Miniature barcode primer for identifying environmental DNA species of black neck crane and associated birds thereof as well as design method and identification method of miniature barcode primer

Abstract

The invention relates to the technical field of molecular biology, and particularly discloses a minisize bar code primer for identifying environmental DNA species of black neck and associated birds thereof and a design method and an identification method thereof, the primer comprises an upstream primer SEQ ID NO.1 and a downstream primer SEQ ID NO.2, the upstream primer SEQ ID NO.1 is 12S-3UF1: ACCGCGGTCATACAAGAGAC, the downstream primer SEQ ID NO.2 is 12S-3UF1: ACCGCGGTCATACAAGAGAC, and the downstream primer SEQ ID NO.2 is 12S-3UF1: ACCGCGGTCATACAAGAGAC; 1, and the SEQ ID NO. 2 is as follows: 12S-3UR1: GCGTTTGTGCTCGTAGTTCTC, and the SEQ ID NO. The miniature barcode primer pair for species identification of the environmental DNA of the black neck crane and the associated birds of the black neck crane can be used for respectively detecting a single species or a combination of various species in the black neck crane and the associated birds of the black neck crane, and the primer pair provided by the invention is accurate and effective in laboratory detection and has a good reference value for identification of environmental DNA samples of the black neck crane and the associated birds of the black neck crane.

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular biology, and specifically relates to a mini-barcode primer for identifying environmental DNA species of black-necked cranes and their associated birds, and a design method and an identification method thereof. Background Art

[0002] The black-necked crane and its associated birds (bar-headed goose, ruddy shelduck) refer to the black-necked crane distributed in the Qinghai-Tibet Plateau and its surrounding high-altitude areas, as well as the birds that often appear with it, mainly including the bar-headed goose and the ruddy shelduck. The black-necked crane is the only crane species that grows and breeds on the plateau in the world, is a first-class protected animal in China, and is listed in the Red List of Endangered Species of the International Union for Conservation of Nature.

[0003] In the National Nature Reserve for Black-necked Cranes in the middle reaches of the Yarlung Zangbo River Valley, bar-headed geese and ruddy shelducks often forage and roost with black-necked cranes, becoming relatively stable associated birds of the latter.

[0004] For the field investigation and research of black-necked cranes and their associated birds, traditional methods are based on passive on-site observation and recording, which require tracking the activity trajectories of black-necked cranes and consume a large amount of time and energy; at the same time, due to the limitations of bird habits, observation equipment and other conditions, it is often very difficult to obtain information such as species distribution and habitats through direct field observation. The development and cross-integration of environmental DNA technology and molecular biology have made the active ecological investigation method more convenient and efficient. At present, there is no specific method for identifying the environmental DNA of black-necked cranes and their associated birds (bar-headed geese, ruddy shelducks). Therefore, a more efficient and convenient molecular biology identification technology is of great significance for the protection and research of black-necked cranes and their associated birds (bar-headed geese, ruddy shelducks).

[0005] In view of this, the inventor proposes a mini-barcode primer for identifying environmental DNA species of black-necked cranes and their associated birds, and a design method and an identification method thereof to solve the above problems. Summary of the Invention

[0006] The purpose of the present invention is to provide a mini-barcode primer for identifying environmental DNA species of black-necked cranes and their associated birds, and a design method and an identification method thereof to solve the problems raised in the above background art.

[0007] To achieve the above purpose, the present invention provides the following technical solutions:

[0008] The mini-barcode primer for identifying environmental DNA species of black-necked cranes and their associated birds includes:

[0009] The upstream primer SEQ ID NO.1 is used to specifically bind to the target sequence in the environmental DNA of black-necked cranes and their associated birds;

[0010] The downstream primer SEQ ID NO.2 is used in combination with the upstream primer to amplify a DNA fragment containing the target sequence;

[0011] wherein the target sequence is located within the conserved region of the 12S rRNA gene of black-necked cranes and their associated bird species;

[0012] SEQ ID NO.1 is: 12S-3U_F1: ACCGCGGTCATACAAGAGAC

[0013] SEQ ID NO.2 is: 12S-3U_R1: GCGTTTGTGCTCGTAGTTCTC.

[0014] Preferably, the method for obtaining the target sequence in the environmental DNA of black-necked cranes and their associated bird species includes:

[0015] Obtaining the mitochondrial genome data NC_025654, NC_020579, NC_024640 of black-necked cranes and their associated bird species from the NCBI database, extracting the gene sequence of 12S rRNA, and determining the conserved region therein using the gene sequence of 12S rRNA;

[0016] Designing a species identification micro-barcode primer pair for the environmental DNA of black-necked cranes and their associated bird species using the conserved region.

[0017] Preferably, determining the conserved region according to the gene sequence of 12S rRNA includes:

[0018] Performing multiple alignment on the 12S rRNA sequences of black-necked cranes and their associated bird species using the Geneious software to determine the conserved region therein.

[0019] Preferably, in the species identification micro-barcode primer pair for the environmental DNA of black-necked cranes and their associated bird species designed using the conserved region, it is designed using the Primer3 software.

[0020] The method for identifying the species of environmental DNA of black-necked cranes and their associated bird species includes:

[0021] Taking environmental samples of the species of environmental DNA of black-necked cranes and their associated bird species to be tested, including water samples, feces, etc., and separating and extracting the DNA to be tested therefrom;

[0022] Using the DNA to be tested as a template, performing PCR amplification using the species identification micro-barcode primer pair for the environmental DNA of black-necked cranes and their associated bird species, and obtaining a sequencing result through Illumina sequencing;

[0023] Analyzing and comparing the sequencing result to determine the species information corresponding to the environmental DNA of black-necked cranes and their associated bird species to be tested.

[0024] Preferably, the environmental sample DNA of the species of the black-necked crane and its companion bird environmental DNA is amplified by PCR, and the sequencing results are obtained by Illumina sequencing, including:

[0025] The 12S rRNA gene fragments of the black-necked crane and its companion bird species were amplified by polymerase chain reaction using the species identification micro-barcode primer pairs of the environmental DNA of the black-necked crane and its companion bird species to obtain the amplified products;

[0026] The amplified products were detected by agarose gel electrophoresis. After the PCR products were purified, the library was constructed and sequenced to obtain the sequencing results.

[0027] Preferably, the amplified fragment length of the amplified product is 280 bp.

[0028] Preferably, the sequencing results are analyzed and compared to determine the species information corresponding to the environmental DNA of the black-necked crane and its companion birds to be tested, including:

[0029] Based on Illumina sequencing technology, the sequencing results were clustered and annotated using Trimmomatic, FLASH, Usearch, and qiime software. The sequences to be analyzed were compared by BLAST on the NCBI website, and the species information corresponding to the samples of the environmental DNA of the black-necked crane and its companion birds was determined based on the similarity, coverage, and comprehensive score.

[0030] As mentioned above, Illumina sequencing technology is a high-throughput sequencing technology that uses synthetic DNA chains and fluorescently labeled nucleotides to sequence by adding nucleotides one by one and recording fluorescent signals. Its efficient parallel processing allows tens of thousands of DNA fragments to be sequenced simultaneously, increasing sequencing speed and data output, and is widely used in genomic research, variation analysis, epigenomics and other fields.

[0031] As mentioned above, Trimmomatic: removes adapter sequences and low-quality bases in high-throughput sequencing data to improve sequence quality; FLASH: splices double-end sequences in sequencing data into complete sequences for PE data processing of high-throughput sequencing; Usearch: used for sequence clustering, quality control and bioinformatics analysis, supporting a variety of sequence analysis tasks; QIIME: a software suite for microbial community analysis and metagenomics research, including sequence processing, analysis and visualization functions.

[0032] As mentioned above, OTU clustering is to group sequences according to similarity, and each group is called an operational unit (OTU). It is usually used to analyze the composition of microbial communities in environmental samples to understand their diversity and structure;

[0033] As mentioned above, NCBI (National Center for Biotechnology Information) is the National Center for Biotechnology Information in the United States. The NCBI database is a comprehensive bioinformatics database that contains various biological data, such as gene sequences, protein sequences, literature, biological sample information, etc.

[0034] As mentioned above, BLAST (Basic Local Alignment Search Tool) is a commonly used bioinformatics tool for searching for sequences similar to a given sequence in a database. It can quickly align DNA, RNA, or protein sequences and generate the most similar matching results to the target sequence, which helps to determine the homology and function of the sequences.

[0035] Compared with the prior art, the beneficial effects of the present invention are:

[0036] The mini-barcode primer pair for species identification of the environmental DNA of black-necked cranes and their associated birds provided by the present invention can respectively detect single species or combinations of various species in black-necked cranes and their associated birds, and can reflect the coexistence status of these three bird species. Based on this, the primer pair provided in the present invention is accurate and effective in laboratory detection and has good reference value for the identification of environmental DNA samples of black-necked cranes and their associated birds. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] Figure 1 It is the electrophoresis band diagram in the second embodiment of the present invention;

[0038] Figure 2 It is the block diagram of the mini-barcode primers for species identification of the environmental DNA of black-necked cranes and their associated birds of the present invention;

[0039] Figure 3 It is the flowchart of the design method of the mini-barcode primers for species identification of the environmental DNA of black-necked cranes and their associated birds of the present invention;

[0040] Figure 4 It is the flowchart of the method for identifying the species of the environmental DNA of black-necked cranes and their associated birds of the present invention. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0041] Next, the technical solutions in the embodiments of the present invention will be clearly and completely described in conjunction with the accompanying drawings in the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all of the embodiments. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts shall fall within the protection scope of the present invention.

[0042] Embodiment 1:

[0043] Primer Design

[0044] In this example, a mini-barcode primer pair for species identification of environmental DNA of black-necked cranes and their associated birds, such as bar-headed geese and ruddy shelducks, was designed.

[0045] 1. Experimental data:

[0046] Mitochondrial genome data (NC_025654, NC_020579, NC_024640) of black-necked cranes and their associated birds, including bar-headed geese and ruddy shelducks, were obtained from the NCBI database.

[0047] 2. Experimental method:

[0048] (1) Use Geneious software to extract the gene sequences of 12S rRNA in the mitochondrial genomes of black-necked cranes and their associated birds (bar-headed geese and ruddy shelducks);

[0049] (2) Use Geneious software to perform multiple sequence alignments on the sequences to find conserved regions;

[0050] (3) According to the conserved regions, use primmer3 software to design DNA micro-barcode primers.

[0051] The mini-barcode primer pairs for species identification of black-necked cranes and their associated birds (bar-headed geese and ruddy shelducks) are as follows:

[0052] SEQ ID NO.1: 12S-3U_F1: ACCGCGGTCATACAAGAGAC;

[0053] SEQ ID NO.2: 12S-3U_R1: GCGTTTGTGCTCGTAGTTCTC.

[0054] Example 2:

[0055] Identification Test

[0056] In this example, an identification experiment of the mini-barcode primer pair for species identification based on environmental DNA of black-necked cranes and their associated birds (bar-headed geese and ruddy shelducks) was carried out.

[0057] Experimental method:

[0058] (1) Extract the DNA to be tested from the environmental DNA samples of black-necked cranes and their associated birds (bar-headed geese and ruddy shelducks) to be tested;

[0059] (2) Use the DNA to be tested as a template, and perform PCR amplification with the mini-barcode primer pair for species identification of environmental DNA of black-necked cranes and their associated birds (bar-headed geese and ruddy shelducks) to obtain sequencing results;

[0060] The species identification micro-barcode primer pairs of the environmental DNA of the black-necked crane and its companion birds (bar-headed goose and ruddy shelduck) were used to perform polymerase chain reaction to amplify the 12SrRNA fragments of the environmental DNA species of the black-necked crane and its companion birds (bar-headed goose and ruddy shelduck) to obtain the amplified products.

[0061] The amplified product was detected by agarose gel electrophoresis, and after the PCR product was purified, it was sequenced to obtain the sequencing result.

[0062] The PCR reaction system is as follows:

[0063] PCR using TransStart Fastpfu DNA Polymerase, 20μl reaction system:

[0064] 5×FastPfu Buffer............4μl

[0065] 2.5mM dNTPs........................2μl

[0066] Forward Primer(5μM)............0.8μl

[0067] Reverse Primer(5μM).........0.8μl

[0068] FastPfu Polymerase............0.4μl

[0069] Template DNA........................10ng

[0070] Add ddH2O to 20μl

[0071] The PCR amplification conditions were as follows: pre-denaturation at 95°C for 3 minutes; denaturation at 95°C for 20 seconds, annealing at 59°C for 20 seconds, and extension at 72°C for 20 seconds, for a total of 38 cycles, and a final extension at 72°C for 3 minutes.

[0072] (3) Analyze and compare the sequencing results to determine the species information corresponding to the environmental DNA samples of the black-necked crane and its companion birds (bar-headed goose and ruddy shelduck).

[0073] Based on the Illumina sequencing technology, the obtained sequencing results are used with software such as Trimmomatic, FLASH, Usearch, and qiime for OTU clustering and species annotation;

[0074] The sequences to be analyzed are BLAST-aligned on the NCBI website, and the corresponding species information of the environmental DNA samples of the black-necked cranes and their associated birds (bar-headed geese and ruddy shelducks) to be tested is determined according to the similarity, coverage, and comprehensive score.

[0075] Experimental results:

[0076] Reference Figure 1 , based on the above method, for the 15 samples (including two sampling blank control samples, sample 10 and sample 11) and 1 PCR blank control (CK) in this experiment, using the species identification micro-barcode primer pair (example) of the environmental DNA of black-necked cranes and their associated birds (bar-headed geese and ruddy shelducks) provided in the present invention, the samples are amplified and sequenced.

[0077] Specifically as follows:

[0078] (1) Experimental samples: Sample numbers 10 - 24, CK;

[0079] (2) Example: Using the species identification micro-barcode primer pair (primer numbers 12S - 3U_F1 / R1) of the environmental DNA of black-necked cranes and their associated birds (bar-headed geese and ruddy shelducks) in the present invention.

[0080] Figure 1 Among them, from left to right, the experimental samples of sample numbers 10 - 24 and CK are shown in sequence.

[0081] Through Figure 1 It can be seen that for the species identification micro-barcode primer pair of the environmental DNA of black-necked cranes and their associated birds (bar-headed geese and ruddy shelducks) in the example, the positive amplification result is obvious, there is no amplification product in the sample sampling control and CK samples, and the electrophoresis band results of the PCR amplification products meet the expectations. Combining with the NCBI results analysis, it can be obtained that the species identification micro-barcode primer pair of the environmental DNA of black-necked cranes and their associated birds (bar-headed geese and ruddy shelducks) provided in the present invention can accurately amplify the 12S rRNA sequence of the environmental DNA of black-necked cranes and their associated birds (bar-headed geese and ruddy shelducks).

[0082] Table 1. Identification result table of the example for samples:

[0083]

[0084]

[0085] Table 1

[0086] For the specific identification results, refer to Table 1. For the 15 samples of the example and the CK sample, using the species identification micro-barcode primer pair (example, 12S-3U_F1 / R1) of the environmental DNA of black-necked cranes and their associated birds (bar-headed geese and ruddy shelducks) provided in the present invention, the single species or various species combinations in black-necked cranes and their associated birds (bar-headed geese and ruddy shelducks) can be detected respectively, and the coexistence status of these three bird species can be reflected. Based on this, the primer pair provided in the present invention is accurate and effective in laboratory detection and has good reference value for the identification of environmental DNA samples of black-necked cranes and their associated birds (bar-headed geese and ruddy shelducks).

[0087] As can be seen from the above, the species identification micro-barcode primer pair of the environmental DNA of black-necked cranes and their associated birds (bar-headed geese and ruddy shelducks) provided by the present invention, based on the molecular biology identification method of the species identification micro-barcode primer pair of the environmental DNA of black-necked cranes and their associated birds (bar-headed geese and ruddy shelducks), is easy to operate and has high accuracy, can identify environmental DNA samples, and provides technical support for the research and protection of black-necked cranes and their associated birds (bar-headed geese and ruddy shelducks).

[0088] In the description of this specification, the description with reference to terms such as "one embodiment", "some embodiments", "example", "specific example" or "some examples" means that the specific features, structures, materials or characteristics described in connection with the embodiment or example are included in at least one embodiment or example of the present invention. In this specification, the schematic representations of the above terms do not have to be directed to the same embodiment or example. Moreover, the specific features, structures, materials or characteristics described can be combined in a suitable manner in any one or more embodiments or examples. In addition, without conflict, those skilled in the art can combine and combine the different embodiments or examples described in this specification and the features of different embodiments or examples.

[0089] In the accompanying drawings of the disclosed embodiments of the present invention, only the structures related to the disclosed embodiments are involved, and other structures can refer to the general design. Without conflict, the same embodiment and different embodiments of the present invention can be combined with each other.

[0090] Although the embodiments of the present invention have been shown and described, those of ordinary skill in the art can understand that various changes, modifications, substitutions and variations can be made to these embodiments without departing from the principles and spirit of the present invention, and the scope of the present invention is defined by the appended claims and their equivalents.

Claims

1. Mini-barcode primers for environmental DNA species identification of black-necked cranes and their associated birds, characterized in that, Comprising: An upstream primer SEQ ID NO.1, which is used to specifically bind to a target sequence in the environmental DNA of black-necked cranes and their associated birds; A downstream primer SEQ ID NO.2, which is used to cooperate with the upstream primer to amplify a DNA fragment containing the target sequence; Wherein, the target sequence is located within a conserved region of the 12S rRNA gene of black-necked cranes and their associated birds; SEQ ID NO.1 is: 12S-3U_F1: ACCGCGGTCATACAAGAGAC SEQ ID NO.2 is: 12S-3U_R1: GCGTTTGTGCTCGTAGTTCTC.

2. A method for designing micro-barcode primers for environmental DNA species identification of black-necked cranes and their associated birds, characterized in that, The method for obtaining the target sequence in the environmental DNA of black-necked cranes and their associated birds includes: Obtaining the mitochondrial genome data NC_025654, NC_020579, NC_024640 of black-necked cranes and their associated birds from the NCBI database, extracting the gene sequence of 12S rRNA, and determining the conserved region therein using the gene sequence of 12S rRNA; Designing a species identification microbarcode primer pair for the environmental DNA of black-necked cranes and their associated birds using the conserved region.

3. The method for designing the mini-barcode primer for environmental DNA species identification of black-necked cranes and their associated birds according to claim 2, characterized in that, Determining the conserved region therein according to the gene sequence of 12S rRNA, including: Performing multiple alignments on the 12S rRNA sequences of black-necked cranes and their associated birds using the Geneious software to determine the conserved region therein.

4. The method for designing the mini-barcode primer for identifying the environmental DNA species of black-necked cranes and their associated birds according to claim 2, characterized in that, Among the species identification microbarcode primer pairs for the environmental DNA of black-necked cranes and their associated birds designed using the conserved region, they are designed using the Primer3 software.

5. Method for identifying environmental DNA species of black-necked cranes and their associated birds, characterized in that, Comprising: Taking an environmental sample of the species of the environmental DNA of black-necked cranes and their associated birds to be tested, and isolating and extracting the DNA to be tested therefrom; Using the DNA to be tested as a template, adopting the species identification microbarcode primer pair for the environmental DNA of black-necked cranes and their associated birds to perform PCR amplification, and obtaining a sequencing result through Illumina sequencing; Analyzing and comparing the sequencing result to determine the species information corresponding to the environmental DNA of black-necked cranes and their associated birds to be tested.

6. The method for identifying the environmental DNA species of black-necked cranes and their associated birds according to claim 5, wherein Performing PCR amplification on the environmental sample DNA of the species of the environmental DNA of black-necked cranes and their associated birds, and obtaining a sequencing result through Illumina sequencing, including: Using the species identification microbarcode primer pair for the environmental DNA of black-necked cranes and their associated birds to perform polymerase chain reaction to amplify the 12S rRNA gene fragment of the species of black-necked cranes and their associated birds to obtain an amplification product; Detecting the amplification product by agarose gel electrophoresis, and after purifying the PCR product, performing library construction and on-machine sequencing to obtain a sequencing result.

7. The method for identifying the environmental DNA species of black-necked cranes and their associated birds according to claim 5, characterized in that, The amplification fragment length of the amplification product is 280bp.

8. The method for identifying the environmental DNA species of black-necked cranes and their associated birds according to claim 5, characterized in that Analyzing and comparing the sequencing result to determine the species information corresponding to the environmental DNA of black-necked cranes and their associated birds to be tested, including: Based on the Illumina sequencing technology, using the obtained sequencing result and using the Trimmomatic, FLASH, Usearch, and qiime software to perform OTU clustering and species annotation.

Images