SNP molecular marker for identifying coilia ectenes and coilia brachygnathus and application thereof

Abstract

The invention discloses an SNP molecular marker for identifying coilia ectenes and coilia brachygnathus and application of the SNP molecular marker, and belongs to the technical field of DNA molecular identification. The marker is selected from any one or more of SNP1-SNP5, and the SNP1-SNP5 is located on an amplification product with a nucleotide sequence as shown in SEQ ID NO: 1, and is located at the 185th site, the 231st site, the 259th site, the 322nd site and the 412th site respectively; the positions, at the SNP1-SNP5 sites, of the coilia ectenes correspond to T, A, T, A and A respectively, and the positions, at the SNP1-SNP5 sites, of the coilia brachygnathus correspond to C, G, C, T and C respectively. According to the SNP molecular marker developed by adopting a high-coverage genome, efficient and accurate species identification can be realized only by one pair of primers, and powerful technical support is provided for subsequent coilia ectenes population genetics research, germplasm resource evaluation, key habitat protection and other related management measure formulation.

Description

Technical Field

[0001] The present invention belongs to the technical field of DNA molecular identification, and particularly relates to an SNP molecular marker for differentiating Coilia nasus and Coilia brachygnathus and its application. Background Art

[0002] As a typical fish species that migrates between the sea and rivers, Coilia nasus enters the river from the sea for reproductive migration in spring and spawns and reproduces in the main stream of the middle and lower reaches of the Yangtze River and its connected lakes. There is also another freshwater sedentary fish species similar in morphology to Coilia nasus distributed in the main stream of the middle and lower reaches of the Yangtze River and its connected lakes - Coilia brachygnathus. The typical adult individuals of the two species can be distinguished by the length of the maxilla: the maxilla of Coilia brachygnathus is shorter and does not extend backward beyond the posterior edge of the operculum (the ratio of maxilla length to head length is significantly less than 1), while the maxilla of Coilia nasus extends backward to reach the base of the pectoral fin (the ratio of maxilla length to head length is significantly greater than 1). However, in the early life history stages of Coilia nasus and Coilia brachygnathus (including fish eggs, larvae, and juveniles), due to the incomplete differentiation of the jaws, the morphological characteristics of the two are highly similar, resulting in great difficulties in species identification and severely restricting the accurate identification and effective protection of key habitats such as the spawning grounds and nursery grounds of Coilia nasus. In addition, some atypical adult individuals of Coilia nasus or Coilia brachygnathus have been found in waters such as Taihu Lake and Hongze Lake, and their maxilla development shows an intermediate form of incomplete differentiation (the ratio of maxilla length to head length approaches 1), and these atypical individuals also cannot be reliably identified by traditional morphological characteristics.

[0003] Although traditional morphological methods have advantages such as simple operation and strong intuitiveness, in practical applications, due to the highly similar morphological characteristics and overlapping traits of Coilia nasus and Coilia brachygnathus, misjudgment is likely to occur, and there are obvious limitations. Subsequently, some molecular biology studies analyzed the genetic relationships between the two species based on molecular markers such as mitochondrial genes (Cytb, D-loop, COI) and nuclear genes (AFLP, SSR). However, due to the limitations of these markers to specific genes or regions, the analysis strength and resolution are relatively low, and it is difficult to effectively distinguish Coilia nasus and Coilia brachygnathus. Previous studies developed SNP molecular markers for differentiating the two species using the cross-species target gene enrichment method, but due to the low genome coverage, the developed molecular markers lack representativeness. There are also studies that published SNP loci and their primers for differentiating the two species based on the genomic differences between Coilia nasus and Coilia brachygnathus, but this method requires amplifying multiple pairs of primers.

[0004] Therefore, in view of the technical problems existing in the prior art, such as the easy misjudgment of traditional morphological methods, the relatively low analysis strength of single molecular markers, and the lack of representativeness of SNP molecular markers, a genetic molecular marker and method for accurately and efficiently differentiating Coilia nasus and Coilia brachygnathus are needed. Summary of the Invention

[0005] Technical problems to be solved: In view of the above technical problems, the present invention provides SNP molecular markers for differentiating Coilia nasus and Coilia brachygnathus and their applications, provides 5 SNP molecular markers and their primer pairs, and provides effective genetic molecular markers for accurately and efficiently differentiating Coilia nasus and Coilia brachygnathus.

[0006] Technical solution: The SNP molecular markers for differentiating Coilia nasus and Coilia brachygnathus are selected from any one or more of SNP1 to SNP5. The SNP1 to SNP5 are located on the amplification product with the nucleotide sequence shown in SEQ ID NO:1, and are located at the 185th, 231st, 259th, 322nd, and 412th positions respectively; Coilia nasus corresponds to T, A, T, A, A at the SNP1 to SNP5 loci respectively, and Coilia brachygnathus corresponds to C, G, C, T, C at the SNP1 to SNP5 loci respectively.

[0007] Preferably, the nucleotide sequences of the primer pairs used for amplification are shown in SEQ ID NO:2 and SEQ ID NO:3.

[0008] The application of the above SNP molecular markers in differentiating Coilia nasus and Coilia brachygnathus.

[0009] A method for differentiating Coilia nasus and Coilia brachygnathus, which differentiates Coilia nasus and Coilia brachygnathus by detecting the base types of any one or more of the above SNP1 to SNP5.

[0010] Preferably, the method comprises the following steps:

[0011] Step 1: Extract the sample DNA, and amplify the sample DNA with the primer pairs with the nucleotide sequences shown in SEQ ID NO:2 and SEQ ID NO:3;

[0012] Step 2: Determine whether the sample is Coilia nasus or Coilia brachygnathus according to the base types of any one or more of SNP1 to 5 in the nucleotide sequence of the amplification product.

[0013] Preferably, the nucleotide sequences of the primer pairs used for amplification are shown in SEQ ID NO:2 and SEQ ID NO:3.

[0014] Preferably, the sample is an adult or juvenile fish of Coilia nasus or Coilia brachygnathus.

[0015] Preferably, the judgment basis is: Coilia nasus corresponds to T, A, T, A, A at the SNP1 to SNP5 loci respectively, and Coilia brachygnathus corresponds to C, G, C, T, C at the SNP1 to SNP5 loci respectively.

[0016] A kit for differentiating Coilia nasus and Coilia brachygnathus, which kit comprises the primer pairs with the nucleotide sequences shown in SEQ ID NO:2 and SEQ ID NO:3.

[0017] Application of the above kit in differentiating Coilia nasus and Coilia brachygnathus

[0018] Beneficial effects: Based on the high-quality chromosome-level genomes of Coilia nasus and Coilia brachygnathus assembled by the research group, combined with the resequencing data of 11 populations of Coilia nasus and Coilia brachygnathus, 5 representative SNP molecular markers and a pair of corresponding primers were screened out. The SNP molecular markers developed by the present invention with high coverage genome only require a pair of primers to achieve efficient and accurate species identification, providing strong technical support for the formulation of relevant management measures such as subsequent population genetics research, germplasm resource evaluation and key habitat protection of Coilia nasus. Description of the drawings

[0019] Figure 1 : Results of sequence alignment and specific SNP locus identification between Coilia nasus and Coilia brachygnathus

[0020] Figure 2 : Sequencing peak maps of Coilia nasus and Coilia brachygnathus samples

[0021] Figure 3 : Agarose gel electrophoresis detection map of PCR products of 60 adult fish and 30 juvenile fish

[0022] Figure 4 : Results of sequence alignment and specific SNP locus identification of juvenile Coilia Specific implementation manners

[0023] The present invention will be further described below in conjunction with the drawings and specific embodiments. The reagents and experimental materials described in the embodiments can be obtained through commercial channels without special instructions.

[0024] The SNP molecular markers of the present invention for differentiating Coilia nasus and Coilia brachygnathus are selected from any one or more of SNP1 to SNP5. The SNP1 to SNP5 are located on the amplification product with the nucleotide sequence shown in SEQ ID NO: 1, and are located at the 185th, 231st, 259th, 322nd, and 412th positions respectively; Coilia nasus corresponds to T, A, T, A, A at the SNP1 to SNP5 loci respectively, and Coilia brachygnathus corresponds to C, G, C, T, C at the SNP1 to SNP5 loci respectively.

[0025] SNP1 to SNP5 and their sequences are as follows:

[0026] AGATAGCTGTTTAAGGTGATGATAGATAAGGAGGCTTAAGAATAGTAGGTGCATTATGGACTTGTATGTTTGAATGCTCCGGTAGGCACTCTGGCTCAACACTGAAATGCTCCACTGGGAAGTTCTCACTTCTTGTACGTCACACACCAAGTTTCCATGAGGGCTTTTCCCTTCTTCTCCTTTT[T / C]CCCCCCAGACTGGACTGAGGTAAAACCTAAATTCATTTGGAGGGA[A / G]GCTGAAGTGGCCGCTAGCCCAGTGCTC[T / C]AGAGGGTTTGCTGAATCACAGGGTTCTG ACTACAAAGTGAACTCTGCATCAAGGAATGAGTT[A / T]CCACAGAGGCAGAAGGAAAA GACTGCAACTATAAAGGTGTTCTATGGAACTGATGACAGAAACAGTTGATGACAGTGCC CACAATAGAT[A / C]ACTTTTTAGTAAAAGAAAGGTTTTCTGCTTTAAAACATACTTTCAGT GTATGTTTGTTATAATCACTGCACCATTACATTTCCATGTAGACAAATGTATTTAAAGGAAGCAGGAGTTACCCTCAAAGACCCCATCAGGCAAACATACATGCACGCATATACGTTTATATGCCTGTTGGCATTATTAAATTCCATTTTATAATATCAATCAGCCTGAGTGGCTGTAATGATAATGAGTGGAGACCACCCACCTCACAGTGCTCTGGAGCGACATATTTGGAGTAATGCAATACTGAGTTTTCTGTGCACTATTCAGAGCCAATCAAAATTGCGTAGACTGGAACGGGGAACTGAGTGGTGGGGTCTGAGGGGGATATTATTTTGGTTTGTACACTATCTGTGGCATGAATCAT(SEQ ID NO:1)

[0027] The SNP1 locus is labeled as T / C and is located at the 2,133,317th position of the genomic sequence of chromosome 24 of Coilia nasus;

[0028] The SNP2 locus is labeled as A / G and is located at the 2,133,363rd position of the genomic sequence of chromosome 24 of Coilia nasus;

[0029] The SNP3 locus is labeled as T / C and is located at the 2,133,391st position of the genomic sequence of chromosome 24 of Coilia nasus;

[0030] The SNP4 locus is labeled as A / T and is located at the 2,133,454th position of the genomic sequence of chromosome 24 of Coilia nasus;

[0031] The SNP5 locus is labeled as A / C and is located at the 2,133,544th position of the genomic sequence of chromosome 24 of Coilia nasus.

[0032] Example 1

[0033] A method for developing SNP molecular markers for differentiating Coilia nasus and Coilia brachygnathus, comprising the following steps:

[0034] 1. Obtaining species-diagnostic SNP molecular markers

[0035] Based on the high-quality chromosome-level genome of Coilia nasus, this invention conducts whole-genome resequencing analysis on 128 samples from 11 geographical populations of Coilia nasus and Coilia brachygnathus, with an average sequencing depth of 26.18× for each sample. Align the clean reads obtained from resequencing with the genomic data, and use the HaplotypeCalle module in GATK v4.1 software to detect SNPs for each sample; subsequently, use the CombineGVCFs tool to merge the generated gvcf files, and perform joint genotyping through the GenotypeGVCFs tool to finally generate a vcf file. Screen the obtained SNP dataset based on the following strict filtering conditions: a. QD < 2: the ratio of variant confidence to depth < 2; b. FS > 60: fisher's possible false positive test > 60; c. MappingQualityRankSum < -12.5: the alignment quality assessment of REF and ALT reads < -12.5; d. ReadPosRankSum < -8.0: the position assessment of the variant on the read < -8.0; e. StrandOddsRatio (SOR) < 3.0: comprehensively evaluate that the possible SOR of strand bias < 3.0; a total of 434,160 high-quality SNP loci are obtained through the above screening conditions. Use Simon Martin software to calculate the Fst value within the whole genome with a 20kb sliding window, and screen out 41 highly differentiated windows with Fst > 0.98, among which there are 16 windows with Fst = 1.

[0036] Based on the above-screened 41 highly differentiated windows, specific SNP sites that stably exist in *Coilia nasus* and *Coilia brachygnathus* were determined. These sites need to meet the following conditions: the SNP detection rate in the two species is 100%; the base mutation frequency is 100% and the upstream and downstream sequences of the mutation sites are highly conserved. Finally, 5 SNP molecular markers that meet the set conditions were screened out and named SNP1-SNP5. The bases of these sites are T, A, T, A, A in *Coilia nasus* and C, G, C, T, C in *Coilia brachygnathus* (Table 1).

[0037] Table 1 SNP site sequence information

[0038]

[0039] Any one or more of the above-mentioned 5 SNP molecular markers can be used to identify *Coilia nasus* and *Coilia brachygnathus*.

[0040] 2. Primer design

[0041] The screened SNP sites were mapped to the *Coilia nasus* genome, and the SNP sites and their upstream and downstream highly conserved sequences with a length of about 800 bp were extracted. Then, a pair of primers for identifying *Coilia nasus* and *Coilia brachygnathus* were designed and named 1F / 1R. The primer pair sequences are shown in Table 2.

[0042] Table 2 Primer pairs of the sequences where 5 SNPs are located

[0043]

[0044]

[0045] The designed primer pair consists of upstream and downstream primer sequences, which were sent to Sangon Biotech Co., Ltd. for synthesis. Each primer was independently packaged and stored, and all were added to the PCR primer reaction system in the form of primer solutions.

[0046] 3. Verification of the reliability of SNP molecular markers

[0047] (1) Collection of adult samples of *Coilia nasus* and *Coilia brachygnathus*

[0048] Thirty adult *Coilia nasus* and 30 adult *Coilia brachygnathus* were randomly selected from the above 128 re-sequenced samples. All samples were identified by morphological characteristics and otolith microchemistry techniques. All *Coilia nasus* samples (maxilla / length of head > 1) were migratory individuals (Sr / Ca × 1000 > 3), and all *Coilia brachygnathus* samples (maxilla / length of head < 1) were freshwater resident individuals (Sr / Ca × 1000 < 3) (Table 3).

[0049] Table 3 Collection information of 60 re-sequenced samples

[0050]

[0051] (2) Genomic DNA extraction

[0052] The genomic DNA of all samples was extracted using an Ezup column animal tissue DNA kit. The integrity of the DNA was detected by 1% agarose gel electrophoresis (voltage 120 - 180 V, 1×TAE buffer), and the DNA concentration and purity were detected using a spectrophotometer. When the OD 260 / 280 ratio was between 1.7 and 2.0, it was determined that the quality of the DNA sample solution was good, and it was stored at -20°C.

[0053] (3) PCR amplification and sequencing

[0054] Using the genomic DNA of Coilia nasus and Coilia brachygnathus as templates for PCR amplification, the primer pair 1F / 1R was used to amplify the target sequence containing SNP1 - SNP5 sites. The PCR amplification system was 25 μL, including 1 μL of R primer, 1 μL of F primer, 1 μL of DNA sample solution, 1 μL of PCR Mix solution, and finally supplemented to 25 μL with ddH2O. The PCR amplification conditions were: pre-denaturation at 95°C for 5 min; 10 cycles (94°C for 30 s, starting annealing at 63°C for 30 s / cycle with a decrease of 0.5°C per cycle, extension at 72°C for 30 s); 30 cycles (95°C for 30 s, 58°C for 30 s, 72°C for 30 s); extension at 72°C for 10 min, and stored at 4°C. After the reaction, 5 μL of the PCR product of each sample was taken, loaded on a 1% agarose gel, electrophoresed for 20 min under a voltage of 120 V, observed and recorded the results in a gel imaging system, and the amplified PCR products were sent to Sangon Biotech Co., Ltd. for bidirectional sequencing using a 3730XL sequencer.

[0055] (4) Multiple sequence alignment

[0056] The sequences obtained by sequencing the PCR products were spliced using CodonCode Aligner software, and the sequencing results were subjected to multiple sequence alignment using BioEdit software. The adult fish of Coilia nasus and Coilia brachygnathus were identified according to the base types of the 5 SNP sites in the PCR amplification product sequences.

[0057] As shown in the appendix Figure 1 All samples were subjected to PCR amplification using the primer pair 1F / 1R. The sequencing of the amplification products showed that the bases at the SNP1 - SNP5 sites of all Coilia nasus samples were T, A, T, A, A, respectively, and the bases at the SNP1 - SNP5 sites of all Coilia brachygnathus samples were C, G, C, T, C, respectively. The MEGA7 software was used to analyze the SNP site peak maps of the samples, and Coilia nasus and Coilia brachygnathus were identified through the peak maps. As shown in the appendix Figure 2As shown, for the verification of each SNP locus, one sample from any two species was randomly selected from 30 samples for display.

[0058] Example 2

[0059] The application of the above SNP molecular markers and primer pairs in the identification of adult and juvenile Coilia nasus and Coilia brachygnathus includes the following steps:

[0060] 1. Collection of adult and juvenile samples

[0061] In June - July 2023, 30 adult Coilia nasus samples (numbered CN01 - 30) and 30 adult Coilia brachygnathus samples (numbered CB01 - 30) were randomly collected from the spawning ground waters of Coilia nasus in Poyang Lake. Species identification was carried out based on morphological characteristics. All Coilia nasus samples (the ratio of maxilla length to head length was significantly greater than 1) were typical long - jawed individuals, with body lengths and weights ranging from 25.6 - 33.9 cm and 47.8 - 155.1 g respectively. All Coilia brachygnathus samples (the ratio of maxilla length to head length was significantly less than 1) were typical short - jawed individuals, with body lengths and weights ranging from 15.9 - 28.3 cm and 20.3 - 95.0 g respectively. In addition, in September - November 2024, a survey of juvenile Coilia was carried out at the estuary of Poyang Lake. 30 samples (numbered Y01 - 30) were randomly selected from 100 juvenile Coilia samples obtained for species identification. The body lengths of the selected samples ranged from 7.1 - 12.5 cm, and the weights ranged from 0.7 - 14.7 g. According to morphological characteristics, they were visually identified as Coilia fish (the jaws of individuals with body lengths < 13 cm had not been fully differentiated). Muscle tissues of the above individuals were collected respectively, immediately placed in liquid nitrogen, and stored in a - 80°C ultra - low temperature freezer in the laboratory.

[0062] 2. Genomic DNA extraction, PCR amplification and sequencing

[0063] The experimental processes such as genomic DNA extraction, PCR amplification and sequencing were kept consistent with those in Example 1.

[0064] 3. PCR amplification results

[0065] As attached Figure 3 As shown, by observing the gel imaging results, after amplification with primer pair 1F / 1R, a single band appeared at around 800 bp of the DNA molecular weight standard, which was consistent with the sequence length that should be amplified during primer design.

[0066] 4. Multiple sequence alignment and species identification

[0067] The sequences obtained by sequencing the PCR products were spliced using CodonCode Aligner software, and the sequencing results were subjected to multiple sequence alignment using BioEdit software. As attached Figure 1As shown in the figure, all adult fish samples were subjected to PCR amplification using primer pair 1F / 1R. Sequence alignment of the amplification products showed that the bases at SNP1-SNP5 sites in all Coilia nasus samples were T, A, T, A, A respectively, and the bases at SNP1-SNP5 sites in all Coilia brachygnathus samples were C, G, C, T, C respectively.

[0068] The sequences of 30 juvenile fish samples of Coilia were analyzed using BioEdit software, and the results are as follows Figure 4 As shown in the figure, the bases at SNP1-SNP5 sites in 13 samples were T, A, T, A, A respectively, and based on this, the species to be tested was determined to be Coilia nasus; the bases at SNP1-SNP5 sites in 17 samples were C, G, C, T, C respectively, and based on this, the species to be tested was determined to be Coilia brachygnathus.

[0069] The above results indicate that the 5 specific SNP molecular markers of the present invention can efficiently and accurately identify Coilia nasus and Coilia brachygnathus, and the identification accuracy rate reaches 100%.

Claims

1. SNP molecular markers for identifying Coilia nasus and Coilia brachygnathus, characterized in that Any one or more selected from SNP1 to SNP5, where SNP1 to SNP5 are located on the amplification product with the nucleotide sequence shown in SEQ ID NO:1, and are located at the 185th, 231st, 259th, 322nd, and 412th positions respectively; Coilia nasus corresponds to T, A, T, A, A at the SNP1 to SNP5 loci respectively, and Coilia brachygnathus corresponds to C, G, C, T, C at the SNP1 to SNP5 loci respectively.

2. The SNP molecular marker for differentiating Coilia nasus and Coilia brachygnathus according to claim 1, characterized in that, The nucleotide sequences of the primer pairs used for amplification are shown in SEQ ID NO:2 and SEQ ID NO:

3.

3. Use of the SNP molecular marker according to claim 1 in differentiating Coilia nasus and Coilia brachygnathus.

4. A method for identifying Coilia nasus and Coilia brachygnathus, characterized in that, Differentiate Coilia nasus and Coilia brachygnathus by detecting the base types of any one or more of SNP1 to SNP5 according to claim 1.

5. The method for identifying Coilia nasus and Coilia brachygnathus according to claim 4, characterized in that, The method includes the following steps: Step 1, extract the sample DNA, and amplify the sample DNA with the primer pairs with the nucleotide sequences shown in SEQ ID NO:2 and SEQ ID NO:3; Step 2, judge whether the sample is Coilia nasus or Coilia brachygnathus according to the base types of any one or more of SNP1 to 5 in the nucleotide sequence of the amplification product.

6. The method for differentiating Coilia nasus and Coilia brachygnathus according to claim 5, wherein The nucleotide sequences of the primer pairs used for amplification are shown in SEQ ID NO:2 and SEQ ID NO:

3.

7. The method for identifying Coilia nasus and Coilia brachygnathus according to claim 5, characterized in that The sample is an adult or juvenile fish of Coilia nasus or Coilia brachygnathus.

8. The method for identifying Coilia nasus and Coilia brachygnathus according to claim 5, wherein The judgment basis is: Coilia nasus corresponds to T, A, T, A, A at the SNP1 to SNP5 loci respectively, and Coilia brachygnathus corresponds to C, G, C, T, C at the SNP1 to SNP5 loci respectively.

9. A kit for identifying Coilia nasus and Coilia brachygnathus, characterized in that, The kit includes the primer pairs with the nucleotide sequences shown in SEQ ID NO:2 and SEQ ID NO:

3.

10. Use of the kit according to claim 9 in differentiating Coilia nasus and Coilia brachygnathus.

Images