Retinitis pigmentosa animal model and construction method and application thereof

Abstract

The invention relates to a method for constructing a retinitis pigmentosa (RP) animal model. The method comprises the step of introducing a human-derived RPGR gene segment comprising RPGR gene mutation into an animal genome. The invention also relates to the RP animal model constructed by the method and application of the animal model in in-vivo evaluation of efficacy and / or safety of a gene editing drug for treating RP.

Description

Technical Field

[0001] This application relates to the field of biomedicine, specifically to a method for constructing a retinitis pigmentosa (RP) animal model, an RP animal model constructed by this method, and the use of this animal model in evaluating the efficacy and / or safety of gene editing drugs for treating RP in vivo. Background Art

[0002] Retinitis pigmentosa (RP) is a hereditary blinding eye disease characterized by the progressive and selective loss of retinal photoreceptor cells and retinal pigment epithelial cells. It is one of the main causes of irreversible binocular blindness in children and working-age populations. RP is usually caused by gene mutations, and X-linked retinitis pigmentosa (xlRP) has an early onset and a rapid disease progression, which is a relatively severe type of RP 1 , and there is currently no effective treatment. X-linked retinitis pigmentosa accounts for 10-20% of total RP patients, and more than 70% of them are caused by RPGR gene mutations 1 . It is estimated that about 210,000 - 420,000 RP patients are caused by RPGR gene mutations.

[0003] The RPGR gene has 10 transcripts, and 5 of them can be translated into proteins. The two main transcripts are as follows: the basic transcript RPGR Ex1-19 and the retina-specific expression transcript RPGR ORF15. RPGR Ex1-19 has a total of 19 exons, with a CDS length of 2448 bp, encoding a protein containing 816 amino acids, about 90 kDa. RPGR ORF15 contains exons 1-14 and an open reading frame 15, namely ORF15, with a total CDS of 3459 bp, encoding a protein containing 1152 amino acids, about 200 kDa. The ORF15 region consists of exon 15 and a part of intron 15, and has a special AG repeat sequence, encoding a 567-amino acid sequence rich in glycine and glutamate. Both of the above two transcripts encode a domain similar to regulator of chromosome condensation 1 (RCC1) between amino acids 54-367 at the N-terminus (exons 3-10); the C-terminus is rich in basic amino acids and is also called the basic functional domain. The ORF15 region of the RPGR gene is a high-mutation site, and more than 60% of RPGR mutations are located in the ORF15 region 2 .

[0004] In February 2020, Nat Med reported the results of a clinical trial of RPGR gene replacement therapy conducted by the University of Oxford, but the clinical treatment effect was very limited 3The reason is that the mutation hot spot of the RPGR gene is located in the ORF15 region of the last exon. There is a special AG repeat sequence in the ORF15 region, which is prone to mutation. At the same time, as the last exon, mutations in the ORF15 region will not cause the degradation of its mRNA through the NMD pathway, and truncated abnormal proteins will be translated, thus causing diseases. 4 Moreover, the precise control of the expression level of the RPGR protein is also crucial. During replacement therapy, the exogenous gene carried is not regulated endogenously in the body, and its expression level is difficult to control. Overexpression of RPGR results in a more severe phenotype than gene knockout. 5 Furthermore, the RPGR gene has complex post-transcriptional processing, while the exogenous target gene carried by AAV does not have intron sequences, making splicing errors prone to occur. 6 Considering the above factors, gene replacement therapy is not the best option for the mutation hot spot ORF15 region of the RPGR gene, and better gene therapy methods need to be explored. Gene editing is a set of technologies used to modify the genomes of organisms. Endonucleases are used to generate double-strand breaks at specific positions in the genome, and the break points are repaired through the endogenous DNA repair process. During this repair process, the genome can be modified to obtain the desired genotype. Due to advantages such as simple target design, easy operation, low cost, and high editing efficiency, CRISPR / Cas9 has been widely applied in fields such as cell line modification, establishment of disease animal models, and gene therapy. Through the AAV viral vector, for the mutations in the ORF15 region of the human RPGR gene mutation hot spot, the CRISPR / Cas9 gene editing technology specifically targets the intron 14 region of human RPGR through the sequence of the sgRNA. By introducing the Cas9 protein exogenously and providing a repair template, precise repair of the ORF15 region of the RPGR gene can be achieved.

[0005] Animal models of gene mutations (naturally occurring or genetically engineered) are important tools for studying the functions of target genes, the pathogenesis of diseases, and the effectiveness of treatment methods. In a good animal model, the disease progression should be fast enough so that researchers can evaluate the treatment results within a reasonable time frame; however, the disease progression should not be "too fast and unstoppable" because if the disease progresses too fast, it is difficult to evaluate the efficacy, and this disease has no similarity to human diseases.

[0006] In recent years, several RPGR animal models have been reported. The first mouse model has exons 4-6 of the RPGR gene knocked out. 7。The retina of the mouse develops normally and begins to degenerate around 2 months of age. The opsin in cone cells is mislocalized to the inner segment and synaptic sites, and the rhodopsin in rod cells decreases. However, the retinal structure and ERG of the mouse are still within the normal range. At 6 months of age, the photoreceptor cells in the mouse retina are significantly reduced, and the visual function is affected. The second mouse model is a conditional knockout of exon 1 of the RPGR gene. At 5-6 months of age, the thickness of the outer nuclear layer (ONL) of the retina in this model is slightly thinned, and the amplitude of the ERG wave is slightly decreased. At 13 months of age, there is a significant difference in the thickness of the ONL, and the amplitude of the ERG wave is also significantly reduced. 8 。The third animal model is RD9, a naturally occurring mouse model with a 32-bp repeat sequence in ORF15 (687-719 in the ORF15 region). The ONL of the retina in the model mice is not different from that of the wild type (WT) at 2 months of age, but the thickness of the inner segment + outer segment (IS+OS) is significantly thinned. At 12 months of age, the thickness of the ONL is slightly thinned, and at 24 months of age, the ONL is 50% of that of the WT. 9 。There is no RPGR-ORF15 protein in the retinas of the second and third mouse models, which can well simulate the retinal degeneration in the late stage of human diseases. There are also two canine models, XLPRA1 and XLPRA2, carrying RPGR gene mutations. 10 。XLPRA1 has a 5-bp deletion (c.1028-1032del) in ORF15, resulting in a 230-amino acid deletion at the C-terminus, premature termination of translation, and the generation of a truncated RPGR protein. The lesion starts from rod cells and eventually affects cone cells, but the development is slow. XLPRA2 has a 2-bp deletion (c.1084-1085del) in ORF15, resulting in a frameshift mutation. After the mutation, 34 new amino acids are added, and 161 amino acids at the C-terminus are deleted, and translation is prematurely terminated. The phenotype of this model is more severe than that of XLPRA1, and the disease starts at 5 weeks of age. The above animal models are widely used in the disease research of xlRP caused by RPGR mutations and also provide a key pharmacodynamic evaluation system for gene replacement therapy.

[0007] However, based on the mechanism of action of gene editing therapy and the characteristics of sequence-targeted specificity, there are no sites in existing xlRP animal models where gene editing drugs can act, and the efficacy of gene editing drugs cannot be effectively evaluated. In addition, in drug safety research experiments, to fully verify the safety of drugs, relevant species need to be selected for toxicological research. Relevant species refer to those animals on which the test substance can produce pharmacological activity. Since gene editing drugs play a therapeutic role by specifically targeting mutant DNA through the CRISPR / Cas9 system and then repairing protein expression, only models with gene editing drug target sites can effectively exert pharmacological activity. No DNA sequence completely identical to human RPGR has been found in conventional animal species. Therefore, it is necessary to further search for more suitable animal models. Summary of the Invention

[0008] In view of the above problems, the present inventors conducted in-depth research and unexpectedly found that by introducing a human RPGR gene fragment including an RPGR gene mutation (especially a fragment including ORF15 with a gene mutation) into the animal genome, while introducing a drug targeting site, it is possible to ensure that the model animal has a RP disease phenotype similar to that of human xlRP. Thus, this model can be used for in vivo efficacy studies of gene editing drugs for xlRP patients and provides an effective safety evaluation system for gene editing therapeutic drugs for RPGR-xlRP.

[0009] Therefore, on the one hand, the present invention provides a method for constructing a retinitis pigmentosa (RP) animal model, which method comprises replacing one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 or 19) exons, one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17 or 18) introns, ORF15 or a combination thereof (e.g., a combination of ORF15 and one or more (e.g., 2, 3, 4 or 5) adjacent introns and / or exons or parts thereof, such as a combination of intron 13, exon 14 and part of intron 14 with ORF15) of the retinitis pigmentosa GTPase regulator gene (RPGR gene) in the genome of the animal with the corresponding one or more exons, one or more introns, ORF15 or a combination thereof (e.g., a combination of ORF15 and one or more (e.g., 2, 3, 4 or 5) adjacent introns and / or exons or parts thereof, such as a combination of intron 13, exon 14, part of intron 15 with ORF15) of the human RPGR gene having one or more RPGR gene mutations, wherein the RPGR gene mutation is an RPGR gene mutation causing human RP, more preferably the RPGR gene mutation is in ORF15 of the RPGR gene, and still more preferably the RP is X-linked retinitis pigmentosa (xlRP).

[0010] In certain embodiments, the gene mutation is selected from point mutation, deletion mutation, insertion mutation, and inversion or duplication mutation, preferably a point mutation, the point mutation is a missense mutation or a nonsense mutation, and more preferably the gene mutation can be repaired by gene editing technology.

[0011] In certain embodiments, the animal is a non-human mammal, preferably a ruminant, a canine, a lagomorph, a felid or a rodent, more preferably a mouse, a pig, a monkey, a bear, a sheep, a goat, a horse, a donkey, a rabbit, a cat, a cow, a fox or a dog, still more preferably a mouse or a rat, still more preferably a C57BL / 6 mouse or a BALB / c mouse, still more preferably a C57BL / 6J and a C57BL / 6N mouse, and most preferably a C57BL / 6J mouse.

[0012] In certain embodiments, the exon includes exons 1 to 19 of the RPGR gene (e.g., exons 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, and 18), and the intron includes introns 1 to 18 of the RPGR gene (e.g., introns 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, and18); preferably, the corresponding ORF15 in the genome of the animal is replaced with a human ORF15 having an RPGR gene mutation; more preferably, the corresponding intron 13-exon 14-ORF15 fragment in the genome of the animal is replaced with a human fragment including intron 13-exon 14-ORF15 having an RPGR gene mutation, wherein the RPGR gene mutation is in the ORF15 of the RPGR gene; and / or preferably, the RPGR gene mutation is a nonsense mutation, and more preferably, the nonsense mutation is c.1905+76G>T.

[0013] In certain embodiments, the animal is a mouse, preferably a C57BL / 6J mouse; and the method includes replacing the corresponding intron 13-exon 14-ORF15 fragment in the genome of the mouse with a human fragment including intron 13-exon 14-ORF15 having a nonsense mutation in ORF15; more preferably, the nonsense mutation is c.1905+76G>T; and / or most preferably, the human fragment including intron 13-exon 14-ORF15 having a nonsense mutation is as shown in SEQ ID NO:1.

[0014] In certain embodiments, the replacement is achieved by the following gene editing techniques: CRISPR / Cas technique; zinc finger nuclease technique (ZFN); or transcription activator-like effector nuclease technique (TALEN); preferably CRISPR / Cas9.

[0015] In certain embodiments, the method includes: 1) introducing, by gene editing technique, a fragment including one or more exons, one or more introns, ORF15, or a combination thereof of the human RPGR gene having one or more RPGR gene mutations into a fertilized egg of the animal to replace the corresponding one or more exons, one or more introns, ORF15, or a combination thereof of the RPGR gene in the genome of the animal, and identifying and obtaining F0 generation animals with the fragment of the human RPGR gene correctly inserted into the genome; and 2) crossing the F0 generation animals with wild-type animals for germline transmission to obtain F1 generation animals, and identifying animals with the fragment of the human RPGR gene correctly inserted into the genome, preferably the animals are hemizygotes or homozygotes, male or female, and more preferably male homozygotes.

[0016] In certain embodiments, the animal is a mouse, and / or the identification is by PCR identification or by Southern blot identification.

[0017] In certain embodiments, the method further comprises one or more of the following steps:

[0018] 1) Detecting fundus changes in model mice by fundus photography anomaly (FP) and optical coherence tomography (OCT); and

[0019] 2) Determining changes in visual function of model mice by electroretinogram (ERG).

[0020] In certain embodiments, the method further comprises: selecting an animal consistent with the disease phenotype of human RP patients as an RP animal model.

[0021] In another aspect, the present invention provides an RP animal model prepared by the method according to the above, preferably a mouse model.

[0022] In another aspect, the present invention provides a method for identifying and / or testing a gene editing drug for treating RP, comprising:

[0023] 1) Administering the gene editing drug to an RP animal model prepared by the method according to the above;

[0024] 2) Determining whether the RPGR gene mutation is repaired or reversed by the gene editing drug, that is, whether correct RPGR mRNA can be expressed; and

[0025] 3) Optionally, detecting whether the disease phenotype of RP in the animal model is improved;

[0026] If the RPGR gene mutation is repaired or reversed by the gene editing drug, and / or the disease phenotype of RP in the animal model is improved, it indicates that the gene editing drug can be effectively used for treating RP.

[0027] In certain embodiments, in the above method, the animal in step 1) is a mouse; the administration in step 1) is subretinal injection; the repair in step 2) is identified by PCR identification, by Southern blot identification or by Sanger sequencing; and / or the detection of the disease phenotype of RP in the animal model in step 3) comprises one or more of the following steps: a) Detecting fundus changes in the model animal by fundus photography anomaly (FP) and optical coherence tomography (OCT); and b) Determining changes in visual function of the model animal by electroretinogram (ERG).

[0028] In some embodiments, in the above method, the gene editing drug includes a CRISPR / Cas9 gene editing drug, preferably in the form of a recombinant adeno-associated virus (rAAV) vector.

[0029] On the other hand, the present invention also provides the use of the above RP animal model for in vivo evaluation of the efficacy and / or safety of gene editing drugs for treating RP, preferably the RP is X-linked retinitis pigmentosa (xlRP).

[0030] Those skilled in the art can easily insight into other aspects and advantages of the present application from the following detailed description. Only the exemplary embodiments of the present application are shown and described in the following detailed description. As those skilled in the art will recognize, the content of the present application enables those skilled in the art to make changes to the disclosed specific embodiments without departing from the spirit and scope of the invention involved in the present application. Accordingly, the descriptions in the drawings and the specification of the present application are merely exemplary and not restrictive. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] The above features and advantages of the present invention will become more apparent from the following detailed description in conjunction with the drawings, wherein:

[0032] Figure 1 is a schematic diagram of the construction of a humanized xlRP disease model mouse;

[0033] Figure 2 is a mouse genotype identification strategy;

[0034] Figure 3 shows the PCR detection of the genotype of the model mouse;

[0035] Figure 4 shows the sequencing identification of the gene insertion site of the transgenic mouse;

[0036] Figure 5 shows the sequencing identification of the mutation site of the transgenic mouse;

[0037] Figure 6A shows a schematic diagram of the Southern blot analysis strategy;

[0038] Figure 6B shows the Southern blot detection of the genotype of the transgenic mouse;

[0039] Figure 7 shows the mRNA transcript detection of the humanized mouse model;

[0040] Figure 8 shows wild-type (WT) mice (RPGR+ / +) and female heterozygotes (Female

[0041] -RPGR + / hMut) and male homozygotes (Male-RPGR hmut ) of the RPGR mutant humanized mice for FP and OCT;

[0042] Figure 9 Showing the ERG amplitudes of WT mice (RPGR + / + ) and female heterozygotes (Female-RPGR + / hMut ) and male homozygotes (Male-RPGR hmut ) humanized RPGR mutant mice. n = 16; 2way-ANOVA; ****p < 0.0001, ***p < 0.001, **p < 0.01, *p < 0.05;

[0043] Figure 10 Showing the changes in ERG amplitudes of female heterozygotes (Female-RPGR + / hMut ) and male homozygotes (Male-RPGR hmut ) humanized RPGR mutant mice of different ages. n = 16; 2way-ANOVA; ****p < 0.0001, ***p < 0.001;

[0044] Figure 11 Showing the editing effect of AAV-Cas9-sgRNA RPGR in the humanized mouse model by PCR and RT-PCR;

[0045] Figure 12 Showing the fundus effect of AAV-Cas9-sgRNA RPGR on Male-RPGR hMut mice; and

[0046] Figure 13 Showing the effect of AAV-Cas9-sgRNA RPGR on the retinal function of Male-RPGR hMut mice; n = 16; 2way-ANOVA; ****p < 0.0001, ***p < 0.001, **p < 0.01, *p < 0.05. Detailed implementation manners

[0047] Unless otherwise indicated, the terms used herein have the ordinary technical meaning understood by those skilled in the art. For definitions and terms in the art, those skilled in the art are particularly recommended to refer to Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd Edition, Cold Spring Harbor Press, Plainsview, New York (1989); and Ausubel et al., Current Protocols in Molecular Biology (Supplement 47), John Wiley & Sons, New York (1999).

[0048] In this application, the term "retinitis pigmentosa (RP)" generally refers to a hereditary blinding eye disease (Retinitis Pigmentosa, RP) characterized by the progressive and selective loss of retinal photoreceptor cells (cone cells and rod cells) and retinal pigment epithelial cells. The inheritance pattern of RP can include autosomal recessive inheritance (arRP), autosomal dominant inheritance (adRP), and X-linked inheritance (xlRP), among which xlRP has an early onset and the most severe damage. The clinical manifestations of RP can include night blindness, progressive visual field defects, decreased central vision after the macula is involved, and ultimately blindness. The main fundus changes in RP are pigment disorders in the equatorial retina, the appearance of osteocyte-like pigmentation, which gradually develops towards the posterior pole and the ora serrata. The retinal pigment epithelial cells (RPE), photoreceptor cells, and choroidal capillary layer gradually atrophy, revealing large choroidal blood vessels. The retina appears bluish-gray, the retinal artery becomes thinner, and the optic disc shows waxy yellow atrophy. Methods for evaluating retinal function and morphology can include Best Corrected Visual Acuity (BCVA), fundus autofluorescence, visual field examination, electroretinography (ERG), fundus color photography, optical coherence tomography (OCT), and fluorescein angiography (FFA), etc.

[0049] In this application, the term "X-linked retinitis pigmentosa (RP)" generally refers to X-linked retinitis pigmentosa, also known as xlRP. Currently, approximately 70% - 75% of xlRP is caused by mutations in the RPGR gene, and more than 75% of RPGR mutations are located in RPGR ORF15The ORF15 region of the last exon of the subtype. The clinical signs of the xlRP include, but are not limited to, reduced peripheral vision, reduced central (reading) vision, reduced night vision, loss of color perception, decreased visual acuity, decreased photoreceptor cell function, and pigment changes.

[0050] In the present application, the term "human retinitis pigmentosa GTPase regulator" is named Retinitis pigmentosa GTPase regulator in English, encoded by the RPGR gene, and is usually a protein with a series of RCC1-like domains (RLD). The "gene encoding the retinitis pigmentosa GTPase regulator" can also be referred to as the "RPGR gene" in this article. The "retinitis pigmentosa GTPase regulator" can include the full-length gene itself or its functional fragments. The retinitis pigmentosa GTPase regulator can be derived from any mammal that naturally expresses the RPGR gene or its homologs, such as primates (e.g., humans), rodents (such as mice, rats). The "RPGR gene" can encode transcripts of multiple different splice forms of subtypes, and this article can include all its splice forms, transcripts, and / or functional variants. For example, human RPGR subtypes can include subtype A, subtype C, subtype D, subtype E, subtype F, subtype G, subtype I, and subtype J. Subtype A and subtype C are full-length human RPGR subtypes. For example, the nucleotide sequence of exemplary subtype A can be found in NCBI accession number NM_000328.3, and the amino acid sequence can be found in NCBI accession number NP_000319.1. The nucleotide sequence of exemplary subtype C can be found in NCBI accession number NM_001034853.2, and the amino acid sequence can be found in NCBI accession number NP_001030025.1.

[0051] Subtype RPGR ex1-19 (Derived from exon 1 to exon 19, corresponding to subtype A above) and RPGR ORF15 (Derived from exon 1 to a part of intron 15, corresponding to subtype C above) are two widely expressed subtypes of RPGR. Among them, RPGR ORF15 terminates before exons 16 to 19, and the termination part of RPGR ORF15 can be called ORF15, and in this article, it is also called "RPGR ORF15". RPGR ORF15 subtype is essential for normal rod and cone function in the retina and is mainly expressed in photoreceptor cells.

[0052] In the present application, the term "RPGR ORF15" or "ORF15" generally refers to RPGR ORF15A terminator portion at the subtype end, which may include a part of exon 15 and intron 15 of the RPGR gene. RPGR ORF15 contains a long guanine-rich repeat sequence, called a highly conserved guanine nucleotide exchange factor. This sequence has poor stability and complex post-transcriptional processing, and is usually difficult to clone into cDNA and is unstable in recombinant DNA operations. RPGR ORF15 is also a hot spot for RPGR gene mutations. The nucleotide sequence of an exemplary wild-type RPGR ORF15 is shown as SEQ ID NO:101 in WO2022021149A1.

[0053] In the present application, the term "gene mutation" refers to a change that occurs in a DNA sequence, which may be a single base substitution, insertion or deletion in the gene sequence, or may be a larger gene deletion, duplication or inversion.

[0054] In the present application, the term "point mutation" refers to the substitution of a single base in a gene sequence, which may include missense mutations and nonsense mutations in the present invention. A missense mutation refers to the replacement of one amino acid by another, which may lead to changes in the protein structure and function. A nonsense mutation refers to the replacement of a codon by another stop codon, which results in the termination of protein synthesis.

[0055] In the present application, the terms "deletion mutation" and "insertion mutation" refer to the insertion or deletion of one or more bases in a gene sequence. This may change the amino acid sequence of the protein and lead to changes in the protein structure and function.

[0056] In the present application, the term "inversion mutation" refers to the inversion of two adjacent regions in a gene sequence, which may lead to changes in gene function.

[0057] In the present application, the term "duplication mutation" refers to the repeated insertion of one or more bases in a gene sequence, which may lead to changes in gene function.

[0058] The term "AAV" generally refers to the abbreviation of adeno-associated virus and can be used to refer to the virus itself or its derivatives. The AAV may include AAV type 1 (AAV-1 or AAV1), AAV type 2 (AAV-2 or AAV2), AAV type 3 (AAV-3 or AAV3), AAV type 4 (AAV-4 or AAV4), AAV type 5 (AAV-5 or AAV5), AAV type 6 (AAV-6 or AAV6), AAV type 7 (AAV-7 or AAV7), AAV type 8 (AAV-8 or AAV8), AAV type 9 (AAV-9 or AAV9), avian AAV, bovine AAV, canine AAV, equine AAV, primate AAV, non-primate AAV, and ovine AAV, etc.

[0059] In the present application, the term "RPGR gene mutation" refers to any mutation of the RPGR gene that causes human RP, including point mutations, deletion mutations, insertion mutations, and inversion or duplication mutations. The mutation can be in exons 1-19, such as exons 1-14, or in ORF15. For example, the mutation can be c.581G>A, c.808C>T, c.1243_1244dupAG, c.1571delA, c.1572+1G>A, c.2218G>T(p.E740X), c.2234_2237del(p.R745fs), c.2236_2237delGA(p.E746Rfs*23), c.2268_2269delAG, c.2405_2406delAG(p.E802Gfs*32), c.2420_2435del16bp, c.2426_2427delAG, c.2628_2629delGG, c.2236_2237delGA, c.2586_2587delGG, c.2650G>T or c.2993_2997delAAGGG, where del represents deletion, dup represents duplication, G>A represents a point mutation of G to A, C>T represents a point mutation of C to T, and the meanings of the remaining expressions are similar.

[0060] In the present application, the term "gene editing drug" refers to a reagent, kit, system, or combination thereof used in the gene editing process by gene editing technology. The gene editing technology includes CRISPR / Cas technology; zinc finger nuclease technology (ZFN); or transcription activator-like effector nuclease technology (TALEN); preferably CRISPR / Cas9.

[0061] In the present application, the animal used to construct the animal model can be any animal with the RPGR gene, such as non-human mammals, preferably ruminants, canines, lagomorphs, felines or rodents, more preferably mice, pigs, monkeys, bears, sheep, goats, horses, donkeys, rabbits, cats, cows, foxes or dogs, even more preferably mice or rats, and even more preferably C57BL / 6 mice or BALB / c mice. C57BL / 6 mice are one of the most widely used experimental animals. Compared with BALB / c mice, their fundus contains pigments and is more suitable as an animal model for studying retinal diseases. C57BL / 6 mice have two main substrains: C57BL / 6J and C57BL / 6N. C57BL / 6N has a Crb1 rd8 mutation, resulting in mild retinal degeneration. Therefore, the present invention most preferably uses C57BL / 6J mice as the basis for model construction.

[0062] In one embodiment of the present invention, a method for constructing an animal model of retinitis pigmentosa (RP) is provided. The method includes replacing one or more exons, one or more introns, ORF15, or a combination thereof of the retinitis pigmentosa GTPase regulator gene (RPGR gene) in the genome of the animal with the corresponding one or more exons, one or more introns, ORF15, or a combination thereof of the human RPGR gene having one or more RPGR gene mutations, wherein the RPGR gene mutation is an RPGR gene mutation that causes human RP (for example, the mutations listed above regarding the term "RPGR gene mutation"), more preferably the RPGR gene mutation is in ORF15 of the RPGR gene, and still more preferably the RP is X-linked retinitis pigmentosa (xlRP).

[0063] In a preferred embodiment of the present invention, the RPGR gene mutation is a point mutation, such as a missense mutation or a nonsense mutation, and preferably the nonsense mutation is c.1905+76G>T.

[0064] In one embodiment of the present invention, the animal is a mouse, preferably a C57BL / 6J mouse; and the method includes replacing the corresponding intron 13-exon 14-ORF15 fragment in the mouse genome with a fragment of human intron 13-exon 14-ORF15 including a nonsense mutation in ORF15; more preferably the nonsense mutation is c.1905+76G>T; and / or most preferably the fragment of human intron 13-exon 14-ORF15 including the nonsense mutation is as shown in SEQ ID NO:1.

[0065] The mouse RPGR gene differs from the human RPGR gene. Before confirming the model construction strategy, the inventors fully considered the expression patterns of the mouse RPGR gene and the human RPGR gene. The mouse RPGR gene has only 18 exons and 9 transcripts. The human RPGR gene has 19 exons and 19 transcripts. In a preferred embodiment, in order to ensure that the model mice can be used for the efficacy and safety detection of gene editing drugs during model construction, the inventors considered replacing the mouse intron 13, exon 14, and part of intron 14 with the human intron 13, exon 14, exon 15, and part of intron 15 (for example, there are nonsense mutations in ORF15, such as c.1905+76G>T). In addition, considering that the splicing of part of mouse intron 13 and human intron 13 region may affect mRNA splicing, resulting in the abnormal expression of human RPGR-ORF15 RNA and protein. Therefore, in the examples, the inventors finally chose a more difficult way to replace the entire mouse intron 13 with the human sequence (the inserted sequence is about 5.4 kb). In a preferred embodiment, the above replacement is achieved by the following gene editing techniques: CRISPR / Cas technology; zinc finger nuclease technology (ZFN); or transcription activator-like effector nuclease technology (TALEN); preferably CRISPR / Cas9. When using the CRISPR / Cas9 technology for the above replacement, the sequences of the sgRNAs (gRNA1 and gRNA2) used are shown in SEQ ID NO:2 and SEQ ID NO:3 respectively. The inventors surprisingly found that the mouse RP model constructed in the above manner can have a phenotype similar to that of human RP (such as xlRP), and this phenotype can be repaired / reversed by gene editing, so that the animal RP model can be used to evaluate the efficacy and / or safety of gene editing drugs for treating RP (such as gene editing drugs targeting RPGR gene mutations in ORF15) in vivo.

[0066] Therefore, the present application for the first time provides a humanized mouse model for in vivo efficacy detection of gene editing therapy for X-linked retinitis pigmentosa (xlRP) caused by RPGR mutations.

[0067] The humanized mouse model obtained in the present invention contains the human RPGR gene intron 13 to the ORF15 sequence with the patient mutation site (such as nonsense mutation, such as c.1905+76G>T), and can be used for detecting the in vivo editing efficiency of gene editing drugs for RPGR patients caused by mutations in the RPGR-ORF15 region. In addition, the humanized mouse model has been identified to have the same disease phenotype as xlRP patients caused by RPGR mutations, and can be used as a model for in vivo efficacy studies of gene editing drugs. In addition, gene editing therapeutic drugs can effectively exert pharmacological activities in this model. Therefore, it can be used for preclinical drug safety evaluation.

[0068] In a preferred embodiment of the present invention, based on the homology between mouse RPGR and human RPGR gene, the present invention designs sgRNA for the intron 13 region of mouse RPGR gene, and simultaneously designs a donor vector "KI-c". The donor vector contains upstream and downstream homology arms and the hRPGR-intron13-exon14-ORF15-mut (1905+76G>T point mutation) region, and co-injects the donor DNA and Cas9 mRNA into fertilized eggs to generate targeted knock-in offspring.

[0069] F0 founder animals were identified by PCR and sequence analysis was performed. They were crossed with wild-type mice for germline transmission and F1 animal genotype identification tests. The PCR identification results showed that the humanized gene fragment was effectively inserted, and the sequencing results showed that the inserted sequence was consistent with the target sequence. The results of Southern blot experiments further indicated that the humanized model mice were successfully constructed. In addition, RT-PCR was used to confirm that the model mice could effectively express the humanized RPGR transcript and ensure correct mRNA splicing.

[0070] After confirming the mice with the target genotype were obtained, breeding was carried out, and disease phenotypes of mice at different ages were identified. For RP patients, abnormal fundus photography (FP) and progressive degeneration of photoreceptors are the main characteristic phenomena, leading to abnormal retinal structure and loss of visual function. In order to determine whether the RPGR mutant humanized mouse model has a similar pathogenesis and disease phenotype as RP patients, we detected the fundus changes of model mice by FP and OCT, and measured the visual function changes of model mice by ERG. The FP results showed that at 6 months old, female hemizygotes (Female-RPGR + / hMut ) and male homozygotes (Male-RPGR hmut ) of the humanized RPGR mutant mice showed tapetal reflex in the fundus, and it deteriorated with age. In addition, RPGR-ORF15 is located at the CC site of photoreceptors and is crucial for the transport of photoreceptor structural proteins. The OCT results showed phenotypes consistent with those previously observed in xlRP patients. Female hemizygotes (Female-RPGR+ / hMut ) and male homozygotes (Male-RPGR hmut ) showed enhanced reflectance in the retinal RPE-photoreceptor layer. ERG results showed that at 6 and 9 months of age, Female-RPGR + / hMut and Male-RPGR hMut mice had significantly reduced amplitudes of the scotopic a-wave and scotopic b-wave, suggesting impaired visual function in the RPGR mutant humanized mouse model. In addition, we further analyzed the progression of phenotypes in the two genotypes of mice with age. The results showed that the ERG amplitude of Male-RPGR hMut mice decreased more significantly with age.

[0071] To determine whether this model is suitable for the in vivo efficacy of gene editing drugs, 3-month-old male heterozygous mice with the same genotype as human patients and stable phenotypic progression were selected for the efficacy detection of gene editing drugs. The experimental results showed that after gene editing drugs were administered subretinally based on the mouse model, the mutant DNA sequence of the model mice could be correctly repaired, and the repaired sequence could effectively express the correct RPGR mRNA. In addition, the results of the retinal structure and function repair experiments further showed that 6 months after subretinal administration of gene editing drugs in the model mice, the fundus phenotypes and ERG damage were significantly restored. In addition, the effective repair of DNA indicated that the gene therapy drug could effectively exert its pharmacological activity in this mouse model, indicating that this model can be used for the safety evaluation of gene therapy for RPGR-xlRP.

[0072] The above results indicate that this humanized mouse disease model has the same disease phenotype as human RP patients, and can be used for the in vivo editing efficiency and efficacy verification of gene editing drugs. In addition, the gene editing drug has pharmacological activity in this mouse model in vivo and can be used for preclinical safety studies, providing a solid efficacy and safety detection model for the research and marketing of gene editing drugs.

[0073] The present invention is further illustrated in the following examples. These examples are for illustrative purposes only and are not intended to limit the scope of the present invention.

[0074] Examples

[0075] Example 1 Construction strategy of humanized xlRP disease mouse model

[0076] The construction strategy of the humanized xlRP disease mouse model is as Figure 1As shown in the figure. The mouse RPGR gene (NCBI reference sequence: NM_001177950.1) is located on the X chromosome of the mouse and contains a total of 18 exons. The ATG start codon is located in exon 1, and the TAA stop codon is located in exon 18. Process of constructing the model mouse: The region from intron 13 to intron 14 of the mouse RPGR gene was replaced with the KI region (the region from intron 13 to intron 15 of the human RPGR gene). In addition, to ensure the phenotype of the disease model, a mutation (c.1905+76G>T) that causes premature termination of protein translation in RPGR ORF15 was introduced into intron 15 of human RPGR. The specific targeting sequence (SEQ ID NO:1) is as follows (from the 5’→3’ direction, the first underlined part is the 5’ arm; the non-underlined part in the middle is the KI region, including human RPGR exons, where the bold underlined part represents c.1905+76G>T; the second underlined part is the 3’ arm):

[0077]

[0078]

[0079]

[0080] Based on the above construction strategy, the CRISPR / Cas9 gene editing technology was used to design targeting vectors for the mouse RPGR gene, namely gRNA1 and gRNA2. The gRNA sequences and corresponding target sites are shown in Table 1. The specific method for constructing the vector can be referred to the examples of WO2022021149A1. The above gRNA, donor DNA, and Cas9 mRNA were co-injected into the fertilized eggs of C57BL / 6J mice (purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd.) to generate targeted knock-in offspring and obtain F0 generation mice.

[0081] Table 1 Binding sites of targeting gRNA

[0082]

[0083] Example 2 Genotype identification of the first-generation (F1) model mice

[0084] (1) Genotype identification strategy

[0085] The genotype identification strategy is as Figure 2As shown, the genomic insertion was detected by PCR using the upstream primer (F1) designed upstream of the KI sequence and the downstream primer (R1) designed downstream of gRNA2, and the upstream primer (F2) designed upstream of gRNA1 and the downstream primer (R2) designed at the position where the KI sequence spans F1. To confirm the correctness of the inserted sequence in the model mice, we designed F3 in the upstream homologous arm and R3 in the downstream homologous arm, and sequenced the PCR product using F3 / R3 to confirm the correctness of the inserted sequence. In addition, the F6 sequencing primer was designed to detect whether the humanized mutation site was correctly introduced. The primer sequences are shown in Table 2.

[0086] Table 2 Primer sequences for genotype identification

[0087] Primer Primer Name Sequence F1 5’KI forward primer GTAAGGATTGATTCGGATTGAG(SEQ ID NO:6) R1 3’arm reverse primer TTAGCATGTTAGGGCTAGTGCTC(SEQ ID NO:7) F2 5’arm forward primer TGCGTCAATATGTCTTCTTCCTGG(SEQ ID NO:8) R2 3’KI reverse primer TAGTCGTAGCTGGCTGCGTCATG(SEQ ID NO:9) F3 5’Sequence primer AACTAGGAAAGGCTCCTCTCTTG(SEQ ID NO:10) R3 3’Sequence primer TACGGATTAGTAATTTGGGG(SEQ ID NO:11) F6 Mutation Sequence primer AGGAGAAGGAAGGAGCAGAGG(SEQ ID NO:12)

[0088] (2) Genotype identification of model mice

[0089] After obtaining the F0 generation mice, they were crossed with wild-type (WT) mice. After the F1 generation mice were born, their tails were cut for DNA extraction, and the F0 generation mice were genotyped by PCR using the F1 / R1 and F2 / R2 primer pairs respectively. The PCR results are as Figure 3 shown. For mice No. 14, 15, 16, and 19, a 4.6 kb positive insertion band could be effectively amplified by F1 / R1, and a 4.8 kb positive insertion band could be effectively amplified by F2 / R2. After PCR amplification using F3 / R3 and sequencing, the sequencing results are as Figure 4 shown. The upstream and downstream insertion sites were both correctly sequenced, indicating successful insertion of the human sequence. In addition, the F6 primer was used to sequence the F3 / R3 PCR product to confirm the correct insertion of the mutation site. The sequencing results are as Figure 5 shown, and the c.1905+76G>T site was correctly inserted.

[0090] Example 3 Southern Blot further confirmed the successful construction of the model

[0091] (1) Southern blot analysis strategy

[0092] Southern blot analysis was performed on the tail DNA samples of 4 F1 animals (mice No. 14, 15, 16, and 19) to confirm the correct gene insertion. The Southern blot analysis strategy is as Figure 6A shown. The mouse DNA samples were digested with ScaI and AvrII enzymes separately, and the size of the bands was analyzed by probes to confirm the correctness of the DNA insertion in the model mice. The probe sequences for Southern blot analysis are shown in Table 3.

[0093] Table 3 Probe sequences for Southern blot analysis

[0094]

[0095] (2) Southern blot analysis of the genomic insertion in the mouse model

[0096] The results of the Southern blot experiment are as Figure 6B shown. After digesting mouse DNA with ScaI and hybridizing and developing color with the 5’ Probe, only a 6.51 kb positive band appeared in the WT mice, only a 3.89 kb band appeared in male mice No. 14, 15, and 16, and both a 6.51 kb and a 3.89 kb band appeared in female mouse No. 19. After digesting mouse DNA with AvrII and hybridizing and developing color with the 3’ Probe, only a 2.34 kb positive band appeared in the WT mice, only a 5.57 kb band appeared in male mice No. 14, 15, and 16, and both a 2.34 kb and a 5.57 kb band appeared in female mouse No. 19. This indicates that male mice No. 14, 15, and 16 are target hemizygous mice, and mouse No. 19 is a transgenic heterozygous mouse.

[0097] Example 4 Detection of mRNA expression in the model mice

[0098] In the construction of the model mice, the humanized RPGR sequence was inserted into the mouse genome. To further detect whether the above-constructed model mice can correctly express the fused mRNA, we extracted mouse retinal and RPE RNA, and after reverse transcription, detected the expression of the fused RPGR mRNA by PCR. The PCR primer sequences are shown in Table 4. The PCR results are as Figure 7 shown. The 4th and 5th humanized fusion mRNA bands were not detected in the WT mice, while the heterozygous RPGR + / hmut and homozygous RPGR hmut / hmut mice could effectively detect the 405 bp positive band of the 4th and the 514 bp positive band of the 5th, indicating that the model mice can effectively express the fused RPGR mRNA and can be correctly spliced.

[0099] Table 4. Primer sequences for detecting mRNA expression in the model mice

[0100] Primer Sequence M-RPGR-e12-F cagcagtggattcagaaaactttgg(SEQ ID NO:17) M-RPGR-e14-R acttgcttgctttgtaagccct(SEQ ID NO:18) M-RPGR-e14-F gtcagggataccagaggagcag(SEQ ID NO:19) M-RPGR-ORF15-R TTTCATATCCAGGATGCACCTTGC(SEQ ID NO:20) M-RPGR-e16-R gttgcagaaggctggcactg(SEQ ID NO:21) H-RPGR-e15-R cctttcttcctccatgcaccttc(SEQ ID NO:22) H-ORF15-R Ccatcccctctaccttcaggc(SEQ ID NO:23)

[0101] Example 5 Phenotypic identification of the model mice

[0102] For xlRP patients, abnormal fundus color photographs (FP) and progressive photoreceptor degeneration are the main characteristic phenomena, leading to abnormal retinal structure and loss of visual function. To determine whether the above humanized RPGR mutant mouse model has a similar pathogenesis and disease phenotype to RP patients, we detected the changes in the fundus and retinal structure of the model mice by FP and OCT, and determined the changes in visual function by ERG.

[0103] As Figure 8 shown, the FP results showed that in 6-month-old female heterozygotes (Female-RPGR + / hMut ) and male hemizygotes (Male-RPGR hmut ), a tapetal reflex appeared in the fundus of the humanized RPGR mutant mice, and the phenotype deteriorated with age. In addition, the RPGR-ORF15 transcript was mainly localized in the CC region of photoreceptors and was crucial for the transport of photoreceptor structural proteins. The OCT results showed that there were no significant abnormalities in the outer nuclear layer of the retina in Male-RPGR hmut and Female-RPGR + / hMut mice at 6-9 months of age. However, the reflectivity of the RPE-photoreceptor layer was significantly enhanced, which was consistent with the previously observed phenomenon in xlRP patients. The tapetal reflex and enhanced reflectivity indicated that genetic defects in RPGR led to dysfunction of the connecting cilia of photoreceptor cells, possibly resulting in the accumulation of retinoid compounds in the inner segment of photoreceptors.

[0104] Furthermore, the changes in the retinal function of the model mice were detected by ERG. The ERG results were as Figure 9 shown. At 6 months and 9 months of age, the amplitudes of the scotopic a-wave and scotopic b-wave in Male-RPGR hmut and Female-RPGR + / hMut mice were significantly reduced, suggesting impaired visual function in the RPGR mutant humanized mouse model. In addition, the progression of the phenotypes of the two genotypes of mice with age was further analyzed. The results were as Figure 10 shown. With the increase of age, the decline of the ERG amplitude in Male-RPGR hmut mice was more obvious. Therefore, the humanized RPGR mutant mouse model has a similar pathogenesis and disease phenotype to human RP patients.

[0105] Example 6 The model mice can effectively detect the repair of gene editing drug DNA and RNA expression

[0106] Based on the more typical and severe clinical manifestations of male xlRP patients in the clinical statistics of this disease. Male-RPGR hmut mice were selected for in vivo efficacy evaluation. To confirm that the above mouse model can be used to detect the in vivo efficacy of gene editing therapeutic drugs, we designed a gene editing drug (see the experimental method in WO2022021149A1) based on the RPGR intron14 (IVS14) region of human RP patients and packaged it into an AAV viral vector. The drug code is AAV-Cas9-sgRNA RPGR(sgRNA sequence: GATGTGATCTTTGACAGTGAAA (SEQ ID NO:24); PAM: GAGAAT (SEQ ID NO:25)), and a pharmacodynamic verification experiment of single subretinal injection in humanized model mice was carried out. The experiment included a total of 3 dose groups: 3×10 8 / eye (3E8), 2×10 9 / eye (2E9), 3×10 9 / eye (3E9). The mice in each group were sacrificed 2 months after administration, and the retinas of the mice were isolated for DNA insertion, RNA splicing and expression detection. The in vivo repair mode was as shown in Figure 11 , A.

[0107] The PCR results showed that (the PCR primer sequences are shown in Table 5), positive insertion sites could be detected at the upstream insertion sites (P1 / P2) and downstream insertion sites (P3 / P4) in each dose group, and the Sanger sequencing results showed that the inserted sequence was consistent with the reference sequence, and no obvious heterozygous peaks appeared ( Figure 11 , B), indicating that the humanized mouse with the RPGR-ORF15 mutation site had its retinal DNA sequence effectively repaired after subretinal injection of AAV-Cas9-sgRNA RPGR . Further indicating that the AAV-Cas9-sgRNA RPGR injection solution has the function of DNA repair in vivo.

[0108] Table 5. Primer sequences for DNA insertion detection

[0109] Primer Sequence P1 GCAGCCAGCTACGACTATCG(SEQ ID NO:26) P2 GCTCTGCTCCAGAGGATCCC(SEQ ID NO:27) P3 TCGCATTGTCTGAGTAGGTGT(SEQ ID NO:28) P4 GTTCTGCTCCTGAACTACCT(SEQ ID NO:29)

[0110] The RT-PCR results showed that the target band of about 250 bp could be obtained by detecting the mRNA reverse transcribed by the primer pairs targeting exon 14 (E14) and Opti-ORF15 (the primer sequences are shown in Table 6). After sequencing, it was found that this target band did not contain IVS14, and the splicing site sequence was completely consistent with the reference sequence ( Figure 11 , C), indicating that the repaired DNA sequence could effectively express mRNA and could be correctly spliced into mature RPGR-ORF15 mRNA. The above results indicate that this model can effectively detect the DNA and RNA repair and expression of gene editing drugs.

[0111] Table 6. Primer sequences for mRNA splicing detection

[0112] Primer Sequence Forward primer GCAGCCAGCTACGACTATCG(SEQ ID NO:30) Reverse primer GCTCTGCTCCAGAGGATCCC(SEQ ID NO:31)

[0113] In addition, the effective repair of DNA indicates that gene therapy drugs can effectively exert their pharmacological activities in this mouse model. Based on the guiding principles for preclinical drug research, to fully evaluate drug safety, the safety evaluation plan should include the use of relevant species. Relevant species refer to those in which the test substance can produce pharmacological activities, indicating that this model can be used for the safety evaluation of gene therapy for RPGR-xlRP.

[0114] Example 7 The model mice can effectively detect the effects of gene editing drugs on disease phenotypes

[0115] To detect whether the above model mice can be used to evaluate the effects of gene editing drugs on the structure and function of the mouse retina, we injected AAV-Cas9-sgRNA at a single dose of 1E9 vg / eye RPGR , and performed FP, OCT, and ERG measurements 3 months and 6 months after injection. As Figure 12 shown, the FP results showed that compared with the Male-RPGR hMut group, the tapetal reflex phenotype of the fundus in the AAV-Cas9-sgRNA RPGR treatment group was significantly improved, indicating that AAV-Cas9-sgRNA RPGR could effectively improve the visual cycle process of the model mice. In addition, the OCT results also showed that compared with the Male-RPGR hMut group, the increase in the reflectivity of the RPE-photoreceptor cell layer in the AAV-Cas9-sgRNA RPGR group was alleviated to a certain extent.

[0116] In addition, we also further detected the changes in the retinal function of the mice by ERG. The ERG results are as Figure 13 shown. Compared with the control group, the scotopic a-wave of the ERG in the mice in the AAV-Cas9-sgRNA RPGR treatment group was significantly improved 3 months after injection. As the time after injection increased, at 6 months after injection, both the scotopic a-wave and b-wave of the ERG in the AAV-Cas9-sgRNA RPGR treatment group were significantly improved.

[0117] The above results indicate that after treatment with gene editing drugs, the fundus abnormalities and retinal function of the model mice were restored to a certain extent, indicating that the model mice can be effectively used for the in vivo evaluation of gene editing drugs for RPGR-xlRP.

[0118] Those skilled in the art should understand that although the present invention has been specifically described with reference to the above embodiments, the present invention is not limited to these specific embodiments. Based on the methods and technical solutions taught by the present invention, without departing from the spirit of the present invention, those skilled in the art can make appropriate modifications or improvements, and the equivalent implementation schemes obtained therefrom are all within the scope of the present invention.

[0119] References

[0120] 1 Talib, M. et al. CLINICAL AND GENETIC CHARACTERISTICS OF MALE PATIENTSWITH RPGR-ASSOCIATED RETINAL DYSTROPHIES: A Long-Term Follow-up Study. Retina39, 1186-1199, doi:10.1097 / IAE.0000000000002125(2019).

[0121] 2 Vervoort, R. et al. Mutational hot spot within a new RPGR exon in X-linked retinitis pigmentosa. Nat Genet 25, 462-466, doi:10.1038 / 78182(2000).

[0122] 3 Jasmina Cehajic-Kapetanovic, K.X., Cristina Martinez-Fernandez de la Camara, Anika Nanda, Alexandra Davies, Laura J. Wood, Anna Paola Salvetti, M. Dominik Fischer, James W. Aylward, Alun R. Barnard, Jasleen K. Jolly, Edmond Luo, Brandon J. Lujan, Tuyen Ong, Aniz Girach, Graeme C.M. Black5,6, Ninel Z. Gregori, Janet L. Davis, Potyra R. Rosa, Andrew J. Lotery8,9, Byron L. Lam, Paulo E. Stanga and Robert E. MacLaren Initial results from a first-in-human gene therapy trial on X-linked retinitis pigmentosa caused by mutations in RPGR. Nature Medicine(2020).

[0123] 4 Hong, D.H., Pawlyk, B.S., Adamian, M. & Li, T. Dominant, gain-of-function mutant produced by truncation of RPGR. Invest Ophthalmol Vis Sci 45, 36-41, doi:10.1167 / iovs.03-0787(2004).

[0124] 5 Wright, R.N., Hong, D.H. & Perkins, B. Misexpression of the constitutive Rpgr(ex1-19) variant leads to severe photoreceptor degeneration. Invest Ophthalmol Vis Sci 52, 5189-5201, doi:10.1167 / iovs.11-7470(2011).

[0125] 6 Megaw, R.D., Soares, D.C. & Wright, A.F. RPGR: Its role in photoreceptor physiology, human disease, and future therapies. Exp Eye Res 138, 32 - 41, doi:10.1016 / j.exer.2015.06.007 (2015).

[0126] 7 Hong, D.H. et al. A retinitis pigmentosa GTPase regulator (RPGR)-deficient mouse model for X-linked retinitis pigmentosa (RP3). Proc Natl Acad Sci U S A 97, 3649 - 3654, doi:10.1073 / pnas.060037497 (2000).

[0127] 8 Huang, W.C. et al. RPGR-associated retinal degeneration in human X-linked RP and a murine model. Invest Ophthalmol Vis Sci 53, 5594 - 5608, doi:10.1167 / iovs.12-10070 (2012).

[0128] 9 Thompson, D.A. et al. Rd9 is a naturally occurring mouse model of a common form of retinitis pigmentosa caused by mutations in RPGR-ORF15. PLoS One 7, e35865, doi:10.1371 / journal.pone.0035865 (2012).

[0129] 10 Zhang, Q. et al. Different RPGR exon ORF15 mutations in Canids provide insights into photoreceptor cell degeneration. Hum Mol Genet 11, 993 - 1003, doi:10.1093 / hmg / 11.9.993 (2002).

Claims

1. A method for constructing an animal model of retinitis pigmentosa (RP), the method comprising replacing one or more exons, one or more introns, ORF15, or a combination thereof of the retinitis pigmentosa GTPase regulator gene (RPGR gene) in the genome of the animal with the corresponding one or more exons, one or more introns, ORF15, or a combination thereof of the human RPGR gene having one or more RPGR gene mutations, wherein the RPGR gene mutation is an RPGR gene mutation that causes human RP, more preferably the RPGR gene mutation is in ORF15 of the RPGR gene, and even more preferably the RP is X-linked retinitis pigmentosa (xlRP).

2. The method according to claim 1, wherein the gene mutation is selected from point mutation, deletion mutation, insertion mutation, and inversion or duplication mutation, preferably point mutation, the point mutation is a missense mutation or a nonsense mutation, and more preferably the gene mutation can be repaired by gene editing technology.

3. The method according to claim 1 or 2, wherein the animal is a non-human mammal, preferably a ruminant, a canine, a lagomorph, a feline or a rodent, more preferably a mouse, a pig, a monkey, a bear, a sheep, a goat, a horse, a donkey, a rabbit, a cat, a cow, a fox or a dog, even more preferably a mouse or a rat, still more preferably a C57BL / 6 mouse or a BALB / c mouse, still more preferably a C57BL / 6J and a C57BL / 6N mouse, and most preferably a C57BL / 6J mouse.

4. The method according to any one of claims 1 to 3, wherein the exons include exons 1 to 19 of the RPGR gene, and the introns include introns 1 to 18 of the RPGR gene; preferably replacing the corresponding ORF15 in the genome of the animal with a human ORF15 having an RPGR gene mutation; more preferably replacing the corresponding intron 13-exon 14-ORF15 fragment in the genome of the animal with a human fragment including intron 13-exon 14-ORF15 having an RPGR gene mutation, wherein the RPGR gene mutation is in ORF15 of the RPGR gene; and / or preferably the RPGR gene mutation is a nonsense mutation, and more preferably the nonsense mutation is c.1905+76G>T.

5. The method according to any one of claims 1 to 4, wherein the animal is a mouse, preferably a C57BL / 6J mouse; and the method comprises replacing the corresponding intron 13-exon 14-ORF15 fragment in the genome of the mouse with a human fragment including intron 13-exon 14-ORF15 having a nonsense mutation in ORF15; more preferably the nonsense mutation is c.1905+76G>T; and / or most preferably the human fragment including intron 13-exon 14-ORF15 having a nonsense mutation is as shown in SEQ ID NO:

1.

6. The method according to any one of claims 1 to 5, wherein the replacement is achieved by the following gene editing techniques: CRISPR / Cas technology; zinc finger nuclease technology (ZFN); or transcription activator-like effector nuclease technology (TALEN); preferably CRISPR / Cas9.

7. The method according to any one of claims 1 to 6, wherein the method comprises: 1) By gene editing technology, introducing a fragment comprising one or more exons, one or more introns, ORF15 or a combination thereof of the human RPGR gene with one or more RPGR gene mutations into the fertilized egg of the animal, replacing one or more exons, one or more introns, ORF15 or a combination thereof corresponding to the RPGR gene in the genome of the animal, and identifying and obtaining F0 generation animals with the fragment of the human RPGR gene correctly inserted into the genome; and 2) Crossing the F0 generation animals with wild-type animals for germline transmission to obtain F1 generation animals, and identifying animals with the fragment of the human RPGR gene correctly inserted into the genome, preferably the animals are hemizygotes or homozygotes, male or female, more preferably male homozygotes.

8. The method according to claim 7, wherein the animal is a mouse, and / or the identification is by PCR identification or by Southern blot identification.

9. The method according to claim 8, the method further comprises one or more of the following steps: 1) Detecting fundus changes in the model mouse by fundus photography abnormality (FP) and optical coherence tomography (OCT); and 2) Measuring visual function changes in the model mouse by electroretinogram (ERG).

10. The method according to any one of claims 1 to 9, wherein the method further comprises: Selecting an animal consistent with the disease phenotype of human RP patients as an RP animal model.

11. An RP animal model prepared by the method according to any one of claims 1 to 10, preferably a mouse model.

12. A method for identifying and / or testing a gene editing drug for treating RP, comprising: 1) Administering the gene editing drug to an RP animal model prepared by the method according to any one of claims 1 to 10; 2) Determining whether the RPGR gene mutation is repaired or reversed by the gene editing drug, that is, whether correct RPGR mRNA can be expressed; and 3) Optionally, detecting whether the disease phenotype of RP in the animal model is improved; If the RPGR gene mutation is repaired or reversed by the gene editing drug, and / or the disease phenotype of RP in the animal model is improved, it indicates that the gene editing drug can be effectively used for treating RP.

13. The method according to claim 12, wherein: the animal in step 1) is a mouse; the administration in step 1) is subretinal injection; the repair in step 2) is identified by PCR identification, by Southern blot identification or by Sanger sequencing; and / or detecting the disease phenotype of RP in the animal model in step 3) comprises one or more of the following steps: a) Detect fundus changes in model animals by fundus photography abnormality (FP) and optical coherence tomography (OCT); and b) Determine changes in visual function of model animals by electroretinogram (ERG).

14. The method according to claim 12 or 13, wherein the gene editing drug comprises a CRISPR / Cas9 gene editing drug, preferably in the form of a recombinant adeno-associated virus (rAAV) vector.

15. Use of the RP animal model according to claim 11 for in vivo evaluation of the efficacy and / or safety of a gene editing drug for treating RP, preferably the RP is X-linked retinitis pigmentosa (xlRP).

Images