encoding the protein.

6. A substance for reducing the cadmium content in rice grains is the CRISPR / Cas9 system for gene editing the coding gene of the protein described in Claim 1 or 2; the target corresponding sequence of the CRISPR / Cas9 system gene editing is the 6771-6790th nucleotides of Sequence 8.

7. The application of the substance described in Claim 7 in rice breeding, and the purpose of the breeding is to prepare a rice variety with a reduced cadmium content in grains.

8. A DNA molecule, characterized in that, The DNA molecule is a DNA molecule formed by the following mutation of the DNA molecule shown in Sequence 8: replacing 5'-CCGTCGTCGACGCCGAGAAG-3' in the coding gene of the said protein in the rice genome DNA with 5'-CCATCATCAACGCCGAGAAG-3', thereby knocking out the gene encoding the said protein.

9. The specific sgRNA according to any one of the methods of claims 1-3 or the specific DNA molecule according to the method of claim 3.

10. The application of the method according to any one of claims 1-5, the DNA molecule according to claim 8, the specific sgRNA according to claim 9, and / or the specific DNA molecule in any one of the following: (1) Application in reducing the cadmium content in rice; (2) Application in cultivating rice varieties with low cadmium accumulation; (3) Application in improving rice germplasm resources.

Images