Rapid molecular identification method of in-plant symbiotic growth-promoting bacillus and application

Abstract

The invention provides a rapid molecular identification method of in-plant symbiotic growth-promoting bacillus, which comprises the following steps: infiltrating plant seeds with a to-be-detected symbiotic strain, promoting seed germination, disinfecting the surface of a symbiotic plant, respectively taking roots and leaves, grinding, and carrying out enlarged culture in a culture medium to respectively obtain bacterial suspensions of the to-be-detected endosymbiotic strain; and after PCR (Polymerase Chain Reaction) amplification, agarose electrophoresis detection is carried out, and when a specific amplification band of 191bp appears, the bacillus mojavensis AER314-4 is symbiotic in a plant body. The AIR314-4 strain is used for germination of alfalfa and wheat seeds under the drought stress condition, and the effect of promoting drought-resistant growth of plants is obvious. The identification method disclosed by the invention is high in sensitivity, capable of detecting low-abundance bacillus, relatively high in specificity, capable of avoiding cross reaction with other microorganisms and capable of shortening the detection time. The bacillus can be used for promoting germination of medicago sativa and wheat seeds under the drought stress condition, and the endosymbiotic colonization effect of strains can be specifically identified through combined application of the bacillus.

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular biology, and particularly relates to a rapid molecular identification method and application of endophytic symbiotic growth-promoting Bacillus in plants. Background Art

[0002] Plant endophytic bacteria are an important component of the microecosystem in plants. They are microorganisms that grow in plants without causing any obvious symptoms or harm to the host plants. Some endophytic bacteria can effectively promote the growth and development of plants and improve the stress resistance of plants. Among them, Bacillus has been widely used in agricultural and academic related fields due to its fast growth rate, simple culture conditions, good environmental tolerance, and low nutritional requirements. However, the detection technology for the symbiotic colonization of Bacillus in plants lags behind, which is a bottleneck problem in the in-depth study of the interaction mechanism between microorganisms and plants and the development of agricultural microorganism detection technology, and urgently needs to be solved. Summary of the Invention

[0003] The technical problem to be solved by the present invention is to provide a rapid molecular identification method and application of endophytic symbiotic growth-promoting Bacillus in plants in view of the above-mentioned deficiencies of the prior art. The identification method has high sensitivity, can detect low-abundance Bacillus, has strong specificity, avoids cross-reaction with other microorganisms, and shortens the detection time. The Bacillus mojavensis AER314-4 can be used to promote the germination of alfalfa seeds and / or wheat seeds under drought stress conditions.

[0004] To solve the above technical problems, the technical solution adopted by the present invention is: a rapid molecular identification method of endophytic symbiotic growth-promoting Bacillus in plants, and the method is as follows:

[0005] S1. Infiltrate the plant seeds with the symbiotic strain to be tested. After the seeds germinate, obtain a symbiotic plant of microorganisms and plants. After surface sterilization of the symbiotic plant of microorganisms and plants, take roots and leaves respectively, grind them, and then perform enlarged culture in a culture medium respectively to obtain bacterial suspensions of the symbiotic strains to be tested, that is, obtain a bacterial suspension of roots and a bacterial suspension of leaves respectively;

[0006] S2. Use the bacterial suspensions of roots and leaves obtained in S1 as templates respectively, and perform PCR amplification respectively to obtain PCR products;

[0007] The system for PCR amplification is as follows: 10 μL of 2×Easy Taq PCR Supermix, 1 μL of the bacterial suspension of the endosymbiotic strain to be tested obtained in S1, 0.5 μL of 10 μM upstream primer, 0.5 μL of 10 μM downstream primer, and supplemented with ddH2O to 20 μL; the program for PCR amplification is: 95°C for 5 min; 95°C for 30 s, 56°C for 30 s, 72°C for 30 s, for 28 cycles; 72°C for 10 min;

[0008] The nucleotide sequence of the upstream primer is as shown in SEQ ID NO:1;

[0009] The nucleotide sequence of the downstream primer is as shown in SEQ ID NO:2;

[0010] S3. Perform agarose gel electrophoresis detection on the PCR products obtained in S2. If amplification bands of 191 bp appear in the lanes of the bacterial suspensions of the roots and leaves, it indicates that Bacillus mojavensis AER314-4 symbiosis in the plant.

[0011] Preferably, the plant seeds in S1 are seeds of alfalfa, Amorpha argentea or wheat.

[0012] Preferably, the time for seed germination in S1 is 14 days.

[0013] Preferably, the method for surface disinfection of the microorganism-plant symbiotic plants in S1 is: soak in 75% alcohol solution for 5 min, then rinse with sterile water 5 to 6 times, then soak in 5% hypochlorous acid solution for 5 to 10 min, and finally rinse with sterile water 4 to 5 times.

[0014] Preferably, the medium in S1 is liquid beef extract peptone medium, and the conditions for enlarged culture are: culture for 8 - 10 h under dark culture conditions at a temperature of 37°C and a shaking speed of 220 rpm.

[0015] Preferably, the liquid beef extract peptone medium is made up of the following raw materials with the final concentrations and made up to 1000 mL with water: 3 g / L of beef extract, 10 g / L of peptone, 5 g / L of sodium chloride, 15 g / L of agar.

[0016] The present invention also provides the application of the plant endosymbiotic growth-promoting bacillus identified by the above rapid molecular identification method of plant endosymbiotic growth-promoting bacillus. The plant endosymbiotic growth-promoting bacillus is used to promote the germination of alfalfa seeds and / or wheat seeds under drought stress conditions.

[0017] The present invention has the following advantages compared with the prior art:

[0018] 1. The identification method of the present invention has high sensitivity, can detect low-abundance Bacillus, and also has strong specificity, avoiding cross-reaction with other microorganisms. The PCR amplification technology is simple and easy to operate. Combined with the method for separating and propagating endophytes, it can accurately and quickly obtain the detection results, saving time.

[0019] 2. The plant endosymbiotic growth-promoting Bacillus mojavensis AER314-4 of the present invention can be used to promote the germination of alfalfa seeds and / or wheat seeds under drought stress conditions.

[0020] The present invention will be further described in detail below with reference to the accompanying drawings and embodiments. Description of the Drawings

[0021] Figure 1 It is the primer specificity of Bacillus mojavensis AER314-4 in Example 1 of the present invention. In the figure: M: DL2000 Marker; 1: negative control; 2: strain AER314-4; 3: Bacillus subtilis (unrelated strain control 1); 4: Escherichia coli. (unrelated strain control 2); 5: Agrobacterium tumefaciens (unrelated strain control 3).

[0022] Figure 2 It is the amplification diagram of the AER314-4 gene in the cDNA of Amorpha argentea in Example 1 of the present invention. In the figure: M, DL2000 Marker; 1, negative control; 2, strain AER314-4; 3, 4, water treatment group; 5, 6, drought group; 7, 8, bacteria-added group.

[0023] Figure 3 It is the amplification diagram of the AER314-4 gene in alfalfa plants in Example 1 of the present invention. In the figure: M: DL2000 Marker; 1, negative control; 2, alfalfa roots treated with bacteria addition; 3, alfalfa leaves treated with bacteria addition.

[0024] Figure 4 It is the germination rate of Amorpha argentea seeds in Example 2 of the present invention. In the figure: CK, water treatment; D, drought treatment; DE314-4, strain AER314-4 plus drought treatment.

[0025] Figure 5 It is the germination rate of alfalfa seeds in Example 2 of the present invention. In the figure: CK, water treatment; D, drought treatment; DE314-4, strain AER314-4 plus drought treatment.

[0026] Figure 6It is the germination rate of wheat seeds in Example 2 of the present invention. In the figure: CK, water treatment; D, drought treatment; DE314-4, strain AER314-4 plus drought treatment. DETAILED DESCRIPTION

[0027] Example 1

[0028] The design scheme of the rapid molecular identification method of plant endosymbiotic growth-promoting Bacillus in this embodiment is:

[0029] 1 Experimental Materials

[0030] The alfalfa variety is the domestically cultivated variety "Zhongmu No. 3"; the silver locust seed variety is silver locust (Ammodendron bifolium); the endophytic bacterium Bacillus mojavensis (Bacillus mojavensis) AER314-4 is a strain with Chinese patent application number CN201811146953.3.

[0031] 2 Experimental methods

[0032] 2.1 Plant inoculation

[0033] Bacillus mojavensis AER314-4 strain was taken out from -80℃ and activated and expanded to OD 600 The strains with a value between 0.8 and 1 were co-cultured with plant seeds. The filter paper plate germination method was used to set up four treatment groups, each of which included water treatment (CK), 20% PEG6000 drought treatment group (D) and AER314-4 strain and 20% PEG6000 drought co-treatment group (DE314-4). Each treatment was set up with at least 5 replicates and treated for 4-15 days.

[0034] 2.2 Surface disinfection methods for plants

[0035] Take alfalfa plants that have been co-cultured for 14 days, soak them in 75% alcohol for 5 minutes, rinse them with sterile water 5-6 times, soak them in 5% hypochlorous acid for 5-10 minutes, rinse them with sterile water 4-5 times, and apply the last rinse liquid on beef extract solid culture medium for culture. No colonies grow, indicating that the surface is thoroughly disinfected.

[0036] 2.3 Grind the roots and leaves of the disinfected plants separately, add liquid beef extract peptone medium and culture at 37°C, 220rpm, and obtain the bacterial suspension of the endosymbiotic strain to be tested, i.e., the bacterial suspension of the roots and the bacterial suspension of the leaves, respectively, after 8-10 hours;

[0037] Liquid beef extract peptone medium is prepared by adding water to 1000 mL of the following raw materials with final concentrations: beef extract 3 g / L, peptone 10 g / L, sodium chloride 5 g / L, and agar 15 g / L.

[0038] 2.4 Use the bacterial suspensions of the roots and leaves obtained in 2.3 as templates respectively for PCR amplification to obtain PCR products;

[0039] The system for PCR amplification is as follows: 10 μL of 2×Easy Taq PCR Supermix, 1 μL of the bacterial suspension of the endosymbiotic strain to be tested obtained in 2.3, 0.5 μL of 10 μM upstream primer, 0.5 μL of 10 μM downstream primer, and make up to 20 μL with ddH2O;

[0040] The procedure for PCR amplification is as follows:

[0041]

[0042] The nucleotide sequence of the upstream primer is: GCAAACACTCCGCCAGTTAC, as shown in SEQ ID NO:1;

[0043] The nucleotide sequence of the downstream primer is: CACGGTTGATACGAAGACCAGA, as shown in SEQ ID NO:2;

[0044] Perform agarose gel electrophoresis on the obtained PCR products. If amplification bands of 191 bp appear in the lanes of the bacterial suspensions of the roots and leaves, then Bacillus mojavensis AER314-4 is endosymbiotic in the plant.

[0045] 3 Results and Analysis

[0046] 3.1 Primer Sequence Specificity

[0047] To verify the specificity of the designed primers for Bacillus mojavensis AER314-4 (CN201811146953.3), PCR amplification experiments were carried out using the bacterial suspensions of Bacillus mojavensis AER314-4, Escherichia coli, Agrobacterium tumefaciens, and Bacillus subtilis as templates respectively.

[0048] After detecting the amplification products by agarose gel electrophoresis, the results showed that only when using the bacterial suspension of Bacillus mojavensis AER314-4 as the template, a clear and bright band appeared at the expected fragment size position ( Figure 1), indicating that the primers (SEQ ID NO: 1-2) successfully amplified the target band. When the bacterial suspensions of Escherichia coli, Agrobacterium, and other Bacillus strains were used as templates, no corresponding bands appeared in the electrophoresis patterns, indicating that the primers failed to achieve effective amplification in these strains.

[0049] 3.2 Detection results of Bacillus mojavensis AER314-4 co-cultured in Sophora alopecuroides

[0050] PCR amplification was performed on the cDNA of Sophora alopecuroides seeds co-cultured with the strain using the primer pair, and the results showed ( Figure 2 ), the expected target fragment was successfully amplified from the cDNA in the co-cultured Sophora alopecuroides samples, with a size of 191 bp (lanes 7 and 8), indicating that the genomic DNA fragment of Bacillus AER314-4 was present in the Sophora alopecuroides plants. Through electrophoresis image analysis, the PCR product clearly showed 191 bp, which was consistent with the known standard band of Bacillus AER314-4 (lane 2), further confirming the presence of Bacillus AER314-4, while no bands appeared in the water treatment without bacteria and the drought treatment (lanes 3-6).

[0051] PCR amplification was performed on the cDNA of Sophora alopecuroides seeds co-cultured with the strain using the primers (SEQ ID NO: 1-2), and the results showed ( Figure 2 ), the expected target fragment was successfully amplified from the cDNA in the Sophora alopecuroides samples, with a size of 191 bp, indicating that the genomic DNA fragment of Bacillus AER314-4 was present in the Sophora alopecuroides plants. Through electrophoresis image analysis, the PCR product clearly showed 191 bp, which was consistent with the known standard band of Bacillus AER314-4, further confirming the presence of Bacillus mojavensis AER314-4.

[0052] 3.3 Detection results of Bacillus mojavensis AER314-4 co-cultured in alfalfa plants

[0053] PCR amplification was performed on the bacterial suspensions of the endosymbiotic strains in the roots and leaves of the co-cultured alfalfa plants using the primers (SEQ ID NO: 1-2), and the results showed ( Figure 3)In the bacterial suspension sample of the endophytic strain expanded and cultured in alfalfa plants (Zhongmu No. 3), the detection of Bacillus mojavensis AER314-4 was carried out by PCR method. The PCR amplification results also showed that the alfalfa plant samples contained Bacillus mojavensis AER314-4. The amplification products were the same as those in the alfalfa samples, with a size of 191 bp. The bands shown in the electrophoresis diagram were consistent with the bands of the standard Bacillus AER314-4, indicating the presence of Bacillus mojavensis AER314-4 in the roots and leaves of alfalfa.

[0054] In summary, the rapid molecular identification method of the plant endophytic growth-promoting Bacillus Bacillus mojavensis AER314-4 in this example is as follows:

[0055] S1. Soak the plant seeds to be tested with the symbiotic strain. After 14 days of seed germination, obtain the symbiotic plant of microorganisms and plants. Surface-sterilize the symbiotic plant of microorganisms and plants. Soak it in 75% alcohol solution for 5 min, then rinse it with sterile water 5 to 6 times, then soak it in 5% hypochlorous acid solution for 5 to 10 min, and finally rinse it with sterile water 4 to 5 times. Take the roots and leaves respectively, grind them, and then carry out expanded culture in liquid beef extract peptone medium respectively. The conditions for expanded culture are: culture for 8 to 10 h under dark culture conditions at a temperature of 37°C and a shaking speed of 220 rpm to obtain the bacterial suspension of the endophytic strain to be tested in the roots respectively, that is, obtain the bacterial suspension of the roots and the bacterial suspension of the leaves respectively; the plant seeds are the seeds of alfalfa, Amorpha argentea or wheat; the liquid beef extract peptone medium is made up of the following raw materials with the following final concentrations and made up to 1000 mL with water: 3 g / L of beef extract, 10 g / L of peptone, 5 g / L of sodium chloride, and 15 g / L of agar; S2. Use the bacterial suspension of the roots and the bacterial suspension of the leaves obtained in S1 as templates respectively, and carry out PCR amplification respectively to obtain PCR products.

[0056] The system for the PCR amplification is: 10 μL of 2×Easy Taq PCR Supermix, 1 μL of the bacterial suspension of the endophytic strain to be tested obtained in S1, 0.5 μL of 10 μM upstream primer, 0.5 μL of 10 μM downstream primer, and make up to 20 μL with ddH2O; the program for the PCR amplification is:

[0057]

[0058] The nucleotide sequence of the upstream primer is as shown in SEQ ID NO:1;

[0059] The nucleotide sequence of the downstream primer is shown in SEQ ID NO: 2;

[0060] S3. Perform agarose gel electrophoresis detection on the PCR products obtained in S2. If amplification bands of 191 bp appear in the lanes of the bacterial suspensions of the roots and leaves, it indicates that Bacillus mojavensis AER314-4 symbiosis occurs in the plant.

[0061] The primer sequences of the present invention can efficiently and specifically amplify specific gene regions of Bacillus AER314-4, thereby realizing the rapid detection of Bacillus mojavensis AER314-4.

[0062] Compared with traditional cultivation methods and other molecular biology methods, the identification method of the present invention has significant advantages: not only is it highly sensitive and can detect low-abundance Bacillus, but it also has strong specificity, avoiding cross-reactions with other microorganisms. The PCR amplification technology is simple and easy to operate. Combined with the technology of isolating and propagating endophytes, it can quickly obtain detection results and greatly save time. This method has a wide range of application prospects in the fields of microbial detection, endophyte identification, etc., and is particularly suitable for the detection requirements of Bacillus in multiple industries such as food safety, environmental monitoring, and agriculture, and has important economic and social values.

[0063] In the present invention, the surface of the symbiotic plant is thoroughly disinfected and then ground, and then beef extract liquid medium is added to propagate the endosymbiotic strains in the plant to obtain a bacterial suspension, and then PCR amplification is performed using the specific primers with the bacterial suspension as the template. The present invention ingeniously combines the traditional propagation and cultivation of plant endophytes with PCR molecular identification means, thereby specifically identifying the low-abundance AER314-4 strains symbiotic in plants. This invention patent can be used for the research on the endosymbiotic colonization mechanism of AER314-4.

[0064] Example 2

[0065] This example is the application of Bacillus mojavensis AER314-4 in Example 1. Bacillus AER314-4 is used to promote the germination of alfalfa seeds and / or wheat seeds under drought stress conditions. Bacillus mojavensis AER314-4 has a drought-resistant and growth-promoting effect on plants.

[0066] Take out Bacillus mojavensis AER314-4 from -80 °C and reactivate and expand the culture to OD 600The strains with values between 0.8 and 1 were co-cultured with plant seeds. Using the filter paper plate germination method, four treatment groups were set up, and each treatment group included: water treatment (CK), 20% PEG6000 drought treatment group (D), and AER314-4 strain and 20% PEG6000 drought co-treatment group (DE314-4). At least 5 replicates were set for each treatment.

[0067] Bacillus mojavensis AER314-4 can colonize Sophora alopecuroides under drought conditions and promote seed water absorption and germination ( Figure 4 ), and has a similar growth-promoting effect on crops such as alfalfa ( Figure 5 ) and wheat ( Figure 6 ). The average germination rate of seeds in the drought treatment group was 22.5%, and the average germination rate in the drought plus bacteria treatment group was 53.3%, which was about twice that of the drought group (as Figure 5 ). The endophyte AER314-4 has a promoting effect on wheat seed germination, and the seed germination rates of the water treatment group and the bacteria-added treatment group were both significantly higher than those of the drought treatment group. Among them, the drought plus bacteria group showed better stress resistance, and the seed germination rate increased by 15%, which was significantly better than the drought stress treatment group. There was a significant statistical difference between the drought and drought plus bacteria groups (p < 0.05). This result indicates that the Bacillus AER314-4 strain can promote wheat to maintain a good growth state under drought stress conditions ( Figure 6 ).

[0068] The above are only the preferred embodiments of the present invention and do not impose any limitations on the present invention. Any simple modifications, changes, and equivalent changes made to the above embodiments according to the technical essence of the invention still fall within the protection scope of the technical solution of the present invention.

Claims

1. A rapid molecular identification method for endophytic plant growth-promoting Bacillus, characterized in that, The method is as follows: S1. Infiltrate the plant seeds with the symbiotic strains to be tested. After the seeds germinate, obtain the microbial and plant symbiotic plants. After surface sterilization of the microbial and plant symbiotic plants, take roots and leaves respectively, grind them, and then perform enrichment culture in a medium respectively to obtain the bacterial suspensions of the endosymbiotic strains to be tested, that is, obtain the bacterial suspension of roots and the bacterial suspension of leaves respectively; S2. Use the bacterial suspensions of roots and leaves obtained in S1 as templates respectively, and perform PCR amplification respectively to obtain PCR products; The system of the PCR amplification is: 10 μL of 2×Easy Taq PCR Supermix, 1 μL of the bacterial suspension of the endosymbiotic strains to be tested obtained in S1, 0.5 μL of 10 μM upstream primer, 0.5 μL of 10 μM downstream primer, and make up to 20 μL with ddH2O; The procedure of the PCR amplification is: 95°C for 5 min; 95°C for 30 s, 56°C for 30 s, 72°C for 30 s, for 28 cycles; 72°C for 10 min; The nucleotide sequence of the upstream primer is as shown in SEQ ID NO:1; The nucleotide sequence of the downstream primer is as shown in SEQ ID NO:2; S3. Perform agarose gel electrophoresis detection on the PCR products obtained in S2. If amplification bands with a size of 191 bp appear in the lanes of the bacterial suspensions of roots and leaves, it indicates that Bacillus mojavensis AER314-4 symbiosis in the plant body.

2. The rapid molecular identification method of an endophytic growth-promoting Bacillus in plants according to claim 1, characterized in that, The plant seeds in S1 are seeds of Medicago sativa, Sophora alopecuroides or Triticum aestivum.

3. The rapid molecular identification method of an endophytic growth-promoting Bacillus in plants according to claim 1, characterized in that, The germination time of the seeds in S1 is 14 days.

4. The rapid molecular identification method of an endophytic growth-promoting Bacillus in plants according to claim 1, characterized in that, The method for surface sterilization of the microbial and plant symbiotic plants in S1 is: soak with 75% alcohol solution for 5 min, then rinse with sterile water for 5 to 6 times, then soak with 5% hypochlorous acid solution for 5 to 10 min, and finally rinse with sterile water for 4 to 5 times.

5. The rapid molecular identification method of an endophytic growth-promoting Bacillus in plants according to claim 1, characterized in that, The medium in S1 is a liquid beef extract peptone medium, and the conditions for enrichment culture are: culture for 8 to 10 h under the dark culture conditions at a temperature of 37°C and a shaking speed of 220 rpm.

6. The rapid molecular identification method of an endophytic growth-promoting Bacillus in plants according to claim 5, characterized in that, The liquid beef extract peptone medium is made up of the following raw materials with the final concentrations and made up to 1000 mL with water: 3 g / L of beef extract, 10 g / L of peptone, 5 g / L of sodium chloride, 15 g / L of agar.

7. Use of a plant endophytic growth-promoting Bacillus sp. identified by the rapid molecular identification method of a plant endophytic growth-promoting Bacillus sp. according to any one of claims 1-6, characterized in that, The plant endosymbiotic growth-promoting bacillus is used to promote the germination of Medicago sativa seeds and / or Triticum aestivum seeds under drought stress conditions.

Images