Method for rapidly detecting salmonella pullorum by using fluorescent quantitative PCR (Polymerase Chain Reaction) and primer used by method

Abstract

The invention discloses a method for rapidly detecting salmonella pullorum by fluorescent quantitative PCR (polymerase chain reaction) and used primers, and the method for rapidly detecting salmonella pullorum by fluorescent quantitative PCR specifically comprises the following steps: (1) collecting a sample; (2) nucleic acid extraction; (3) preparing a reaction system; (4) running a sample detection program; and (5) detecting a test result and judging. According to the rapid detection method disclosed by the invention, an ultra-short-range PCR program is designed as follows: pre-denaturation is performed at 95 DEG C for 2 minutes; according to the present invention, with the program setting, the salmonella pullorum detection time is shortened by about 60% compared with the salmonella pullorum detection time of the commercially available kit and the commercial standard program, and the detection efficiency is substantially improved; the cost of a single detection reagent is reduced by 40% compared with that of an imported kit, and the economic cost is reduced; compared with a traditional culture method, the method has the advantages that the time is 3-5 days earlier, the detection result is reliable, the repeatability is good, and the method can be used for clinical diagnosis and monitoring of SP.

Description

Technical Field

[0001] The present invention belongs to the technical field of Salmonella detection, and particularly relates to a rapid detection method for Salmonella pullorum by fluorescence quantitative PCR and primers used therefor. Background Art

[0002] Salmonella pullorum (SP) is a Gram-negative short bacillus belonging to the genus Salmonella. It has flagella and can move, has no spores, has pili all over the body, and the cell size is generally about (0.4 - 0.6) μm × (1 - 3) μm. This microorganism can multiply in large numbers in parts such as the intestines of chickens and cause many harms to chickens. After chicks are infected, they often show symptoms of acute septicemia, with a relatively high incidence and mortality rate, seriously affecting the survival rate of chicks and bringing greater losses to chicken farms; for growing chickens, after being infected with Salmonella pullorum, they will have poor growth and development, slow weight gain, weakened constitution, and increased risk of getting sick; and for laying hens, after being infected, there will be a decrease in egg production and a decline in egg quality, greatly affecting the economic benefits of chicken farms. Moreover, Salmonella pullorum is easily vertically transmitted through ways such as breeding eggs, making the germ passed down from generation to generation in the chicken flock, and it is very difficult to completely eliminate, posing a long-term threat to the health and breeding production of the chicken flock. Therefore, it is very necessary to regularly detect Salmonella pullorum in the breeding chicken flock.

[0003] The detection methods for Salmonella pullorum include bacteriological detection methods, serological detection methods, molecular biological detection methods, etc. The bacteriological detection method is a traditional detection method. Although it has a certain degree of accuracy and reliability, its detection cycle is long, sensitivity is limited, specificity is insufficient, it has high requirements for operators, and it is not suitable for large-scale detection; although the serological detection method is widely used in disease diagnosis and monitoring, it also has the following defects: there are cross-reactions, the duration of antibodies affects judgment, the detection results are easily interfered by various factors, it is difficult to distinguish vaccine immunity and natural infection, and some methods are complex in operation or high in cost; among the molecular biological detection methods, fluorescence quantitative PCR is one of the common detection methods for Salmonella pullorum, which has the advantages of strong specificity and high sensitivity. However, in the prior art, the fluorescence quantitative PCR amplification program takes a long time, resulting in reduced detection efficiency, increased human detection costs, higher requirements and costs for sample preservation, being unfavorable for real-time monitoring, the accuracy of the results being affected, and ultimately affecting the timeliness of the detection results and the prevention and control decisions in subsequent breeding production. Summary of the Invention

[0004] The present invention researches and designs a rapid detection method for Salmonella pullorum by fluorescence quantitative PCR and the primers used, aiming to solve the problems in the background technology, such as the long time of the fluorescence quantitative PCR amplification program in the prior art, which leads to the reduction of detection efficiency, increases the labor detection cost, improves the sample preservation requirements and costs, is not conducive to real-time monitoring, the result accuracy is affected, and ultimately affects the timeliness of the detection results and the prevention and control decisions in subsequent breeding production.

[0005] The technical solution of the present invention: Primers for the rapid detection of Salmonella pullorum by fluorescence quantitative PCR. The PCR primers include 1 μL of PCR forward primer and 1 μL of PCR reverse primer. The sequence of the PCR forward primer is CCCGGATTGGACCTCAAGTG, and the sequence of the PCR reverse primer is ATGTTACGGGACGAGTGGGT.

[0006] A rapid detection method for Salmonella pullorum by fluorescence quantitative PCR specifically includes the following steps: (I) Sample collection Collect tissue blocks of dead chickens with sterile instruments, store the samples in a sterile container, and temporarily store them at 4°C; (II) Nucleic acid extraction Take the tissue blocks in step (I), add PBS, homogenize with a tissue grinder, add lysis solution, incubate and then place them in a sterilized centrifuge tube, perform centrifugation on a microcentrifuge, discard the supernatant after centrifugation, and add DNA extraction reagent to the precipitate in the sterile centrifuge tube, elute the DNA in TE buffer, and temporarily store it for later use; (III) Reaction system preparation In an ice box, sequentially add the pre-cooled PCR premix, PCR primer with a concentration of 1 μmol / L, PCR probe with a concentration of 0.5 μmol / L, template DNA, and double-distilled water into a clean PCR tube with a pipette, mix well to obtain a reaction system, and temporarily store it in the ice box for later use; (IV) Run the sample detection program Centrifuge the PCR tube with the reaction system prepared in step (III) and then put it into a preheated fluorescence quantitative PCR instrument, and set the PCR reaction program: pre-denature at 95°C for 2 min; denature at 95°C for 3 s, anneal at 60°C for 10 s, for 35 cycles; (V) Detection of test results and determination The PCR instrument automatically collects the fluorescence signals of the cycles described in step (IV) to generate a real-time amplification curve, uses the built-in algorithm of the instrument to automatically calculate the threshold, and sets positive, negative, and blank controls for result determination and verification.

[0007] Preferably, in the step (i), the tissue blocks are the livers and spleens of dead chickens.

[0008] Preferably, in the step (ii), the tissue block is 50 mg, the PBS is 1 mL, the lysis buffer is 200 μL, the TE buffer is 100 μL, the incubation temperature is 70 °C, and the incubation time is 10 min.

[0009] Preferably, in the step (ii), the rotational speed of the microcentrifuge is 10,000 rpm, the centrifugation time is 1 min, and the temperature for temporarily storing the pure DNA is -20 °C.

[0010] Preferably, in the step (ii), the DNA extraction reagent is a commercially available centrifugal column-based DNA extraction kit.

[0011] Preferably, in the step (iii), the PCR premix is 10 μL, the PCR primer is 0.6 - 2 μL, the PCR probe is 0.2 - 1 μL, the template DNA is 1 - 5 μL, and the double-distilled water is 1 - 2 μL. More preferably, in the step (iii), the volume of the PCR premix is 10 μL, the volume of the PCR primer is 2 μL, the volume of the PCR probe is 1 μL, the volume of the template DNA is 5 μL, and the volume of the double-distilled water is 2 μL.

[0012] Preferably, in the step (iii), the PCR premix is a commercially available 2× Taq Man Fast qPCR premix compatible with rapid programs.

[0013] Preferably, in the step (iv), the centrifugation speed is 1,500 rpm and the centrifugation time is 1 min.

[0014] Advantages of the present invention: The fluorescence quantitative PCR rapid detection method for Salmonella pullorum of the present invention has an ultra-short PCR program design: pre-denaturation at 95 °C for 2 min; denaturation at 95 °C for 3 s, annealing at 60 °C for 10 s, 35 cycles. This program setting not only shortens the detection time of Salmonella pullorum by about 60% compared with commercially available kits and industry standard programs, greatly improving the detection efficiency; the cost of reagents for single detection is reduced by 40% compared with imported kits, reducing the economic cost; early diagnosis of infection is achieved, 3 - 5 days earlier than the traditional culture method, the detection results are reliable, with good repeatability, and can be used for the clinical diagnosis and monitoring of SP. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 It is the amplification curve graph in Example 1 of the present invention; Figure 2 It is the amplification curve graph of Example 2 (commercially available kit); Figure 3 It is the amplification curve graph of Example 3 (industry standard). Detailed implementation manners

[0016] The present invention will be further described below in conjunction with the accompanying drawings, specific embodiments and clinical sample detections.

[0017] Example 1 A rapid detection method for Salmonella pullorum by fluorescence quantitative PCR includes the following steps: (I) Sample collection Collect 50 mg of the liver of dead chickens with sterile instruments, store the sample in a sterile container, and temporarily store it at 4°C; (II) Nucleic acid extraction Take the liver in step (I), add 1 mL of PBS, homogenize it with a tissue grinder, add 200 μL of lysis solution, incubate it and place it in a sterilized centrifuge tube, perform centrifugation on a microcentrifuge, the rotation speed of the microcentrifuge is 10,000 rpm, the centrifugation time is 1 min, discard the supernatant after centrifugation, and add a commercially available centrifugal column method DNA extraction reagent to the precipitate in the sterile centrifuge tube, elute the DNA into TE buffer, extract pure template DNA, and temporarily store it at -20°C for standby; (III) Reaction system preparation In an ice box, sequentially add 10 μL of a pre-cooled commercially available 2 × Taq Man FastqPCR premix compatible with a rapid program, 2 μL of a PCR primer with a concentration of 1 μmol / L, 1 μL of a PCR probe with a concentration of 0.5 μmol / L, 5 μL of template DNA, and 2 μL of double-distilled water into a clean PCR tube with a pipette, mix while adding to prepare a reaction system, and temporarily store it in the ice box for standby. The PCR primer includes 1 μL of a PCR forward primer and 1 μL of a PCR reverse primer. The sequence of the PCR forward primer is CCCGGATTGGACCTCAAGTG, the sequence of the PCR reverse primer is ATGTTACGGGACGAGTGGGT, and the sequence of the PC probe is 5’-FAM- ACGCACAATCACTGTGCGACCATCCGG-BHQ1-3’; (IV) Run the sample detection program Centrifuge the PCR tube with the reaction system prepared in step (III) and then put it into a PCR instrument, set the PCR reaction program: pre-denature at 95°C for 2 min; denature at 95°C for 3 s, anneal at 60°C for 10 s, for 35 cycles, where the centrifugation speed is 1,500 rpm and the centrifugation time is 1 min; (V) Detection of test results and determination The PCR instrument automatically collects the fluorescence signals of the cycles described in step (IV) to generate a real-time amplification curve, uses the built-in algorithm of the instrument to automatically calculate the threshold, and sets positive, negative and blank controls for result determination and verification.

[0018] Example 2 The difference from Example 1 lies in that only the reaction procedure of the commercially available kit in step (iv) is as follows: maintain at 50 °C for 2 min; maintain at 95 °C for 10 min; denature at 95 °C for 15 s, anneal at 60 °C for 60 s, 40 cycles, and other steps are the same as those in Example 1.

[0019] Example 3 The difference from Example 1 lies in that only the reaction procedure of the industry standard in step (iv) is as follows: pre-denaturation: 95 °C, 30 s; denaturation: 95 °C, 5 s, annealing and extension: 60 °C, 30 s, 40 cycles, and other steps are the same as those in Example 1.

[0020] Example 4 (Repeatability Test) Three sets of intra-group and inter-group controls were respectively set up, and directly using the SP bacterial titer / (cfu / mL), after DNA extraction, serial dilution was carried out and the optimal reaction procedure of the present invention (in Example 1) was adopted. The specific test results are shown in Table 1 below.

[0021] Example 5 (Comparison of Concordance Rates for Clinical Sample Detection) The detection method of the present invention, commercially available kits, and industry standard PCR methods were used to detect clinical samples (both using the same sample source and number of samples), and the positive rate of Salmonella pullorum was detected, so as to compare the concordance rate of the detection method of the present invention. The detection results are shown in Table 2.

[0022] Table 1 Repeatability Test Results in Example 4 Table 2 Concordance Rate Comparison Results in Example 5 It can be seen from Figures 1 to 3 that compared with commercially available kits and industry standard PCR methods, the detection method of the present invention has high sensitivity.

[0023] It can be seen from Table 1 that the detection method of the present invention has good repeatability, because when the test was carried out according to the optimal reaction procedure of the present invention (pre-denaturation at 95 °C for 2 min; denaturation at 95 °C for 3 s, annealing at 60 °C for 10 s, 35 cycles), the CV value of the inter-group repeated test was less than 2.43%, and the CV value of the intra-group repeated test was less than 1.97%.

[0024] It can be seen from Table 2 that the detection results of the present invention are highly reliable, because when detecting the positive rate of Salmonella pullorum for the same sample source and number of samples, the detection results of the detection method of the present invention are close to those of commercially available kits and industry standard detection methods, and the concordance rate exceeds 83.3%.

[0025] In summary, the rapid detection method of Salmonella pullorum by fluorescence quantitative PCR of the present invention features an ultra-short PCR program design: pre-denaturation at 95°C for 2 min; denaturation at 95°C for 3 s, annealing at 60°C for 10 s, for 35 cycles. This program setting not only shortens the detection time of Salmonella pullorum by about 60% compared with commercially available kits and industry standard procedures, greatly improving the detection efficiency; the reagent cost per single detection is reduced by 40% compared with imported kits, reducing the economic cost; it enables early diagnosis of infection, 3 - 5 days earlier than the traditional culture method, with reliable detection results and good repeatability, and can be used for the clinical diagnosis and monitoring of SP.

Claims

1. Primers for rapid detection of Salmonella pullorum by fluorescence quantitative PCR, characterized in that: The PCR primers include 1 μL of the forward PCR primer and 1 μL of the reverse PCR primer. The sequence of the forward PCR primer is CCCGGATTGGACCTCAAGTG, and the sequence of the reverse PCR primer is ATGTTACGGGACGAGTGGGT.

2. A rapid detection method for Salmonella pullorum by fluorescence quantitative PCR, characterized in that: Specifically, it includes the following steps: (I) Sample collection Collect tissue blocks of dead chickens with sterile instruments, store the samples in a sterile container, and temporarily store them at 4°C; (II) Nucleic acid extraction Take the tissue blocks in step (I), add PBS, homogenize them with a tissue homogenizer, add lysis buffer, incubate, place them in a sterilized centrifuge tube, perform centrifugation on a microcentrifuge, discard the supernatant after centrifugation, add DNA extraction reagent to the precipitate in the sterile centrifuge tube, elute the DNA into TE buffer, and temporarily store it for later use; (III) Reaction system preparation In an ice box, sequentially add the pre-cooled PCR premix, PCR primers at a concentration of 1 μmol / L, PCR probes at a concentration of 0.5 μmol / L, template DNA, and double-distilled water into a clean PCR tube with a pipette, mix well to prepare the reaction system, and temporarily store it in the ice box for later use; (IV) Run the sample detection program Centrifuge the PCR tube containing the prepared reaction system in step (III) and then place it in a pre-heated fluorescence quantitative PCR instrument. Set the PCR reaction program: pre-denaturation at 95°C for 2 min; denaturation at 95°C for 3 s, annealing at 60°C for 10 s, for 35 cycles; (V) Detection of test results and determination The PCR instrument automatically collects the fluorescence signals of the cycles described in step (IV), generates a real-time amplification curve, automatically calculates the threshold using the built-in algorithm of the instrument, and sets positive, negative, and blank controls for result determination verification.

3. The rapid detection method of Salmonella pullorum by fluorescence quantitative PCR according to claim 2, wherein: The tissue blocks in step (I) are the liver and spleen of dead chickens.

4. The rapid detection method for Salmonella pullorum by fluorescence quantitative PCR according to claim 2, wherein: In step (II), the tissue block is 50 mg, the PBS is 1 mL, the lysis buffer is 200 μL, the TE buffer is 100 μL, the incubation temperature is 70°C, and the incubation time is 10 min.

5. The rapid detection method for Salmonella pullorum by fluorescence quantitative PCR according to claim 2, characterized in that: In step (II), the rotation speed of the microcentrifuge is 10,000 rpm, the centrifugation time is 1 min, and the temporary storage temperature of the pure DNA is -20°C.

6. The rapid detection method for Salmonella pullorum by fluorescence quantitative PCR according to claim 2, characterized in that: In step (II), the DNA extraction reagent is a commercially available centrifugal column-based DNA extraction kit.

7. The rapid detection method for Salmonella pullorum by fluorescence quantitative PCR according to claim 2, wherein: In step (III), the PCR premix is 10 μL, the PCR primers are 0.6 - 2 μL, the PCR probes are 0.2 - 1 μL, the template DNA is 1 - 5 μL, and the double-distilled water is 1 - 2 μL.

8. The rapid detection method for Salmonella pullorum by fluorescence quantitative PCR according to claim 7, characterized in that: In step (III), the volume of the PCR premix is 10 μL, the volume of the PCR primers is 2 μL, the volume of the PCR probes is 1 μL, the volume of the template DNA is 5 μL, and the volume of the double-distilled water is 2 μL.

9. The rapid detection method for Salmonella pullorum by fluorescence quantitative PCR according to claim 2, characterized in that: In step (III), the PCR premix is a commercially available 2× Taq Man Fast qPCR premix compatible with the rapid program.

10. The rapid detection method for Salmonella pullorum by fluorescence quantitative PCR according to claim 2, characterized in that: In (IV), the centrifugation speed is 1500 rpm, and the centrifugation time is 1 min.

Images