Composition and kit for detecting intestinal pathogens and application of composition and kit

By designing amplification primer compositions for different enteric pathogens, rapid and accurate multi-target detection is achieved, solving the problem of time-consuming and inability to determine serotyping in the prior art, and improving detection efficiency and specificity.

CN120350148APending Publication Date: 2025-07-22SANSURE BIOTECH INC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510568445.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-30
Publication Date
2025-07-22

AI Technical Summary

Technical Problem

In the prior art, the detection of intestinal pathogens takes a long time and is complicated to operate, and the bacterial culture method cannot quickly and accurately determine the types and serotypes of pathogens, which affects the determination of treatment plans for acute patients.

Method used

A composition is provided, which contains amplification primers for different enteric pathogens, which can simultaneously detect a variety of pathogens, including different serotypes of Salmonella typhimurium, Shigella and Campylobacter, and achieve rapid and accurate detection through PCR technology.

Benefits of technology

It simplifies the detection process, improves detection efficiency, reduces costs, and has high sensitivity and specificity, which is suitable for large-scale promotion and application.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120350148A_ABST
    Figure CN120350148A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of biological detection, and discloses a composition and a kit for detecting intestinal pathogens and application of the composition and the kit. The composition provided by the invention contains the primer group aiming at various intestinal pathogens, can realize simultaneous detection of various different intestinal pathogens and different serotypes thereof, and also has the advantages of simple operation, high detection efficiency and the like while realizing high-specificity and high-sensitivity intestinal pathogen detection.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of biological detection, and particularly relates to a composition, a kit and an application for detecting intestinal pathogens. Background Art

[0002] Infectious diarrhea is a disease caused by human infection with pathogens and mainly manifested by diarrhea. It is prevalent all over the world and is a common and frequently-occurring disease that endangers human health. Infectious diarrhea poses a more serious threat to children's health and is an important factor leading to malnutrition, growth and development disorders and even death in children. Infantile diarrhea is a very prominent and serious disease burden.

[0003] Diarrhea caused by pathogenic bacteria is the most common type of infectious diarrhea, and the fecal-oral route is its main transmission route. There are many types of pathogenic bacteria causing bacterial diarrhea, and Salmonella, Shigella, Campylobacter, etc. are common pathogens causing bacterial diarrhea. Studies have found that the above-mentioned intestinal pathogens capable of causing diarrhea all contain multiple serotypes (or serogroups), and the treatment regimens for pathogens of different serotypes vary.

[0004] Currently, the main method for detecting pathogenic bacteria infection is the bacterial culture method. However, the isolation and culture of pathogenic bacteria are time-consuming and cumbersome, and problems such as missed detection and misdetection may occur during the operation process due to improper sampling, operation errors, sample contamination, etc. Moreover, the bacterial culture method cannot directly detect the serotype of pathogenic bacteria, which further prolongs the detection process, reduces the detection efficiency, and has an adverse impact on the determination of the subsequent treatment regimen for the diagnosis of emergency patients.

[0005] Therefore, developing a new detection method that can quickly and accurately determine the types and serotypes of intestinal pathogenic bacteria is of great significance for both medical and scientific research work. Summary of the Invention

[0006] The purpose of the present invention is to overcome the above problems existing in the prior art, and provide a composition, a kit and an application for detecting intestinal pathogens. The composition provided by the present invention contains amplification primers for different serotypes of common intestinal pathogenic bacteria. When these primers are used in combination, multiple pathogenic bacteria in a sample can be detected simultaneously, thereby realizing rapid, accurate and highly sensitive detection and analysis of intestinal pathogenic bacteria.

[0007] To achieve the above purpose, on the one hand, the present invention provides a composition for nucleic acid detection, and the composition includes at least one of the following primer sets A, primer sets B and primer sets C:

[0008] Primer set A: primers selected from at least one of the target sequences for Salmonella typhi, the target sequence for Salmonella enterica serovar Typhi, and the target sequence for Salmonella typhimurium, wherein the target sequence for Salmonella typhi is selected from nucleotide sequences having more than 90% identity with SEQ ID NO: 39, the target sequence for Salmonella enterica serovar Typhi is selected from nucleotide sequences having more than 90% identity with SEQ ID NO: 40, and the target sequence for Salmonella typhimurium is selected from nucleotide sequences having more than 90% identity with SEQ ID NO: 41;

[0009] Primer set B: primers selected from at least one of the target sequences for Shigella dysenteriae, the target sequence for Shigella flexneri, the target sequence for Shigella boydii, and the target sequence for Shigella sonnei, wherein the target sequence for Shigella dysenteriae is selected from nucleotide sequences having more than 90% identity with SEQ ID NO: 42, the target sequence for Shigella flexneri is selected from nucleotide sequences having more than 90% identity with SEQ ID NO: 43, the target sequence for Shigella boydii is selected from nucleotide sequences having more than 90% identity with SEQ ID NO: 44, and the target sequence for Shigella sonnei is selected from nucleotide sequences having more than 90% identity with SEQ ID NO: 45;

[0010] Primer set C: primers selected from at least one of the target sequences for Campylobacter jejuni, the target sequence for Campylobacter coli, the target sequence for Campylobacter fetus, and the target sequence for Campylobacter lari, wherein the target sequence for Campylobacter jejuni is selected from nucleotide sequences having more than 90% identity with SEQ ID NO: 46, the target sequence for Campylobacter coli is selected from nucleotide sequences having more than 90% identity with SEQ ID NO: 47, the target sequence for Campylobacter fetus is selected from nucleotide sequences having more than 90% identity with SEQ ID NO: 48, and the target sequence for Campylobacter lari is selected from nucleotide sequences having more than 90% identity with SEQ ID NO: 49.

[0011] The second aspect of the present invention provides a kit, which contains the composition described in the first aspect.

[0012] The third aspect of the present invention provides the use of the composition described in the first aspect, or the kit described in the second aspect, in the detection of intestinal pathogens.

[0013] The fourth aspect of the present invention provides a method for detecting intestinal pathogens in a sample, the method comprising subjecting the sample to be tested to in vitro nucleic acid amplification using the composition described in the first aspect or the kit described in the second aspect.

[0014] By the above technical solution, the present invention can at least achieve the following beneficial effects:

[0015] (1) The composition provided by the present invention contains detection primers for different pathogenic bacteria and their drug resistances. These primers can be freely combined to achieve the detection purposes of different pathogenic bacteria and drug resistances as needed. The composition and the kit of the present invention can achieve the detection of at most three different pathogenic bacteria and their two different drug resistances respectively. During the simultaneous detection process, multi-target detection can be completed only through one PCR, which simplifies the detection process, greatly improves the detection efficiency, and reduces the detection cost.

[0016] (2) The primer pairs and probes contained in the composition provided by the present invention will not polymerize with each other, have no interference with each other, have good simultaneous detection effects on multiple targets in the sample, and have good specificity, high detection sensitivity, convenient operation, and are suitable for large-scale popularization and application. Description of the Drawings

[0017] Figures 1-3 It is a test result diagram of the mixed sample in Example 2, where Figure 1 are the melting curves of Salmonella typhi, Salmonella enterica serovar Typhi, Salmonella typhimurium and the internal standard detected by the FAM channel; Figure 2 are the melting curves of Shigella dysenteriae, Shigella flexneri, Shigella boydii, Shigella sonnei detected by the HEX channel; Figure 3 are the melting curves of Campylobacter jejuni, Campylobacter coli, Campylobacter fetus and Campylobacter lari detected by the ROX channel.

[0018] Figure 4 It is a test result diagram of other intestinal pathogens in Example 2.

[0019] Figure 5 It is a single-channel test result diagram of the Campylobacter lari sample using the substituted Campylobacter lari primer pair in Comparative Example 1. Detailed Embodiments

[0020] The endpoints and any values within the ranges disclosed herein are not limited to the exact ranges or values. These ranges or values should be understood to include values close to these ranges or values. For numerical ranges, between the endpoint values of each range, between the endpoint values of each range and individual point values, and between individual point values, they can be combined with each other to obtain one or more new numerical ranges, and these numerical ranges should be regarded as specifically disclosed herein.

[0021] In the research, the inventors of the present invention ingeniously designed a series of PCR primers and probes respectively according to specific target sequences in Salmonella, Shigella and Campylobacter of different serotypes. These primers and probes do not produce non-specific binding or dimers, can coexist in the reaction system, and do not have adverse effects on each other when used together, and can perform efficient PCR amplification on multiple target sequences simultaneously. By using fluorescence labeling and melting curve analysis, simultaneous detection of different pathogenic bacteria species and serotypes can be achieved.

[0022] Based on this, in the first aspect of the present invention, a composition for nucleic acid detection is provided, and the composition includes at least one of the following primer sets A, B and C:

[0023] Primer set A: primers selected from at least one of the target sequences of Salmonella typhi, Salmonella enterica subsp. enterica serovar Typhimurium, and Salmonella enterica subsp. enterica serovar Enteritidis, wherein the target sequence of Salmonella typhi is selected from nucleotide sequences having more than 90% identity with SEQ ID NO: 39, the target sequence of Salmonella enterica subsp. enterica serovar Enteritidis is selected from nucleotide sequences having more than 90% identity with SEQ ID NO: 40, and the target sequence of Salmonella enterica subsp. enterica serovar Typhimurium is selected from nucleotide sequences having more than 90% identity with SEQ ID NO: 41;

[0024] Primer set B: primers selected from at least one of the target sequences of Shigella dysenteriae, Shigella flexneri, Shigella boydii, and Shigella sonnei, wherein the target sequence of Shigella dysenteriae is selected from nucleotide sequences having more than 90% identity with SEQ ID NO: 42, the target sequence of Shigella flexneri is selected from nucleotide sequences having more than 90% identity with SEQ ID NO: 43, the target sequence of Shigella boydii is selected from nucleotide sequences having more than 90% identity with SEQ ID NO: 44, and the target sequence of Shigella sonnei is selected from nucleotide sequences having more than 90% identity with SEQ ID NO: 45;

[0025] Primer set C: primers selected from at least one of the target sequences of Campylobacter jejuni, Campylobacter coli, Campylobacter fetus, and Campylobacter lari, wherein the target sequence of Campylobacter jejuni is selected from nucleotide sequences having more than 90% identity with SEQ ID NO: 46, the target sequence of Campylobacter coli is selected from nucleotide sequences having more than 90% identity with SEQ ID NO: 47, the target sequence of Campylobacter fetus is selected from nucleotide sequences having more than 90% identity with SEQ ID NO: 48, and the target sequence of Campylobacter lari is selected from nucleotide sequences having more than 90% identity with SEQ ID NO: 49.

[0026] ATGCTGTTAACGAGTCGTCGGGGTTATTCATCATTCGGTCCACTAGAGCATCTATCTCTTCAGCATCTTGTAAGGCACTAATTGCCGTAATTCGATTAATTTTGCGTTCAAGTCTGTAATCAGCATTTACGCGCTGAGCATGTAACATCTTTAACTTAATGCCAATTTTACGGACTTTATCAACATCTACGCCGTTAACTTTAGCAGCCTCACCGTTACAAAAAGCTGTATAGAGTCGCATGTGAGAACCGCCAGGTAATCTCTCACCATCAGTATCATGGGTAGGCGTCAGATTGTTAGTGATTCTGAGGGCTGAATGATACATGCCGTAGTATGACCTGCTGATAGCATTACGTGTCCATTGCTCACCATTGTGCTGCAATGATTCTCTGGCTAATTC(SEQ ID NO:39)

[0027] ACCAGGGATTCGTTATTGCCGAGGTGGATTTTTTGCAGCTTGTCCATTATCACCCCGGATAATACTGTTCCTGTAGCTCGCATTGAGCCAAAAACATATCCCATCCATTGTCGCGCAATGCTTGGAGAGCTGCGCTAAAGCTGACGTTGCAACTATCCATCAAATACTGAATCACTTCATTCCTTCCCATCTTTCCCTCTCCCCTTAACGCCGGGTGGCGGAACTAAAACCTACAGCGCCGTGCTGTTTCTGAGATTATATTAGCGATATTCATATAGTTGATCAAGATAAATATGCATATATATCATAAATATGATCTATCCTAATGAAAATA(SEQ ID NO:40)

[0028] ACCCTTATCACAAATAAAGAATCAAATACAAAAATCGACATTCATAATATCAAATGGTTTCCTTGTAGTAGTGGAGGTGAATATCGAAAGTGGTATGGTAATAACGAAATAGTTGTAAATTGGGAAAATAATGGTTACGAAATACGAAATTTTAAATTTGAGAATGGCAAAACTCGCTCTGCCGTAAGAAATGATGAGTATTACTTTAGAGAAGGCATAACATGGTCAAAAATAAGCCAAGGTAATTTTTGCGTGAGATATCGTCCAAAAGGGTTTGTTTTTGATGATACAGGCCGTTGCGGCTTTTCAAATAACAAAAATGAGTTGCTTTACGCTGCGGGATTAATGTGCACTCCGGTTGTAAACCATTATTTATCAATACTAGCCCCCACACTTAGCTTTACTAGTGGTGAATTAGCCTCAGTACCATATCCAGAAATTGAAGATGAAATTATCGAATTAGTCACCAATGCTATTGAAATAGCTAAAAATGACTGGGA(SEQ ID NO:41)

[0029] CATAATTTTTACTTATCAACTATTATTGATTCTAGTATTTTGATATTAGCAATTGTAATGATGGTGCTATATTAATGGTTTCAAGAACCCCCGCAAAATCAAATGTTATTTTGGGGGTATGTTCTTGACTATATACTATATGTTCATTTCTCTGTTCTACTGGCAAGTGAGAGTCCTATACTTTGTTATTATATTATTATTTACCTTTGTAAATATAAGTAAGAAGAGTGAGCAATGAAAAACCATAAGGTTAGTATTATCATCCCCTGTTTTAATAACGGAAAAACTATAGAAAGATGCGTTCTTTCCGCATTAAAACAAACCCATAGAAATAT(SEQ ID NO:42)

[0030] ATAACAGTGATCCATATAATGCAAATGCATTAACTATTTTAATAAAAATCTCACATGAAAATACTTTTAAAGTATATCTTAGTGTAAATAGATATATAAGTGACAGCATAAAAAGGTATGGTTGCACATCAAACAGTATATCATTTATTTTATTACCAGCTAATAAGCCGACAAAGAAGCCATAAAAAGGAAATAAAAGCAACCATATAAAAAGACTGACACATTTTTGGGTGATTGAAAAATTGAATGTAACTAAATTAAAAATTAAAAGTATAAAACTAAATACAAATAATAAATATCGCAAAGGGAATATTCCCAATGGCTCCAGTAATCTTCCACCACCACCAATAATCAGTTCAATACATAAAAATGTTATAAAAATTTTATTTATATTATTCAT(SEQ ID NO:43)

[0031] ATCACGCGCAGTTTATGGAGCAGGCGCTGCACCAGGCGGGCTTTGAAACGCGTATCTTGCGCGGGCTGGATGAACTGGGCTGGGATGCTGCCGGGCAACTGATTGATGGGGAAGGGCGACTGGTTAACTGCGTGTGGAAAACCTGGGCGTGGGAAACCGCGTTTGATCAGATTCGTGAAGTTAGCGACCGTGAGTTTGCTGCGGTGCCAATCCGTACCGGTCATCCGCAAAACGAAGTGCGTCTTATCGACGTATTGCTGCGCCCGGAAGTGCTGGTCTTTGAGCCGCTGTGGACGGTG(SEQ ID NO:44)

[0032] ACGTGTTTGGTACCTTGTACTGCGCTGAGTCAGCGATCGAAAGTGGCGTTGAAACTTTTGTGTTGATTTCCACCGATAAAGCGGTGCGCCCGACCAACACTATGGGGACAACTAAGCGTCTGGCCGAATTGGTATTGCAGGCTTTGTCTGCACGGCAAAGCCAAACTCGCTTTTGTATGGTGCGATTTGGTAATGTACTCGGTTCTTCGGGCTCTGTCGTGCCGTTGTTTGAAAAACAGATTGCCCAAGGTGGGCCAGTTACCTTGACTCATCGTGACATTATTCGCTATTTCATGACAATTCCGGAAGCATCACAGTTGGTGATTCAAGCGGGGGCGATGGGGCATGGCGGCGATGTCTTTGTCTTAGACATGGGCGATCCGGTCAAG(SEQ ID NO:45)

[0033] TCAAGTTCTTGTTTTAAATAAGTATAAAATACCGCATTAAAATTCACATCAACAAATAACTTTTTCCCTTTAGCATTTAAAACCTTTTGCCCTTCTTTTAAATCATAAAATCTATGTAAATAAACCTTTTTCAAAGCAATACCAGTGTCTAAAGTGCGTTTATTGGCACAACATTGAATTCCAACATCGCTAATGTATAAA(SEQ ID NO:46)

[0034] ATAAGTTTTACACTTGAAAATATCCGCAATGGCGGAACATTTATGGCTTGGATGGAGTCCCGTCGTTTAGAATGGGCTCCTTTAATGGCCGCAAGATTAAGATACCTTTTAGAGGGGCGAACCTT TGTTTTAATGTGTGA(SEQID NO:47)

[0035] ATGGATGGGGTATGATTGAGACATCTAATGCTATACTTAATTTAGATATTACTAAGAGTTTTCTTGGCGAGACTTTAAATAATAATGAGTCGTTTGTAAAGCATTTATTTAAGAATGCTGTTAATTTAACTGAGTTTGTTAGTGATGAGCAAAAAGCTGGTCTTAAGTATTGGGTTGATCTTTTAGATAATGGTACAGTAAGTAAGGCTGATTTAGTAGGACACTTCGTGAATGCTGCTAAAGATCCTAGTAATGCTGGGGCTAATCAAGATCTATTTAATAATAAGGTAATTGTTAGTAATTATGTTGCTGATACTATAGCTAAACTTCCACTTGATGGTCTTACTCCTGATCAACAAAATGCTTTAATACAAAAGACTGTTGATATAATTAATAATGT(SEQ ID NO:48)

[0036] ATGCAAAAAACTTTTTAATTGTAATTTTGCTAATGTGCAACCTAATTCAGGTTCGCAAGCAAATCAAGGTGTGTATATGGCATTGTTAAATCCTGGTGATAGAATTTTGGGTATGGATTTAAGCCATGGAGGACACTTAACTCATGGTTCTAAAGTAAGTTCTTCTGGAAAAGTTTATGAAAGCTTTTTTTATGGAGTTGAGCTTGATGGAAGAATTAATTATGATAAAGTTAGAGAGATAGCAAAAGAGATTAAACCAAAACTTATTGTTTGTGGTGCTAGTGCTTATCCTAGAGTGATTGATTTTGCCAAATTTAGAGAAATAGCAGATGAGGTTGGTGCGTATTTGTTTGCTGATATTGCACATATTGCAGGTTTGGTTGTAGCAGGTGAGCATCCCAGTCCATTCCCTCATGCTCATGTTGTAAGTTCTACTACACATAAAACT(SEQ ID NO:49)

[0037] In the present invention, "identity" refers to the proportion of the completely identical sequences between two sequences. For example, if sequence a and sequence b have 90% identity, it means that 90% of sequence a is identical to sequence b, or 90% of sequence b is identical to sequence a. The different parts in the two sequences can be caused by nucleotide deletion, addition or substitution. For example, sequence b obtained by deleting 20 consecutive nucleotides from the 5'-end of a 100-nucleotide sequence a has 100% identity with sequence a.

[0038] In the present invention, the target sequence is selected from nucleotide sequences having more than 90% identity with a certain sequence, which means that the proportion of the completely identical sequences between the target sequence and this sequence is not less than 90%. Taking Salmonella typhi as an example, its target sequence can be a nucleotide sequence having 90-100% identity with SEQ ID NO: 39. For example, the identity can be 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 100%, or the range formed by any two of the above values, or any intermediate value within this range. The situations of other target sequences are similar and will not be elaborated here.

[0039] In the composition provided by the present invention, primer set A is a primer set for detecting Salmonella, which can contain at most primers for detecting three different serotypes of Salmonella (Salmonella typhi, Salmonella enteritidis, and Salmonella typhimurium); primer set B is a primer set for detecting Shigella, which can contain at most primers for detecting four different serotypes of Shigella (Shigella dysenteriae, Shigella flexneri, Shigella boydii, and Shigella sonnei); primer set C is a primer set for detecting Campylobacter, which can contain at most primers for detecting four different serotypes of Campylobacter (Campylobacter jejuni, Campylobacter coli, Campylobacter fetus, and Campylobacter lari).

[0040] The compositions provided by the present invention can be freely combined according to actual needs. For example, the composition can simultaneously contain the above primer set A, primer set B, and primer set C, or can only contain one of them (i.e., only primer set A, only primer set B, or only primer set C), and can also contain a combination of any two of the primers; for each type of primer, it can contain primers targeting all of the aforementioned target sequences, or can contain primers targeting a combination of two or more target sequences.

[0041] In the present invention, the target sequences of primer set A, primer set B, and primer set C can be the complete sequences of the above target sequences, or can be partial fragments of the above target sequences.

[0042] According to some preferred embodiments of the present invention, among them, the target sequence of Salmonella typhi is as shown in SEQ ID NO:25.

[0043] GTAACATCTTTAACTTAATGCCAATTTTACGGACTTTATCAACATCTACGCCGTTAACTTTA GCAGCCTCACCGTTACAAAAAGCTGTATAGAGTCGCATGTGAGAACCGCCAGGTAATC(SEQ ID NO:25)

[0044] In the present invention, that the target sequence is selected from nucleotide sequences having more than 90% identity with a certain sequence means that the proportion of the sequence that is completely identical between the target sequence and this sequence is not less than 90%. Taking Salmonella typhi as an example, its target sequence SEQ ID NO:25 has a nucleotide sequence with 100% identity with SEQ ID NO:39. The situations of other target sequences are similar and will not be elaborated here.

[0045] According to some preferred embodiments of the present invention, among them, the target sequence of Salmonella enterica serovar Typhi is as shown in SEQ ID NO:26.

[0046] CCCGGATAATACTGTTCCTGTAGCTCGCATTGAGCCAAAAACATATCCCATCCATTGTCGC GCAATGCTTGGAGAGCTGCGCTAAAGCTGACGTTGCAACTATCCATCAAATACTGAATCACTTCATTCCTTCCCATCTTTCCCTCTCC(SEQ ID NO:26)

[0047] According to some preferred embodiments of the present invention, among them, the target sequence of Salmonella typhimurium is as shown in SEQ ID NO:27.

[0048] ATGGCAAAACTCGCTCTGCCGTAAGAAATGATGAGTATTACTTTAGAGAAGGCATAACATGGTCAAAAATAAGCCAAGGTAATTTTTGCGTGAGATATCGTCCAAAAGGGTTTGTTTTTGATGATACAGGCCGTTGCGGCTTTTCAAATAACAAAAATGAGTTGCTTTACGCTGCGGGATTAATGTGCACTCCGGTTGTAAACCATTATTTATCAATACTAGCCCCCACACTTAGCTTTACTAGTGGTGAATTAGCCTCAGTACCATATCCAGAAATTGAAGATGAA(SEQ IDNO:27)

[0049] According to some preferred embodiments of the present invention, the target sequence of Shigella dysenteriae is as shown in SEQ ID NO: 28.

[0050] CATAATTTTTACTTATCAACTATTATTGATTCTAGTATTTTGATATTAGCAATTGTAATGAT GGTGCTATATTAATGGTTTCAAGAACCCCCGCAA(SEQ ID NO:28)

[0051] According to some preferred embodiments of the present invention, the target sequence of Shigella flexneri is as shown in SEQ ID NO: 29.

[0052] ATAAAAAGGTATGGTTGCACATCAAACAGTATATCATTTATTTTATTACCAGCTAATAAGC CGACAAAGAAGCCATAAAAAGGAAATAAAAGCAACCATATAAAAAGACTGA(SEQ ID NO:29)

[0053] According to some preferred embodiments of the present invention, the target sequence of Shigella boydii is as shown in SEQ ID NO: 30.

[0054] CGGGCAACTGATTGATGGGGAAGGGCGACTGGTTAACTGCGTGTGGAAAACCTGGGCGTG GGAAACCGCGTTTGATCAGATTCGTGAAGTTAGCGACCGTGAGTTTGCTGCGGTGCCAATCCGTACCGGTCATCCGCAAAACGAAGTG(SEQ ID NO:30)

[0055] According to some preferred embodiments of the present invention, the target sequence of Shigella sonnei is as shown in SEQ ID NO:31.

[0056] CTTTGTCTGCACGGCAAAGCCAAACTCGCTTTTGTATGGTGCGATTTGGTAATGTACTCGGTTCTTCGGGCTCTGTCGTGCCGTTGTTT(SEQ ID NO:31)

[0057] According to some preferred embodiments of the present invention, the target sequence of Campylobacter jejuni is as shown in SEQ ID NO:32.

[0058] AAATACCGCATTAAAATTCACATCAACAAATAACTTTTTCCCTTTAGCATTTAAAACCTTTT GCCCTTCTTTTAAATCATAAAATCTATGTAAATAAACCTTTTTCAAAGCAATACCAGTGTCTAA AGTGCGTTTATTGGCA(SEQ ID NO:32)

[0059] According to some preferred embodiments of the present invention, the target sequence of Campylobacter coli is as shown in SEQ ID NO:33.

[0060] ATAAGTTTTACACTTGAAAATATCCGCAATGGCGGAACATTTATGGCTTGGATGGAGTCCC GTCGTTTAGAATGGGCTCCTTTAATGGCCGCAAGATTAAGATACCTTTTAGAGGGGCGAACCTT TGTTTTAATGTGTGA(SEQ ID NO:33)

[0061] According to some preferred embodiments of the present invention, the target sequence of Campylobacter fetus is as shown in SEQ ID NO:34.

[0062] ATGAGCAAAAAGCTGGTCTTAAGTATTGGGTTGATCTTTTAGATAATGGTACAGTAAGTAA GGCTGATTTAGTAGGACACTTCGTGAATGCTGCTAAAGATCCTAGTAATGCTGGGGCTAATCAA GATCTATTTAATA(SEQID NO:34)

[0063] According to some preferred embodiments of the present invention, the target sequence of Campylobacter lari is as shown in SEQ ID NO: 35.

[0064] GGACACTTAACTCATGGTTCTAAAGTAAGTTCTTCTGGAAAAGTTTATGAAAGCTTTTTTTATGGAGTTGAGCTTGATGGAAGAATTAATTATGATAAAGTTAGAGAGATAGCAAAAGAGATTAAACCAAAACTTATTGTTTGTGGTGCTAGTGCTTATCCTAGAGTGATTGATTTTGCCAAATTTAGAGAAATAGCAGATGAGGTTGGTGCGTATTTG(SEQ ID NO: 35)

[0065] According to a preferred embodiment of the present invention, primer set A includes at least one pair of primer pairs selected from primer pair SEQ ID NO: 1 and SEQ ID NO: 13 (primer pair for Salmonella typhi), primer pair SEQ ID NO: 2 and SEQ ID NO: 14 (primer pair for Salmonella enterica subsp. enterica serovar Typhi), and primer pair SEQ ID NO: 3 and SEQ ID NO: 15 (primer pair for Salmonella typhimurium).

[0066] According to a preferred embodiment of the present invention, primer set B includes at least one pair of primer pairs selected from primer pair SEQ ID NO: 5 and SEQ ID NO: 17 (primer pair for Shigella dysenteriae), primer pair SEQ ID NO: 6 and SEQ ID NO: 18 (primer pair for Shigella flexneri), primer pair SEQ ID NO: 7 and SEQ ID NO: 19 (primer pair for Shigella boydii), and primer pair SEQ ID NO: 8 and SEQ ID NO: 20 (primer pair for Shigella sonnei).

[0067] According to a preferred embodiment of the present invention, primer set C includes at least one pair of primer pairs selected from primer pair SEQ ID NO: 9 and SEQ ID NO: 21 (primer pair for Campylobacter jejuni), primer pair SEQ ID NO: 10 and SEQ ID NO: 22 (primer pair for Campylobacter coli), primer pair SEQ ID NO: 11 and SEQ ID NO: 23 (primer pair for Campylobacter fetus), and primer pair SEQ ID NO: 12 and SEQ ID NO: 24 (primer pair for Campylobacter lari).

[0068] According to some preferred embodiments of the present invention, the composition can be any of the following primer combinations:

[0069] (1) Primer combinations for simultaneously detecting Salmonella of different serotypes, which include at least two pairs of primer pairs selected from primer pair SEQ ID NO:1 and SEQ ID NO:13, primer pair SEQ ID NO:2 and SEQ ID NO:14, and primer pair SEQ ID NO:3 and SEQ ID NO:15;

[0070] (2) Primer combinations for simultaneously detecting Shigella of different serotypes, which include at least two pairs of primer pairs selected from primer pair SEQ ID NO:5 and SEQ ID NO:17, primer pair SEQ ID NO:6 and SEQ ID NO:18, primer pair SEQ ID NO:7 and SEQ ID NO:19, and primer pair SEQ ID NO:8 and SEQ ID NO:20;

[0071] (3) Primer combinations for simultaneously detecting Campylobacter of different serotypes, which include at least two pairs of primer pairs selected from primer pair SEQ ID NO:9 and SEQ ID NO:21, primer pair SEQ ID NO:10 and SEQ ID NO:22, primer pair SEQ ID NO:11 and SEQ ID NO:23, and primer pair SEQ ID NO:12 and SEQ ID NO:24;

[0072] (4) Primer combinations for simultaneously detecting Salmonella and Shigella, which include:

[0073] At least one pair of primer pairs selected from primer pair SEQ ID NO:1 and SEQ ID NO:13, primer pair SEQ ID NO:2 and SEQ ID NO:14, and primer pair SEQ ID NO:3 and SEQ ID NO:15, and

[0074] At least one pair of primer pairs selected from primer pair SEQ ID NO:5 and SEQ ID NO:17, primer pair SEQ ID NO:6 and SEQ ID NO:18, primer pair SEQ ID NO:7 and SEQ ID NO:19, and primer pair SEQ ID NO:8 and SEQ ID NO:20;

[0075] (5) Primer combinations for simultaneously detecting Salmonella and Campylobacter, which include:

[0076] At least one pair of primer pairs selected from primer pair SEQ ID NO:1 and SEQ ID NO:13, primer pair SEQ ID NO:2 and SEQ ID NO:14, and primer pair SEQ ID NO:3 and SEQ ID NO:15, and

[0077] At least one pair among primer pairs SEQ ID NO:9 and SEQ ID NO:21, primer pairs SEQ ID NO:10 and SEQ ID NO:22, primer pairs SEQ ID NO:11 and SEQ ID NO:23, and primer pairs SEQ ID NO:12 and SEQ ID NO:24;

[0078] (6) A primer combination for simultaneously detecting Shigella and Campylobacter, the primer combination comprising:

[0079] At least one pair among primer pairs SEQ ID NO:5 and SEQ ID NO:17, primer pairs SEQ ID NO:6 and SEQ ID NO:18, primer pairs SEQ ID NO:7 and SEQ ID NO:19, and primer pairs SEQ ID NO:8 and SEQ ID NO:20, and

[0080] At least one pair among primer pairs SEQ ID NO:9 and SEQ ID NO:21, primer pairs SEQ ID NO:10 and SEQ ID NO:22, primer pairs SEQ ID NO:11 and SEQ ID NO:23, and primer pairs SEQ ID NO:12 and SEQ ID NO:24;

[0081] (7) A primer combination for simultaneously detecting Salmonella, Shigella and Campylobacter, the primer combination comprising:

[0082] At least one pair among primer pairs SEQ ID NO:1 and SEQ ID NO:13, primer pairs SEQ ID NO:2 and SEQ ID NO:14, and primer pairs SEQ ID NO:3 and SEQ ID NO:15, and

[0083] At least one pair among primer pairs SEQ ID NO:5 and SEQ ID NO:17, primer pairs SEQ ID NO:6 and SEQ ID NO:18, primer pairs SEQ ID NO:7 and SEQ ID NO:19, and primer pairs SEQ ID NO:8 and SEQ ID NO:20, and

[0084] At least one pair among primer pairs SEQ ID NO:9 and SEQ ID NO:21, primer pairs SEQ ID NO:10 and SEQ ID NO:22, primer pairs SEQ ID NO:11 and SEQ ID NO:23, and primer pairs SEQ ID NO:12 and SEQ ID NO:24.

[0085] According to some preferred embodiments of the present invention, the composition further comprises primer D for an internal reference gene. Preferably, the internal reference gene is selected from nucleotide sequences having more than 90% identity with SEQ ID NO:50.

[0086] ATGGCTTCCTCTATGCTCTCTTCCGCTACTATGGTTGCCTCTCCGGCTCAGGCCACTATGGTCGCTCCTTTCAACGGACTTAAGTCCTCCGCTGCCTTCCCAGCCACCCGCAAGGCTAACAACGACATTACTTCCATCACAAGCAACGGCGGAAGAGTTAACTGCATGCAGGTGTGGCCTCCGATTGGAAAGAAGAAGTTTGAGACTCTCTCTTACCTTCCTGACCTTACCGATTCCGAATTGGCTAAGGAAGTTGACTACCTTATCCGCAACAAGTGGATTCCTTGTGTTGAATTCGAG(SEQ ID NO:50)

[0087] Preferably, the internal reference gene is as shown in SEQ ID NO:36.

[0088] ATGGCTTCCTCTATGCTCTCTTCCGCTACTATGGTTGCCTCTCCGGCTCAGGCCACTATGGTCGCTCCTTTCAACGGACTTAAGTCCTCC(SEQ ID NO:36)

[0089] More preferably, primer D comprises the primer pair SEQ ID NO:4 and SEQ ID NO:16.

[0090] The composition provided by the present invention may further comprise a probe targeting the same target sequence as the primer, or a labeling group may be modified on one of the primer sequences of the primer pair for quantitative analysis of the amplification result.

[0091] According to a preferred embodiment of the present invention, a labeling group is modified on the primer in the composition.

[0092] Any labeling group commonly used in nucleic acid detection in the art, especially a labeling group that can be modified in the primer / probe sequence, can be applicable to the present invention, such as a fluorescent labeling group, a drug labeling group (such as biotin, etc.), a nano-luminescent labeling group, an enzyme label, etc.

[0093] Preferably, the labeling group is a fluorescent labeling group.

[0094] Since the composition provided by the present invention can be used for detecting multiple different target sequences simultaneously, in order to more clearly distinguish the detection results of different target analytes, preferably, different fluorescent labeling groups are modified on the probes / primers for different target sequences. Preferably, the different fluorescent labeling groups can be simultaneously detected through different channels.

[0095] The composition provided by the present invention can simultaneously detect multiple different pathogenic bacteria and their different serotypes. Considering the limited detection channels, through careful design by the inventors, when using the aforementioned primers to amplify the target sequences, different serotype amplification products of the same pathogenic bacterium can be distinguished by the different emergence temperatures of the melting curve peaks. Therefore, in the composition of the present invention, fluorescent labeling groups detected by the same channel can be modified on the probes / primers for different serotypes of the same pathogenic bacterium.

[0096] According to some preferred embodiments of the present invention, wherein, the fluorescent labeling group can be selected from at least one of ATTO 425, HEX, FAM, ROX, CY5, Quasar705, VIC.

[0097] The present invention has no particular limitation on the modification position of the fluorescent labeling group, which can be adjusted according to actual needs.

[0098] Preferably, the fluorescent labeling group is modified on the 2nd - 10th nucleotides at the 3' end of the primer sequence, and more preferably, the fluorescent labeling group is modified on deoxythymidine 5'-triphosphate (dTTP).

[0099] Preferably, a fluorescent quenching group is also modified on the probe (5' end). Preferably, the fluorescent quenching group is selected from at least one of BHQ1, BHQ2, SQ1, SQ2.

[0100] In the above composition provided by the present invention, each primer can be independently packaged or can be packaged in a mixture. Since non-specific binding does not occur between the primers in the above composition provided by the present invention, preferably, in order to save packaging materials and reduce production and use costs, the composition exists in the form of a mixed package.

[0101] The second aspect of the present invention provides a kit, and the kit contains the composition described in the first aspect.

[0102] According to the preferred embodiments of the present invention, wherein, the kit further contains at least one of a buffer, an enzyme, and deoxyribonucleoside triphosphate.

[0103] Preferably, the buffer includes tris(hydroxymethyl)aminomethane hydrochloride buffer (Tris-HCl buffer).

[0104] Preferably, the enzyme includes at least one of UNG enzyme, DNA polymerase (such as H-Taq enzyme, etc.).

[0105] More preferably, the kit further includes a positive control reagent and / or a negative control reagent.

[0106] The present invention has no particular limitation on the specific selection of the reagents as positive control and negative control in the kit, and can be selected according to the conventional techniques in the art. For example, reagents without target sequences such as physiological saline, buffer solution, etc. can be used as negative control, or internal standard gene pseudovirus, etc. can be used as negative control. Also, for example, mixed plasmids containing corresponding specific gene target sequences, DNA or RNA of target gene fragments, pseudovirus, etc. can be used as positive control.

[0107] The third aspect of the present invention provides the use of the composition described in the first aspect, or the kit described in the second aspect, in the detection of intestinal pathogens.

[0108] The composition and kit provided by the present invention can simultaneously detect three different intestinal pathogenic bacteria, can also simultaneously detect different serotypes of one intestinal pathogenic bacterium, and can also simultaneously detect at least two pathogenic bacteria and their different serotypes.

[0109] The fourth aspect of the present invention provides a method for jointly detecting pathogens and their drug resistance in a sample, and the method includes performing in vitro nucleic acid amplification on the sample to be tested by using the composition described in the first aspect or the kit described in the second aspect.

[0110] Preferably, the method further includes analyzing the amplification result. In a preferred embodiment, since markers such as fluorescent labeling groups are modified on the probe, the pathogens and / or drug resistance genes can be qualitatively or quantitatively detected and analyzed by detection methods for markers such as fluorescence detection. In a preferred embodiment, since primers for different serotypes of the same pathogenic bacterium are designed, different serotypes of the same pathogenic bacterium in the sample can be distinguished by melting curve.

[0111] According to some preferred embodiments of the present invention, wherein, the melting curve analysis includes, after the completion of the process of in vitro nucleic acid amplification (including at least the steps of nucleic acid denaturation, annealing and extension in the sample), heating the amplification product at a uniform heating rate within the analysis temperature range, and continuously collecting fluorescence intensity during the heating process.

[0112] The analysis temperature range refers to the range between the starting temperature and the ending temperature during the melting curve analysis process. Preferably, the analysis temperature range can be 50 - 100 °C, preferably 60 - 90 °C.

[0113] Preferably, the heating rate can be 0.01 - 0.1 °C / s. For example, the heating rate can be 0.01 °C / s, 0.02 °C / s, 0.03 °C / s, 0.04 °C / s, 0.05 °C / s, 0.06 °C / s, 0.07 °C / s, 0.08 °C / s, 0.09 °C / s, 0.1 °C / s, or any intermediate value within the range formed by any two of the above values. "Uniform heating rate" means that the heating rate is a fixed value during one melting curve analysis.

[0114] In some preferred embodiments of the present invention, when detecting a sample using the aforementioned preferred primer set or a mixture of each primer set, it is possible to first determine whether the target analyte is contained in the sample according to the temperature at which the melting curve peak appears (i.e., the peak temperature), with reference to the following criteria. Among them, primers in the same group are modified with the same fluorescent labeling group, or different fluorescent labeling groups detected by the same channel; primers in different groups are modified with fluorescent labeling groups detected by different channels:

[0115]

[0116] It should be noted that the applications in the third aspect and the methods in the fourth aspect of the present invention can be diagnostic or non-diagnostic. For example, the diagnostic aspect may include detecting a sample using the composition or kit of the present invention to determine whether the patient providing the sample has been infected with the aforementioned intestinal pathogen; the non-diagnostic aspect may include detecting a sample (including human-derived samples, animal-derived samples, environmental samples, etc.) using the composition or kit of the present invention to conduct related scientific research, detection, environmental monitoring, etc.

[0117] The present invention will be described in detail below through examples. It should be understood that the following examples are only used to further explain and illustrate the content of the present invention by way of example, and are not used to limit the present invention.

[0118] In the following examples, unless otherwise specified, the reagents and materials used are commercially available products purchased from regular chemical or biological reagent / material suppliers, and the reagents are all of analytical grade.

[0119] Example 1

[0120] This example is used to illustrate the preparation of the kit provided by the present invention.

[0121] 1. Prepare primers and probes

[0122] Entrust Sangon Biotech to synthesize primers and probes according to the sequences in Table 1.

[0123] Table 1

[0124]

[0125] Note: In Table 1, the T upstream primer sequences marked in bold and underlined are

[0126] modified with a fluorescent labeling group at the upper part. Among them, the upstream primers of Salmonella typhi, Salmonella enterica subsp. enterica serovar Typhimurium, Salmonella enterica subsp. enterica serovar Enteritidis and the internal standard are modified with FAM; the upstream primers of Shigella dysenteriae, Shigella flexneri, Shigella boydii and Shigella sonnei are modified with HEX; the upstream primers of Campylobacter jejuni, Campylobacter coli, Campylobacter fetus and Campylobacter lari are modified with ROX; the primers of SEQ ID NO:9 and SEQ ID NO:24 are described with degenerate bases. Y represents C or T, R represents A or G, and W represents A or T. These two primers are mixtures of sequences of each base represented by the degenerate bases at the corresponding positions.

[0126] 2. Prepare the unit reaction reagent set for the PCR reaction

[0127] Prepare the corresponding reagents according to the dosages of the unit reaction reagent set in Table 2 (i.e., the reagent set for detecting 1 sample in 1 PCR reaction).

[0128] Table 2

[0129]

[0130] * In Table 2, the PCR buffer is the PCR buffer (S09) purchased from Hunan Kangde Biotechnology Co., Ltd.; the dosages of the upstream primer and the downstream primer are the dosages of one sequence respectively.

[0131] 3. Prepare the control reagents

[0132] Negative control: Sterile physiological saline.

[0133] Positive control: The target sequence mixed plasmid, which is made by inserting the target sequence into the pCDH plasmid, and the target sequence is shown in Table 3 below.

[0134] Table 3

[0135] Name Sequence Target sequence of Salmonella typhi SEQ ID NO:25 Target sequence of Salmonella enterica subsp. enterica serovar Typhi SEQ ID NO:26 Target sequence of Salmonella typhimurium SEQ ID NO:27 Target sequence of Shigella dysenteriae SEQ ID NO:28 Target sequence of Shigella flexneri SEQ ID NO:29 Target sequence of Shigella boydii SEQ ID NO:30 Target sequence of Shigella sonnei SEQ ID NO:31 Target sequence of Campylobacter jejuni SEQ ID NO:32 Target sequence of Campylobacter coli SEQ ID NO:33 Target sequence of Campylobacter fetus SEQ ID NO:34 Target sequence of Campylobacter lari SEQ ID NO:35 Internal standard target sequence SEQ ID NO:36

[0136] 4. Prepare the kit

[0137] Match and package the reagents prepared in steps 1-3 according to the target detection amount of a single kit.

[0138] Example 2

[0139] This example is used to illustrate the combined detection effect of the kit provided by the present invention on Salmonella, Shigella and Campylobacter of different serotypes in a sample.

[0140] (1) PCR Detection

[0141] 1. Prepare the sample to be tested

[0142] The sample bacteria used in this example were all obtained through commercial channels. The product numbers are shown in Table 4 for details.

[0143] Table 4

[0144]

[0145] Sample preparation: Take 300 μL of the sample bacterial suspension, negative control, and positive control into 1.5 mL centrifuge tubes respectively. Then, use the nucleic acid extraction and purification reagents of Shengxiang Biotech Co., Ltd. to perform nucleic acid extraction and purification according to the instructions. Mix the obtained purified sample bacterial DNA solutions as the sample to be tested.

[0146] 2. Sample addition and PCR amplification

[0147] Take 10 μL of the sample to be tested, 10 μL of the negative control, and 10 μL of the positive control and add them into PCR reaction tubes respectively. Add 40 μL of the unit PCR reaction reagent set (the specific components are shown in Table 2) to each tube. After mixing, place them in a Hongshi fluorescence quantitative PCR analyzer and perform PCR reaction according to the reaction conditions in Table 5.

[0148] Table 5

[0149]

[0150] Detection standard: Refer to Table 6, and determine the types and serotypes of pathogenic bacteria in the sample according to the appearance temperature of the melting curve peaks in each detection channel.

[0151] Table 6

[0152]

[0153] The detection results of the sample to be tested are as Figures 1-3 shown in and Table 7. The detection results of the positive control are consistent with it. Referring to the judgment criteria in Table 6, it is determined that Salmonella typhi, Salmonella enterica subsp. enterica serovar Typhimurium, Salmonella enterica subsp. enterica serovar Dublin, Shigella dysenteriae, Shigella flexneri, Shigella boydii, Shigella sonnei, Campylobacter jejuni, Campylobacter coli, Campylobacter fetus, Campylobacter lari in the mixed sample are all positive.

[0154] Table 7

[0155]

[0156] (2) Sensitivity test

[0157] Detect the sensitivity (LOD) of each target. The specific method is as follows:

[0158] Using the plasmid in Example 1 as a positive control, gradient dilution solutions of each target sequence were prepared, with concentration gradients of: 10,000 copies / mL, 1,000 copies / mL, and 400 copies / mL. Then, the gradient dilution solutions of each target sequence were detected respectively using the method in Experiment (1) to determine the detection limit of each target sequence. The specific detection results are shown in Table 8.

[0159] Table 8

[0160] Target sequence contained in the plasmid 10,000 copies / mL 1,000 copies / mL 400 copies / mL Salmonella typhi 100%(20 / 20) 100%(20 / 20) 100%(20 / 20) Salmonella typhimurium 100%(20 / 20) 100%(20 / 20) 100%(20 / 20) Salmonella enterica subsp. enterica serovar Typhi 100%(20 / 20) 100%(20 / 20) 100%(20 / 20) Shigella dysenteriae 100%(20 / 20) 100%(20 / 20) 95%(19 / 20) Shigella flexneri 100%(20 / 20) 100%(20 / 20) 100%(20 / 20) Shigella sonnei 100%(20 / 20) 100%(20 / 20) 100%(20 / 20) Shigella boydii 100%(20 / 20) 100%(20 / 20) 95%(19 / 20) Campylobacter coli 100%(20 / 20) 100%(20 / 20) 95%(19 / 20) Campylobacter lari 100%(20 / 20) 100%(20 / 20) 100%(20 / 20) Campylobacter fetus 100%(20 / 20) 100%(20 / 20) 100%(20 / 20) Campylobacter jejuni 100%(20 / 20) 100%(20 / 20) 100%(20 / 20)

[0161] (III) Specificity test

[0162] Using the method in Experiment (1), other intestinal pathogens (Enterococcus faecalis, Staphylococcus aureus, Yersinia enterocolitica, Escherichia coli O157, Clostridium difficile, Clostridium perfringens, Helicobacter pylori, Enterovirus 71, Astrovirus, Rotavirus, Enteric adenovirus) were detected respectively. The results are as Figure 4 shown. It can be seen from the figure that these pathogens all showed obvious negative detection results, indicating that the composition and kit provided by the present invention have good specificity.

[0163] (IV) Stability test

[0164] (1) Repeat detection stability

[0165] Using the method in Experiment (1), the test samples and positive controls (mixtures of plasmids of each target sequence) were detected respectively, and each sample was detected 10 times repeatedly.

[0166] The detection results of the test samples and positive controls were similar and highly consistent, indicating that the kit of the present invention has good repeat detection stability.

[0167] (2) Long-term storage stability

[0168] In order to further test the stability of the primer sets contained in the kit, the method of heat treatment was used to accelerate the deterioration rate of the primers, simulate the state after the kit was stored for a long time, and test its detection effect. The specific method is as follows:

[0169] Using the plasmid in Example 1 as a positive control, dilution solutions of each target sequence were prepared (the concentration of each target sequence was 400 copies / mL). The prepared dilution solutions of the target sequences were divided into three parts, and were detected respectively using the kits treated in the following ways:

[0170] Conventional: that is, the freshly prepared kit in Example 1.

[0171] Treatment at 37°C for 48 h: After the kit was prepared according to the method of Example 1, it was placed at 37°C for 48 h.

[0172] Treatment at 37°C for 72 h: After the kit was prepared according to the method of Example 1, it was placed at 37°C for 72 h.

[0173] Table 9

[0174] Target sequence contained in the plasmid Conventional Treated at 37°C for 48 h Treated at 37°C for 72 h Salmonella typhi 100%(20 / 20) 100%(20 / 20) 100%(20 / 20) Salmonella typhimurium 100%(20 / 20) 100%(20 / 20) 100%(20 / 20) Salmonella enterica subsp. enterica serovar Typhi 95%(19 / 20) 100%(20 / 20) 100%(20 / 20) Shigella dysenteriae 100%(20 / 20) 100%(20 / 20) 95%(19 / 20) Shigella flexneri 100%(20 / 20) 100%(20 / 20) 100%(20 / 20) Shigella sonnei 100%(20 / 20) 100%(20 / 20) 100%(20 / 20) Shigella boydii 100%(20 / 20) 95%(19 / 20) 95%(19 / 20) Campylobacter coli 95%(19 / 20) 100%(20 / 20) 95%(19 / 20) Campylobacter lari 100%(20 / 20) 100%(20 / 20) 100%(20 / 20) Campylobacter fetus 100%(20 / 20) 100%(20 / 20) 100%(20 / 20) Campylobacter jejuni 100%(20 / 20) 95%(19 / 20) 100%(20 / 20)

[0175] It can be seen from the results in Table 9 that there is no significant difference in the detection results of the kit for the sample after being treated at 37°C for 48 h and 72 h respectively compared with the untreated kit. It can be inferred therefrom that the detection effect of the kit of the present invention will not decrease significantly after long-term storage, indicating its good stability.

[0176] Comparative Example 1

[0177] The kit was prepared in the same manner as in Example 1, except that the detection primer for Campylobacter jejuni was replaced with the sequence in Table 10.

[0178] Table 10

[0179]

[0180] Note: In Table 10, the T upstream primer sequence is in bold and underlined and

[0181] is modified with ROX; the primer of SEQ ID NO:38 is described using degenerate bases, where R represents A or G, and this primer is a mixture of sequences of each base represented by the degenerate bases at the corresponding positions. Figure 5 Using the method in Example 2, the primers in the above table and the primers in Table 1 were used to separately detect Campylobacter jejuni samples. The results are shown in

[0182]

[0183] It can be seen from the figure that non-specific amplification occurred when using the primers in Table 10 to amplify the target sequence in the Campylobacter jejuni genome, which is likely to cause false positive results. Using the kit of this comparative example to test the sample to be tested (purified sample bacterial DNA mixed solution) in Example 2 showed that it was difficult to clearly distinguish different serotypes of Campylobacter jejuni by this kit. Thus, it can be seen that better detection effects can be obtained only by using specific primers in combination in the kit of the present application, and each primer in this kit is irreplaceable.The preferred embodiments of the present invention have been described in detail above. However, the present invention is not limited thereto. Within the scope of the technical concept of the present invention, various simple modifications can be made to the technical solutions of the present invention, including any other suitable combination of each technical feature. These simple modifications and combinations should also be regarded as the content disclosed by the present invention and fall within the protection scope of the present invention.

Claims

1. A composition for nucleic acid detection, characterized in that, The composition comprises at least one of the following primer sets A, B, and C: Primer set A: primers selected from at least one of the target sequences for Salmonella typhi, Salmonella enterica subsp. enterica serovar Typhi, and Salmonella typhimurium, wherein the target sequence for Salmonella typhi is selected from nucleotide sequences having more than 90% identity with SEQ ID NO: 39, the target sequence for Salmonella enterica subsp. enterica serovar Typhi is selected from nucleotide sequences having more than 90% identity with SEQ ID NO: 40, and the target sequence for Salmonella typhimurium is selected from nucleotide sequences having more than 90% identity with SEQ ID NO: 41; Primer set B: primers selected from at least one of the target sequences for Shigella dysenteriae, Shigella flexneri, Shigella boydii, and Shigella sonnei, wherein the target sequence for Shigella dysenteriae is selected from nucleotide sequences having more than 90% identity with SEQ ID NO: 42, the target sequence for Shigella flexneri is selected from nucleotide sequences having more than 90% identity with SEQ ID NO: 43, the target sequence for Shigella boydii is selected from nucleotide sequences having more than 90% identity with SEQ ID NO: 44, and the target sequence for Shigella sonnei is selected from nucleotide sequences having more than 90% identity with SEQ ID NO: 45; Primer set C: primers selected from at least one of the target sequences for Campylobacter jejuni, Campylobacter coli, Campylobacter fetus, and Campylobacter lari, wherein the target sequence for Campylobacter jejuni is selected from nucleotide sequences having more than 90% identity with SEQ ID NO: 46, the target sequence for Campylobacter coli is selected from nucleotide sequences having more than 90% identity with SEQ ID NO: 47, the target sequence for Campylobacter fetus is selected from nucleotide sequences having more than 90% identity with SEQ ID NO: 48, and the target sequence for Campylobacter lari is selected from nucleotide sequences having more than 90% identity with SEQ ID NO:

49.

2. The composition according to claim 1, wherein The target sequence for Salmonella typhi is as shown in SEQ ID NO: 25; and / or, the target sequence for Salmonella enterica subsp. enterica serovar Typhi is as shown in SEQ ID NO: 26; and / or, the target sequence for Salmonella typhimurium is as shown in SEQ ID NO: 27; and / or, the target sequence for Shigella dysenteriae is as shown in SEQ ID NO: 28; and / or, the target sequence for Shigella flexneri is as shown in SEQ ID NO: 29; and / or, the target sequence for Shigella boydii is as shown in SEQ ID NO: 30; and / or, the target sequence for Shigella sonnei is as shown in SEQ ID NO: 31; and / or, the target sequence for Campylobacter jejuni is as shown in SEQ ID NO: 32; and / or, the target sequence for Campylobacter coli is as shown in SEQ ID NO: 33; and / or, the target sequence for Campylobacter fetus is as shown in SEQ ID NO: 34; And / or, the target sequence of Campylobacter jejuni is as shown in SEQ ID NO:

35.

3. The composition according to claim 1, wherein, Primer set A includes at least one pair of primer pairs SEQ ID NO: 1 and SEQ ID NO: 13, primer pairs SEQ ID NO: 2 and SEQ ID NO: 14, and primer pairs SEQ ID NO: 3 and SEQ ID NO: 15; And / or, primer set B includes at least one pair of primer pairs SEQ ID NO: 5 and SEQ ID NO: 17, primer pairs SEQ ID NO: 6 and SEQ ID NO: 18, primer pairs SEQ ID NO: 7 and SEQ ID NO: 19, and primer pairs SEQ ID NO: 8 and SEQ ID NO: 20; And / or, primer set C includes at least one pair of primer pairs SEQ ID NO: 9 and SEQ ID NO: 21, primer pairs SEQ ID NO: 10 and SEQ ID NO: 22, primer pairs SEQ ID NO: 11 and SEQ ID NO: 23, and primer pairs SEQ ID NO: 12 and SEQ ID NO:

24.

4. The composition according to any one of claims 1-3, wherein, The composition further includes primer D for an internal reference gene, and the internal reference gene is selected from nucleotide sequences having more than 90% identity with SEQ ID NO: 50; Preferably, primer D includes the primer pair SEQ ID NO: 4 and SEQ ID NO:

16.

5. The composition according to any one of claims 1-4, wherein, The primers in the composition are modified with a labeling group, preferably a fluorescent labeling group; Preferably, different fluorescent labeling groups are modified on the primers for different target sequences.

6. A kit, characterized in that, The kit contains the composition according to any one of claims 1-5.

7. The kit according to claim 6, wherein, The kit further contains at least one of a buffer, an enzyme, and deoxynucleoside triphosphate; Preferably, the buffer includes a tris(hydroxymethyl)aminomethane hydrochloride buffer; Preferably, the enzyme includes at least one of UNG enzyme and DNA polymerase; More preferably, the kit further includes a positive control reagent and / or a negative control reagent.

8. Use of the composition according to any one of claims 1-5, or the kit according to claim 6 or 7 in the detection of intestinal pathogens.

9. A method for detecting intestinal pathogens in a sample, characterized in that, The method includes subjecting a sample to be tested to in vitro nucleic acid amplification using the composition according to any one of claims 1-5 or the kit according to claim 6 or 7.

10. The method according to claim 9, wherein, The method further includes a step of melting curve analysis.