Plasmid vector and cell line capable of inducing double-strand breakage of targeted genome DNA (deoxyribonucleic acid)

Abstract

The invention discloses a plasmid vector and a cell line capable of inducing double-strand breakage of targeted genome DNA (Deoxyribose Nucleic Acid). The endonuclease AscI expression plasmid based on a lentiviral vector skeleton is constructed by integrating a Tet-on chemical induction type transcription control system and an ERT2 ligand-dependent nuclear localization regulation system. According to the vector, transcription of AscI is regulated and controlled through a Tet-on system, and space-time specific nuclear translocation of incision enzyme AscI is achieved through a 4-hydroxytamoxifen-induced ERT2 system. The invention also constructs and screens a cell line capable of stably expressing AscI. By means of small chemical molecules, spatio-temporal expression of AscI incision enzyme in cells can be accurately regulated and controlled, and DNA double-chain breakage is induced to be generated at a specific site of a genome. An efficient and accurate research tool is provided for the field of DNA damage repair, and the method can be widely applied to research of a DNA damage repair mechanism and high-throughput screening of related drugs.

Description

Technical Field

[0001] The present invention relates to the field of molecular and cell biology. Specifically, it relates to the construction and application of a plasmid vector and a cell line that can generate DNA double-strand break damage at specific genomic loci by chemical small molecule induction. Background Art

[0002] As a key carrier of genetic information, the integrity of DNA is crucial for the normal physiological functions of cells, the development of individuals, and genetic stability. However, DNA in cells is constantly under attack from endogenous and exogenous factors, resulting in various types of damage. Among them, DNA double-strand breaks (DSBs) are the most severe form of damage. If DSBs are not repaired in a timely and accurate manner, it will lead to chromosomal structure variations such as gene deletions, translocations, and inversions, and then trigger apoptosis, senescence, or malignant transformation, which is closely related to the occurrence and development of various major human diseases such as tumors, neurodegenerative diseases, and immunodeficiency. Therefore, in-depth study of DNA double-strand breaks and their repair mechanisms is of great significance for understanding the essence of life processes, revealing the pathogenesis of related diseases, and developing effective treatment strategies. In addition, the repair mechanism of DSBs is the basis of the CRISPR gene editing technology. Studying the DSBs repair mechanism is of great significance for optimizing the efficiency, accuracy, and safety of the CRISPR technology.

[0003] When DNA double-strand breaks occur, cells will rapidly initiate a series of complex and delicate repair mechanisms, including the recruitment of repair protein molecules, the participation of RNA, the remodeling of the three-dimensional chromatin structure, and the selection of repair pathways. Naturally occurring DSBs are random and heterogeneous, making it difficult to precisely track the repair process. Therefore, artificially controlling the occurrence of DSBs in time and space can effectively eliminate background noise, thereby accurately analyzing the changes in the three-dimensional chromatin structure near DSBs, the recruitment order of repair proteins, the selection preference of repair pathways, and their regulatory mechanisms. According to existing reports, there are several systems for generating DSBs at specific sites, mainly divided into single-site systems and multi-site systems. Single-site systems include the I-SceI endonuclease system, the I-PpoI endonuclease system, and the CRISPR / Cas9 system, etc. Most of these systems require plasmid transfection or complex gene editing before use and can only generate DSBs at a specific site. Research based on such systems cannot reflect general laws, causing significant interference to the credibility of research results and also being unable to perform statistical analysis. The multi-site system mainly refers to the AsiSI endonuclease system. Although there are multiple cleavage sites for the AsiSI endonuclease in the genome, DNA methylation modification can significantly weaken the accessibility of most sites. Studies have shown that only about 100 AsiSI sites can be effectively cleaved to generate detectable double-strand breaks. Moreover, these observable DSB sites are not randomly distributed, and their formation efficiency is highly affected by the local chromatin open state (such as active transcription regions or nuclear matrix attachment regions). These two factors make it difficult for the AsiSI system to truly simulate the random distribution characteristics of endogenous DNA damage events, thereby causing significant biases in the statistical analysis of DSB repair mechanisms. In addition, existing ChIP-seq data shows that no typical DSB peak shape appears at AsiSI sites. Summary of the Invention

[0004] To solve the problems in the prior art such as poor spatio-temporal control accuracy, limited number of cleavage sites, and poor randomness of cleavage sites during the induction of DNA double-strand breaks at multiple sites, the present invention is committed to developing a multi-site DSB induction system with precise regulation ability. Based on this goal, the DNA endonuclease AscI is selected as the research object in the present invention, and Tet-on (chemically inducible gene expression system) and ERT2 (chemically inducible nuclear localization regulation system) are introduced, and an expression vector is constructed based on a lentiviral plasmid vector. Through lentiviral infection and the screening of monoclonal stable expression cell lines, a cell line stably expressing ERT2-AscI is successfully constructed.

[0005] The specific technical solutions of the present invention are as follows: The present invention provides a plasmid vector capable of inducing targeted double-strand breaks in genomic DNA. With a lentiviral vector as the backbone, it contains the following elements: The coding sequence of the DNA endonuclease AscI; And the ERT2 element, which is used for chemically induced regulation of the nuclear localization of the DNA endonuclease AscI; or The ERT2 element and the Tet-on element, where the ERT2 element is used for chemically induced regulation of the nuclear localization of the DNA endonuclease AscI, and the Tet-on element is used for chemically induced regulation of the expression of the DNA endonuclease AscI gene.

[0006] The sequence of the ERT2 element is the sequence of 1753 - 4668 bp in the pCAG-ERT2CreERT2 (addgene, Plasmid #13777) sequence; the sequence of the Tet-on element is the sequence of 3441 - 4187 bp in the pLVX-TetOne-puro (Clontech, catalog number 631849631847) sequence.

[0007] Specifically, the amino acid and nucleotide sequences of the coding sequence of the DNA endonuclease AscI are shown in SEQ ID NO.1 and SEQ ID NO.2 respectively. To promote its efficient expression in human cells, the original DNA sequence was codon-optimized, and the optimized sequence is shown in SEQ ID NO.3.

[0008] In specific applications, the Tet-on element induces the expression of AscI through doxycycline (Dox), and the ERT2 element induces the nuclear localization of AscI through 4-hydroxytamoxifen (4-OHT).

[0009] Preferably, the plasmid vector is in any of the following forms: Single control system: Connect the ERT2 element and the coding sequence of the DNA endonuclease AscI downstream of a constitutive promoter; Dual control system: Connect the ERT2 element and the coding sequence of the DNA endonuclease AscI downstream of an inducible promoter regulated by the Tet-on system, and eliminate the DNA endonuclease AscI cleavage site in the vector through site-directed mutagenesis.

[0010] Furthermore, in the single control system, the lentiviral vector used is pLVX-IRES-puro, and the constitutive promoter is the CMV promoter.

[0011] In a specific embodiment of the present invention, the specific steps are as follows: The 3×Flag-ERT2 and AscI fragments are sequentially inserted after the CMV promoter of the lentiviral vector pLVX-IRES-puro to obtain the recombinant plasmid pLVX-3×Flag-ERT2-AscI-IRES-puro, which is a single control system.

[0012] Furthermore, in the dual control system, the lentiviral vector used is pLVX-TetOne-puro, and the inducible promoter is the TRE3GS promoter; In the dual control system, the cleavage site of the DNA endonuclease AscI is mutated from GGCGCGCC to GGGCCGCC.

[0013] In a specific embodiment of the present invention, the specific steps are as follows: The 3×Flag -ERT2-AscI fragment in the single control system is ligated after the TRE3GS promoter of the Tet-on lentiviral vector pLVX-TetOne-puro to obtain the recombinant plasmid pLVX-TetOne-3×Flag-ERT2-AscI-puro. Since there is an AscI cleavage site on the pLVX-TetOne-puro vector, the plasmid pLVX-TetOne-3×Flag-ERT2-AscI-puro constructed based on this vector also contains this cleavage site. After AscI is expressed in cells, it will act on this site, thereby interfering with the continuous expression of the Tet-on element and AscI. Therefore, this site is mutated from GGCGCGCC to GGGCCGCC by site-directed mutagenesis.

[0014] The present invention also provides a cell line that can induce targeted double-strand breaks in genomic DNA, which is constructed through the following steps: The above plasmid vector and the lentiviral packaging plasmid are co-transfected into engineering cells to package lentivirus; the target cells are infected with the lentivirus, and a stably expressed monoclonal cell line is obtained by screening.

[0015] By integrating the Tet-on and / or ERT2 elements mediated by chemical small molecules, precise regulation of the spatio-temporal expression of AscI endonuclease in cells is achieved, thereby generating DNA double-strand breaks (DSBs) at specific genomic loci.

[0016] Furthermore, the screening of the monoclonal cell line includes: Continuous screening with puromycin (concentration 0.5 - 10 mg / ml); monoclonal cell strains are obtained by the limiting dilution method.

[0017] In a specific embodiment of the present invention, the specific steps are as follows: (1) Transfect the above-mentioned lentiviral vector pLVX-3×Flag-ERT2-AscI-IRES-puro, packaging plasmid pMD2.G and psPAX2 into the engineering cell 293FT for lentivirus packaging;

[0018] (2) Transfect the above-mentioned lentiviral vector pLVX-TetOne-3×Flag-ERT2-AscI-puro, packaging plasmid pMD2.G and psPAX2 into the engineering cell 293FT for lentivirus packaging;

[0019] (3) Infect the target cells with the lentiviruses produced in (1) and (2) respectively to establish cell lines with single and dual control systems, and the infection lasts for 24 hours;

[0020] (4) After the infection, replace it with fresh complete medium and add the antibiotic puromycin for screening, and the screening lasts for 3 days;

[0021] (5) Digest the screened cells with trypsin, inoculate them into 96-well plates after appropriate dilution, and culture them in a cell incubator at 37°C and 5% CO2 for 2 weeks, and continuously add puromycin during the culture period;

[0022] (6) Select the monoclonal cell wells formed by the growth of single cells, detect the expression of 3×Flag-ERT2-AscI by Western blot and immunofluorescence staining, and select and retain those single-cell clones with moderate expression levels for expansion culture, thereby obtaining cell lines with single and dual control systems;

[0023] (7) Number and cryopreserve the expanded single-cell clones, and name the stable cell line containing the 3×Flag-ERT2-AscI element as AscID ( Asc I- I nduced- D SBs) cells.

[0024] The present invention utilizes the AscI restriction endonuclease to generate DSBs at its specific recognition site.

[0025] Specifically, the monoclonal cell line induces DNA double-strand breaks in the following manner: When the monoclonal cells contain the coding sequence of the endonuclease AscI and the ERT2 element: add 4-hydroxytamoxifen during culture to induce nuclear entry and induce DNA double-strand breaks at specific genomic loci; When the monoclonal cells contain the coding sequence of the endonuclease AscI, the ERT2 element, and the Tet-on element: First, doxycycline is added to the culture medium to induce the expression of the ERT2 element and the coding sequence of the endonuclease AscI, and then 4-hydroxytamoxifen is added to induce the ERT2 element and the coding sequence of the endonuclease AscI to enter the nucleus, inducing DNA double-strand breaks at specific loci in the genome.

[0026] Preferably, the concentration of 4-hydroxytamoxifen is 300 nM, and the induction time is at least 1.5 h; further, the induction time is 1.5 - 3 h; the concentration of doxycycline is 1 μg / mL, and the induction time is 4 - 12 h.

[0027] More specific steps are as follows: In the single-regulation system cell line, 3×Flag-ERT2-AscI is constitutively expressed in the cytoplasm. By adding 4-hydroxytamoxifen (300 nM, 1.5 h) to the cell culture medium, 3×Flag-ERT2-AscI is induced to translocate from the cytoplasm to the nucleus, thereby achieving cleavage of specific loci in the genome.

[0028] In the dual-regulation system cell line, the expression of 3×Flag-ERT2-AscI in the cytoplasm is induced by adding doxycycline (1 μg / mL, 12 h) to the cell culture medium. Subsequently, by adding 4-hydroxytamoxifen (300 nM, 1.5 h) to the cell culture medium, 3×Flag-ERT2 -AscI is induced to translocate from the cytoplasm to the nucleus, thereby achieving cleavage of specific loci in the genome.

[0029] The present invention also provides the application of the described cell line in studying DNA damage repair mechanisms, gene editing, or high-throughput screening of DNA repair regulatory drugs.

[0030] The plasmid vector and cell line capable of inducing targeted DNA double-strand breaks in the genome involved in the present invention can be applied to the fields of studying DNA damage repair mechanisms, screening compounds that inhibit / enhance repair, and gene editing.

[0031] The experimental results in the examples of the present invention fully demonstrate that by chemically inducing the expression and nuclear entry of the endonuclease AscI, extensive DNA double-strand break events can be generated at the AscI cleavage sites in the genome.

[0032] Compared with the prior art, the beneficial effects of the present invention are as follows: (1) The present invention uses the AscI endonuclease to generate DNA double-strand breaks. After the AscI endonuclease is expressed in different cells, its enzyme activity for cleaving DNA is less affected, and the enzyme activity is sufficient to generate sufficient DNA double-strand breaks.

[0033] (2) The number of AscI sites in the genome is moderate, which will neither affect the cell state due to too many sites nor reduce the reliability of experimental results due to too few sites. Immunofluorescence and CUT&Tag-seq results showed that sufficient DSBs can be generated in AscID cells to meet the needs of statistical analysis.

[0034] (3) The results of CUT&Tag-seq showed that the double-strand break events near the AscI site showed a typical concave shape, which is a feature not possessed by other systems that generate DSBs at specific sites, further highlighting the superiority of the present invention.

[0035] (4) The present invention utilizes two commercial chemical small molecules, 4-hydroxytamoxifen and doxycycline, to induce the spatiotemporal expression of AscI, which are easy to obtain and low in cost.

[0036] (5) The present invention uses the Tet-on system to control the expression of AscI and the ERT2 system to control the nuclear entry of AscI, which can strictly regulate the occurrence of DSBs and provide a powerful tool for studying the changes in events before and after DNA breakage.

[0037] (6) The two lentiviral plasmid vectors of the present invention can be conveniently applied to a variety of cell types and have the characteristics of simple operation, low cost and high efficiency.

[0038] (7) The chemical small molecule control strategy adopted in the present invention can be used to regulate the spatiotemporal expression of any protein molecule and has broad implications. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] Figure 1 :Distribution of AscI restriction sites in the human genome (hg38).

[0040] Figure 2 : Schematic diagram of the spatiotemporal control of AscI expression; A: single regulation system; B: dual regulation system.

[0041] Figure 3 :Western Blot was used to detect the changes in the phosphorylation levels of ATM and H2AX proteins in AscID cells after they were treated with 4-OHT for different time periods.

[0042] Figure 4 :Immunofluorescence detection of AscI protein nuclear entry and 53BP1 foci formation in AscID cells before and after treatment with Dox and 4-OHT; the scale bar is 10 μm.

[0043] Figure 5: Enrichment status of 53BP1 (A) and γH2AX (B) at DNA double-strand break sites induced by AscID before and after 4-OHT treatment in CUT&Tag-seq analysis.

[0044] Figure 6 : Taking human chromosome 13 as an example, Karyoplot (genome coverage map) is used to display the CUT&Tag-seq results; among them, the red vertical line represents the position of the AscI cleavage site, and the blue peak map represents the CUT&Tag-seq signals of 53BP1 (A) and γH2AX (B). Detailed implementation manners

[0045] The technical solutions provided by the present invention will be described in detail below, but they should not be construed as limiting the protection scope of the present invention.

[0046] In the following technical solutions, unless otherwise specified, they are all conventional methods, and the materials, reagents, etc. used, unless otherwise specified, can be obtained from commercial channels.

[0047] Example 1

[0048] This example aims to elaborate on the construction process of plasmid vectors for single-regulation systems and dual-regulation systems, specifically including the following steps: 1. Selection of restriction enzymes: With the help of the NEB website, obtain the information of restriction enzymes with recognition sites of 8 bases or more. By searching the human genome (hg38) sequence, determine the number of recognition sites of these enzymes in the genome. Select restriction enzymes with less than 10,000 sites. After screening, the rare-cutting enzyme AscI (recognition sequence: 5'-GG^CGCGCC-3') is selected, and its 8 bp recognition sites have a total of 4722 sites in the human genome (hg38) ( Figure 1 ), which can achieve sparse and controllable DSBs induction. AscI The gene is derived from the genus Arthrobacter luteus ( Arthrobacter sp.). Obtain the amino acid and nucleotide sequences of AscI from the UniProt website (accession number: E3VXA3), and the sequences are shown as SEQ ID NO.1 and SEQ ID NO.2 respectively.

[0049] 2. To achieve the high expression of AscI in human cells, its codons are optimized, and a DNA fragment encoding AscI is obtained by chemical synthesis, and the sequence is shown as SEQ ID NO.3. If it is necessary to express in cells of other species, the codons of the corresponding species can be optimized.

[0050] 3. Construction of the single-regulation system vector: The nuclear localization regulatory module sensitive to 4-hydroxytamoxifen (4-OHT) was fused with the optimized AscI gene to obtain ERT2-AscI.

[0051] The specific operation process is as follows: From the plasmid pCAG-ERT2CreERT2 (addgene, Plasmid #13777), the DNA sequence of the ERT2 element (1753-4668 bp in Plasmid #13777) was obtained by conventional PCR technology. To facilitate the detection of the expression of ERT2-AscI in cells, a 3×Flag tag was added to the 5' end of ERT2. The specific method was to add the DNA sequence of the Flag tag to the 5' end of the ERT2 amplification primer. The ERT2 amplification primers are as follows: The forward primer sequence is: GAGGATCTATTTCCGGTGAATTTGCCACCATGGACTACAAAGACCATGACGGTGATTATAAAGATCATGACATCGACTACAAGGATGACGATGACAAGGAATTCGAGCCATCTGCTGGAGACATGAGAGCTGCCAACCTT (SEQ ID NO.4), The reverse primer sequence is: TGTGGCAGGGAAACCCT CTGCCTCCCCCGTGATG (the underlined sequence is the homologous arm sequence) (SEQ ID NO.5).

[0052] PCR amplification was performed using 2×Phanta Flash Master Mix (P510-01) from Novoprotein. The PCR program was set as follows: pre-denaturation at 98°C for 30 s; denaturation at 98°C for 10 s; annealing at 60°C for 5 s; extension at 72°C for 5 s / kb, and the number of cycles was 34.

[0053] By homologous recombination method, the 3×Flag-ERT2 obtained by PCR amplification and the chemically synthesized AscI fragment were sequentially inserted behind the CMV promoter of the lentiviral vector pLVX-IRES-puro (Clontech, catalog number 632183) ( Eco RI and BamBetween the HI restriction sites), the recombinant plasmid pLVX-3×Flag-ERT2-AscI-IRES-puro was constructed. It should be noted that when designing primers and chemically synthesizing the AscI sequence, homologous arms should be added upstream and downstream of the CDS sequence of AscI. The upstream homologous arm sequence is: AGGGTTTCCCTGCCACAGCTGTCGA (SEQ ID NO.6), and the downstream homologous arm sequence is: GGATCCCGCCCCTCTCCCTCCCC (SEQ ID NO.7). Homologous recombination was performed using the ClonExpress MultiS One Step Cloning Kit (C113) from Novoprotein.

[0054] 4. Construction of the dual regulation system vector: The 3×Flag-ERT2-AscI recombinant fragment in the above single regulation system was inserted into the Tet-On lentiviral vector.

[0055] The specific operation steps are as follows: The 3×Flag-ERT2-AscI recombinant fragment was obtained by conventional PCR from the pLVX-3×Flag-ERT2-AscI-IRES-puro recombinant plasmid, and then this fragment was ligated to the TRE3GS promoter of the Tet-on lentiviral vector pLVX-TetOne-puro (Clontech, catalog number 631847, the Tet-on element sequence is the sequence from 3441 - 4187bp) by homologous recombination method ( Eco RI and Bam Between the HI restriction sites), to obtain the recombinant plasmid pLVX-TetOne-3×Flag-ERT2-AscI-puro. Since there is an AscI restriction site on the pLVX-TetOne-puro vector, the pLVX-TetOne-3×Flag-ERT2-AscI-puro plasmid constructed based on this vector also contains this restriction site. After AscI is expressed in cells, it will act on this site and interfere with the continuous expression of the Tet-on system and AscI. Therefore, this site was mutated from GGCGCGCC to GGGCCGCC by site-directed mutagenesis.

[0056] Example 2

[0057] This example details the process of establishing cell lines for the single regulation system and the dual regulation system, and the specific steps are as follows: 1. Packaging of the single regulation system lentivirus: Using liposome Lipofectamine TMThe lentivirus packaging was carried out by transfecting the engineered cells 293FT with pLVX-3×Flag-ERT2-AscI-IRES-puro and the packaging plasmids pMD2.G (Addgene #12259) and psPAX2 (Addgene #12260) mediated by Lipofectamine 2000. The transfection operation was carried out in a 35 mm culture dish, and the ratio and dosage of the packaging plasmids were: pLVX-3×Flag-ERT2-AscI-IRES-puro∶pMD2.G∶psPAX2 = 10 mg∶3 mg∶7.5 mg. 8 hours after transfection, the medium was replaced with fresh medium. After continued culture for 48 - 72 hours, the cell culture supernatant containing lentivirus was collected. The collected supernatant was filtered through a 0.45 mm filter to remove cell debris and impurities, obtaining a preliminarily purified lentivirus solution. This is the lentivirus of the single regulation system (only containing the ERT2 element).

[0058] 2. Packaging of the lentivirus of the dual regulation system: Using Lipofectamine TM The lentivirus packaging was carried out by transfecting the engineered cells 293FT with pLVX-TetOne-3×Flag-ERT2-AscI-puro and the packaging plasmids pMD2.G and psPAX2 mediated by Lipofectamine 2000. The transfection was carried out in a 35 mm culture dish, and the ratio and dosage of the packaging plasmids were: pLVX-TetOne-3×Flag-ERT2-AscI-puro∶pMD2.G∶psPAX2 = 10 mg∶3 mg∶7.5 mg. 8 hours after transfection, the medium was replaced with fresh medium. After continued culture for 48 - 72 hours, the cell culture supernatant containing lentivirus was collected. The collected supernatant was filtered through a 0.45 mm filter to remove cell debris and impurities, obtaining a preliminarily purified lentivirus solution. This is the lentivirus of the dual regulation system (containing the Tet-on and ERT2 elements).

[0059] 3. Infection of cells with lentivirus: Inoculate the target cells to be infected into a 6-well plate and culture them under appropriate culture medium and conditions until the cell confluence reaches 30%-40% at the time of infection. Add an appropriate amount of lentivirus solution to the 6-well plate containing the target cells, and simultaneously add polybrene with a final concentration of 5-10 mg / mL to promote the binding of the virus to the cells. Gently shake the culture plate to evenly distribute the virus solution, and then place the culture plate back into the cell incubator at 37°C and 5% CO2 for continued culture. After 12-24 hours of infection, replace it with fresh complete medium to remove the uninfected virus. After continued culture for 24 hours, add the antibiotic puromycin for screening. The concentration of the antibiotic is adjusted according to the specific cell type (the concentration is 0.5-10 mg / ml), and the screening time usually lasts for 3 days until all the uninfected cells die. The surviving cells are the cell clones stably infected with the lentivirus. Digest the screened cells with trypsin, dilute them moderately, and adjust the cell concentration to 10-20 cells per milliliter. Inoculate the diluted cell suspension into a 96-well plate, adding 100 μL of the cell suspension to each well. Theoretically, each well contains an average of 1-2 cells. After inoculation, place the 96-well plate in the cell incubator at 37°C and 5% CO2 for culture, and continuously add puromycin during the culture period.

[0060] 4. Monoclonal identification and expansion culture: Continue to culture for 2 weeks, and regularly observe the cell growth during this period. Select the monoclonal cell wells formed by the growth of single cells and further identify these monoclonal cells. The specific operation is as follows: Digest the cells with trypsin and inoculate all of them into a 24-well plate. Continue to culture until the cell confluence reaches 80%-90%, and then digest the cells with trypsin again. Half of the cells are inoculated into a 24-well plate, and the other half of the cells are inoculated into a 24-well plate with a cell slide for immunofluorescence detection. The cells are continued to be cultured for 16 hours.

[0061] For the single regulatory system, the schematic diagram of the spatiotemporal control of AscI expression is as Figure 2As shown in A in [reference], that is, directly detect the expression of ERT2-AscI by Flag antibody immunofluorescence. At this time, ERT2-AscI should be expressed in the cytoplasm. The specific steps are as follows: The cells inoculated on the cell slide are rinsed once with PBS. After sucking dry the PBS, add 4% paraformaldehyde (4% PFA) to fix the cells for 15 minutes. Rinse the fixed cells 3 times with PBS. After sucking dry the PBS, add 0.5% Triton X-100 to permeabilize the cells for 10 minutes. Rinse the permeabilized cells 3 times with PBS. Dilute the Flag antibody to an appropriate concentration with PBS solution, and then drop the diluted Flag antibody (Sigma, F9291) on the cell slide (the side covered with cells), and incubate at 37 °C for 1 hour. After the incubation, rinse the cells 3 times with PBS to remove the unbound Flag antibody. Select a fluorescently labeled secondary antibody (Abcam, ab150117) that matches the animal species of the Flag antibody source, dilute it to an appropriate concentration with PBS, drop the diluted secondary antibody on the cell slide, and incubate at 37 °C in the dark for 1 hour. After the incubation, rinse the cells 3 times with PBS to remove the unbound secondary antibody. Then drop the anti-fluorescence quenching mounting medium containing DAPI on the slide, and invert the slide on the glass slide. After the mounting medium dries, fluorescence microscopy can be performed.

[0062] For the dual regulation system, the schematic diagram of the spatio-temporal control of AscI expression is shown in Figure 2 B in [reference], that is, first add Dox (1 mg / mL, 12 h) to the culture medium to induce the expression of ERT2-AscI, and then perform immunofluorescence staining according to the above steps. According to the immunofluorescence results, select and retain those single-cell clones with moderate expression levels, transfer the remaining half of the cells to a 6-well plate for expansion culture, and then gradually transfer them to larger culture containers, such as 10-cm culture dishes, culture flasks, etc., and perform cell cryopreservation for subsequent experimental studies.

[0063] Example 3

[0064] This example aims to verify that double-strand breaks can be induced in the AscID cell line.

[0065] After double-strand breaks occur in cells, the ATM protein (ataxia-telangiectasia mutated protein) is recruited to the vicinity of the damage site and undergoes autophosphorylation (pATM) to become activated. The activated ATM rapidly phosphorylates histone H2AX to form γH2AX. 53BP1 (p53-binding protein 1) can recognize and bind to γH2AX through its BRCT domain, thereby being recruited to the DNA double-strand break site. When DNA double-strand breaks occur, the phosphorylation levels of ATM and H2AX increase (i.e., the levels of pATM and γH2AX increase), and obvious punctate structures form at the damage site. At the same time, 53BP1 rapidly changes from a diffuse state to aggregation at the damage site, also forming obvious punctate structures, namely 53BP1 foci. Therefore, pATM, γH2AX, and 53BP1 foci are widely used as biomarkers for DSBs to indicate double-stranded DNA damage.

[0066] In this example, the occurrence of DSBs in the AscID cell line was verified through the following experiments: 1. Western blot detection: 300 nM 4-OHT was added to the culture medium, and cells were collected after treatment for different times. The levels of γH2AX and pATM were detected by western blot to observe the time of DSB occurrence. The experimental results showed ( Figure 3 ), that treatment with 4-OHT for 1.5 h could trigger sufficient DNA damage, manifested as an increase in the levels of pATM and γH2AX.

[0067] 2. Immunofluorescence detection: Dox (1 mg / mL) was added to the doubly regulated AscID cell line. After treatment for 12 hours, the expression of 3×Flag-ERT2-AscI was detected by immunofluorescence. The experimental results ( Figure 4 in the red fluorescence channel) showed that Dox induced the expression of 3×Flag-ERT2-AscI in the cytoplasm. Subsequently, after adding 300 nM 4-OHT and treating for 1.5 h, the immunofluorescence results showed that 3×Flag-ERT2-AscI was induced to translocate into the nucleus ( Figure 4 the red fluorescence channel is 3×Flag-ERT2-AscI, and the blue fluorescence channel is the nucleus). Co-immunostaining of 53BP1 showed that after 3×Flag-ERT2-AscI entered the nucleus, the number of 53BP1 foci increased sharply ( Figure 4 shown in the green fluorescence channel), indicating that a large number of DSB events occurred.

[0068] 3. CUT&Tag-seq experimental verification: The CUT&Tag-seq experiment was used to verify the DSBs events occurring at the AscI sites in the genome of the AscID cell line. The CUT&Tag experiment used the Hyperactive Universal CUT&Tag Assay Kit for Illumina Pro (TD904) kit from Novoprotein Scientific Inc., and the experimental steps were carried out according to the kit instructions. The generated sequencing library was sequenced on the illumina high-throughput sequencing platform to obtain the sequencing results. Specific antibodies against two DSBs markers, 53BP1 and γH2AX, were used in the CUT&Tag experiment to detect DSBs events in the genome.

[0069] The experimental results are as Figure 5 shown. After treating AscID cells with 4-OHT, obvious enrichment of 53BP1 ( Figure 5 A in Figure 5 ) and γH2AX ( Figure 5 B in

[0070] ) could be detected at the AscI sites in the cell genome, indicating that double-strand break events occurred at these AscI sites.

[0070] More importantly, in the CUT&Tag-seq results, obvious concave shapes of 53BP1 and γH2AX were observed near the AscI sites ( Figure 5 magnified views of A and B in

[0071] ), meaning that the DNA on both sides of the AscI site was broken and partially excised, which is a typical characteristic of DNA double-strand breaks.

[0071] Taking the CUT&Tag-seq sequencing results on human chromosome 13 as an example, the gene coverage map ( Figure 6 ) shows that enrichment of 53BP1 ( Figure 6 A in ) and γH2AX ( Figure 6 B in ) could be detected at the AscI sites ( Figure 6 shown by the red line in Figure 6 ), indicating that double-strand break events occurred at these AscI sites.

Claims

1. A plasmid vector capable of inducing targeted double-strand breaks in genomic DNA, characterized in that, Based on a lentiviral vector backbone, it contains the following elements: The coding sequence of the DNA endonuclease AscI; And the ERT2 element, which is used for chemically induced regulation of the nuclear localization of the DNA endonuclease AscI; or The ERT2 element and the Tet-on element, where the ERT2 element is used for chemically induced regulation of the nuclear localization of the DNA endonuclease AscI, and the Tet-on element is used for chemically induced regulation of the expression of the DNA endonuclease AscI gene.

2. The plasmid vector according to claim 1, wherein The coding sequence of the DNA endonuclease AscI has been codon-optimized, and the sequence is as shown in SEQ ID NO.

3.

3. The plasmid vector according to claim 1, wherein The Tet-on element induces the expression of AscI through doxycycline, and the ERT2 element induces the nuclear localization of AscI through 4-hydroxytamoxifen.

4. The plasmid vector according to claim 1, wherein The plasmid vector is in any of the following forms: Single control system: Connect the ERT2 element and the coding sequence of the DNA endonuclease AscI downstream of a constitutive promoter; Dual control system: Connect the ERT2 element and the coding sequence of the DNA endonuclease AscI downstream of an inducible promoter regulated by the Tet-on element, and eliminate the DNA endonuclease AscI cleavage site in the vector through site-directed mutagenesis.

5. The plasmid vector according to claim 4, characterized in that, In the single control system, the lentiviral vector used is pLVX-IRES-puro, and the constitutive promoter is the CMV promoter.

6. The plasmid vector according to claim 4, characterized in that, In the dual control system, the lentiviral vector used is pLVX-TetOne-puro, and the inducible promoter is the TRE3GS promoter; In the dual control system, the cleavage site of the DNA endonuclease AscI is mutated from GGCGCGCC to GGGCCGCC.

7. A cell line capable of inducing targeted double-strand breaks in genomic DNA, characterized in that, Constructed through the following steps: Co-transfect the plasmid vector described in any one of claims 1-6 with a lentiviral packaging plasmid into engineering cells to package and produce lentivirus; Infect the target cells with the lentivirus and screen to obtain a monoclonal cell line with stable expression.

8. The cell line according to claim 7, characterized in that, The monoclonal cell line induces DNA double-strand breaks in the following ways: When the monoclonal cell contains the coding sequence of the DNA endonuclease AscI and the ERT2 element: Add 4-hydroxytamoxifen during culture to induce nuclear import, and induce DNA double-strand breaks at specific loci in the genome; When the monoclonal cell contains the coding sequence of the DNA endonuclease AscI, the ERT2 element, and the Tet-on element: First add doxycycline to the culture medium to induce the expression of the ERT2 element and the coding sequence of the DNA endonuclease AscI, and then add 4-hydroxytamoxifen to induce the nuclear import of the ERT2 system and the coding sequence of the DNA endonuclease AscI, and induce DNA double-strand breaks at specific loci in the genome.

9. The cell line according to claim 8, wherein The concentration of 4-hydroxytamoxifen is 300 nM, and the induction time is at least 1.5 h; The concentration of doxycycline is 1 μg / mL, and the induction time is 4-12 h.

10. The application of the cell line described in any one of claims 7-9 in studying DNA damage repair mechanisms, gene editing, or high-throughput screening of DNA repair regulatory drugs.

Images