Chloroplast gene rbcL bar code sequence primer composition, identification kit and application

Abstract

The invention discloses a chloroplast gene rbcL bar code sequence primer composition, an identification kit and application, the primer composition contains at least one pair of primers derived from a nucleotide sequence as shown in SEQ ID NO: 1 and / or SEQ ID NO: 2, and can be used for identifying or distinguishing the variety of a to-be-detected lycopodiaceae plant; the identification method is simple and reliable, is not easily influenced by sample characters, is high in objectivity, does not depend on subjective judgment, is compatible with various instruments and reaction systems, and is suitable for identifying the medicinal material lycopodium clavatum.

Description

Technical Field

[0001] The present invention relates to plant barcode sequences, and in particular to a primer composition of chloroplast gene rbcL barcode sequences, an identification kit and applications for identifying plants of the Lycopodiaceae family. Background Art

[0002] Herba Lycopodii, a traditional Chinese medicine, is the dried whole herb of Lycopodium japonicum Thunb. of the Lycopodiaceae family and is one of the commonly used traditional Chinese medicinal materials in clinical practice. It is warm in nature, bitter and pungent in taste, and has the effects of dispelling wind and dampness, and relaxing tendons and activating collaterals. It is mainly used to treat symptoms such as joint soreness and limited flexion and extension. As an important part of traditional Chinese medicine, Herba Lycopodii is widely used in the traditional Chinese medicine system and diet therapy, and its bioactive components have attracted much attention in the medical field. However, with the growth of market demand, there are frequent phenomena of mixing counterfeit products in the circulation of medicinal materials. Among them, Palhinhaea cernua (L.) Vasc. & Franco has become the main counterfeit product due to its similar morphology, seriously threatening the safety and efficacy of medication.

[0003] Currently, the identification of Herba Lycopodii and its counterfeits mainly relies on traditional methods. Morphological identification is carried out by observing the morphological characteristics of medicinal materials. For example, Zhang Bo et al. distinguished the genuine product from Palhinhaea cernua by the morphological differences between the erect and drooping stems and branches; microscopic identification analyzes the microscopic structural characteristics with the aid of a microscope. For example, the team led by Zhu Jianhua established an identification system by combining ultraviolet spectra and microscopic characteristics. However, these methods have significant limitations: morphological identification relies on intact medicinal materials and becomes invalid once the medicinal materials are processed into decoction pieces or powders; although microscopic identification can analyze fragmented samples, it is complex and time-consuming to operate, and has limited ability to distinguish subtle structural differences, and is easily affected by subjective experience, making it difficult to meet the needs of large-scale detection.

[0004] In this context, DNA barcode technology has gradually become an innovative means for identifying traditional Chinese medicine varieties with its standardization, high efficiency and accuracy. By analyzing species-specific DNA fragments, this technology can quickly distinguish closely related species at the molecular level. The reliability of DNA barcode technology has been verified in scenarios such as the identification of raw materials for artemisinin, providing a scientific guarantee for the quality control and international promotion of traditional Chinese medicine. With the popularization of molecular biology techniques, DNA barcode is expected to become a key technical support for combating adulteration of traditional Chinese medicine and ensuring the sustainable development of the traditional medicine system. Summary of the Invention

[0005] Object of the Invention: The object of the present invention is to provide a primer composition of chloroplast gene rbcL barcode sequences that can be used for identifying plants of the Lycopodiaceae family; the second object is to provide an identification kit and applications for identifying plants of the Lycopodiaceae family.

[0006] Technical solution: The primer composition of the chloroplast gene rbcL barcode sequence of the present invention contains at least one pair of primers derived from the nucleotide sequences shown in SEQ ID NO: 1 and / or SEQ ID NO: 2.

[0007] Preferably, the primer composition includes:

[0008] Primer pair A: an upstream primer having the nucleotide sequence shown in SEQ ID NO: 3 and a downstream primer having the nucleotide sequence shown in SEQ ID NO: 4,

[0009] and / or primer pair B: an upstream primer having the nucleotide sequence shown in SEQ ID NO: 5 and a downstream primer having the nucleotide sequence shown in SEQ ID NO: 6,

[0010] wherein, when the primer composition contains only primer pair A or B, or contains both primer pair A and B, the amounts of the various primers contained are the same.

[0011] The identification kit of the present invention contains the primer composition of the chloroplast gene rbcL barcode sequence as described in claim 1 or 2.

[0012] Application of the primer composition of the chloroplast gene rbcL barcode sequence or the identification kit of the present invention in identifying Lycopodiaceae plants.

[0013] Preferably, the Lycopodiaceae plants include: Lycopodium japonicum Thunb. of the genus Lycopodium and Palhinhaea cernua (L.) Vasc. of the genus Palhinhaea.

[0014] Preferably, the steps of the application include:

[0015] (1) Extract genomic DNA from the sample to be tested;

[0016] (2) Perform PCR amplification using the aforementioned primer composition of the chloroplast gene rbcL barcode sequence or the identification kit;

[0017] (3) Analyze the PCR product to determine the sample variety.

[0018] Preferably, the primer composition or the identification kit in step 2 contains: an upstream primer having the nucleotide sequences shown in SEQ ID NO: 3 and 5, and a downstream primer having the nucleotide sequences shown in SEQ ID NO: 4 and 6.

[0019] Preferably, the PCR amplification in step 2 includes single PCR or multiplex PCR.

[0020] Preferably, for the PCR amplification described in step 2, an enhanced blue high-fidelity Taq enzyme or rTaq DNA polymerase or TaqHS DNA polymerase reaction system is used, and the amount of sample template DNA used is 3 - 100 ng.

[0021] Preferably, the annealing temperature for the PCR amplification described in step 2 is 54 - 58 °C, and the number of cycles is 29 - 39 times.

[0022] Preferably, the method for analyzing the PCR product described in step 3 is agarose gel electrophoresis.

[0023] Preferably, when analyzing the PCR product by agarose gel electrophoresis,

[0024] if a 131 bp band appears, the sample to be tested is Lycopodium clavatum L. of the genus Lycopodium;

[0025] if a 201 bp band appears, the sample to be tested is Palhinhaea cernua (L.) Vasc. of the genus Palhinhaea;

[0026] if both a 131 bp band and a 201 bp band appear simultaneously, the sample to be tested is a mixed product of Lycopodium clavatum L. of the genus Lycopodium and Palhinhaea cernua (L.) Vasc. of the genus Palhinhaea.

[0027] Beneficial effects: Compared with the prior art, the present invention has the following remarkable advantages: 1. The primer composition of the chloroplast gene rbcL barcode sequence can effectively identify or distinguish the varieties of the Lycopodiaceae plants to be tested; 2. The identification method is simple and reliable, not easily affected by the sample traits, objective, does not rely on subjective judgment, is compatible with a variety of instruments and reaction systems, and is suitable for the identification of the medicinal material Herba Lycopodii. Description of the Drawings

[0028] Figure 1 It is a detection result diagram of agarose gel electrophoresis for single PCR detection at different annealing temperatures;

[0029] Figure 2 It is a detection result diagram of agarose gel electrophoresis for multiplex PCR detection with different polymerase systems;

[0030] Figure 3 It is a detection result diagram of agarose gel electrophoresis for multiplex PCR detection with different cycle numbers;

[0031] Figure 4 It is a detection result diagram of agarose gel electrophoresis for multiplex PCR detection with different template amounts;

[0032] Figure 5 It is a detection result diagram of agarose gel electrophoresis for multiplex PCR detection with different PCR instruments;

[0033] Figure 6 It is a detection result diagram of agarose gel electrophoresis for multiplex PCR detection of all samples under the optimal conditions;

[0034] Figure 7 The figure shows the results of agarose gel electrophoresis for multiplex PCR detection of samples of Lycopodium japonicum Thunb. and Palhinhaea cernua (L.) Vasc. & Franco with different mixing ratios under optimal conditions. Specific Embodiments

[0035] The technical solution of the present invention will be further described below.

[0036] Example 1: Design and Synthesis of Primer Combinations for Chloroplast Gene rbcL Barcode Sequences

[0037] 1. Based on the chloroplast gene rbcL gene fragment of Lycopodium japonicum Thunb. with the nucleotide sequence shown in SEQ ID NO: 1, and the chloroplast gene rbcL gene fragment of Palhinhaea cernua (L.) Vasc. & Franco with the nucleotide sequence shown in SEQ ID NO: 2, the primers shown in Table 1 below were designed.

[0038] Table 1 Primer Information

[0039]

[0040] Among them, the product sequence amplified by the specific primer pair of Lycopodium japonicum Thunb. is shown in SEQ ID NO: 7, with a length of 131 bp, which is: GGTAAACTTGAAGGAGAACGTGATGTAACTTTAGGTTTTGTTGATC TACTTCGTGATGATTATATAGAGAAGGACCGAAGCCGTGGTATTTATTTTACTCAAG ATTGGGTATCTATGCCTGGTGTGTTGCC;

[0041] The product sequence amplified by the specific primer pair of Palhinhaea cernua (L.) Vasc. & Franco is shown in SEQ ID NO: 8, with a length of 201 bp, which is: GGACCGATGGACTTACAAGTCTCGACCGTTACAAAGGTCGATGTTATGATATTGAACCTGTTGCTGGAGAAAAAGATCAATATATTGCTTATGTAGCTTATCCTCTGGATTTATTTGAGGAAGGTTCTGTTACTAATTTGTTTACCTCCATTGTAGGTAATGTATTTGGATTCAAAGCCTTGCGAGCCTTACGTTTGGAAG.

[0042] 2. The foregoing primers were synthesized by Shanghai Sangon Biotech Co., Ltd. to obtain a primer combination for chloroplast gene rbcL barcode sequences.

[0043] Example 2: Sample Acquisition and Genomic DNA Preparation of Lycopodiaceae Plants

[0044] 1. Samples were purchased from the national market. Among them, Lycopodium clavatum (Lycopodium) all met the requirements of the 2020 edition of the Chinese Pharmacopoeia. After total DNA was extracted from Palhinhaea cernua, it was sent to Shanghai Sangon Biotech Co., Ltd. for sequencing. The obtained results were compared with the sequences shown in NCBI Taxonomy ID73621. After being determined as Palhinhaea cernua, it was used as a sample. The medicinal material information is shown in Table 2. Figure 6 The mixing ratio in it is Lycopodium clavatum: Palhinhaea cernua mass ratio of 199:1.

[0045] Table 2 Sample Information

[0046]

[0047]

[0048] 2. The surfaces of the samples in Table 2 were wiped with 75% ethanol and irradiated under ultraviolet light for 30 minutes for sterilization, and then DNA was extracted using a plant genomic DNA extraction kit.

[0049] Example 3: Chloroplast Gene rbcL Barcode Sequence Primer Composition for Identifying Lycopodiaceae Plants

[0050] 1. Selection of Single-PCR Annealing Temperature

[0051] 2×M5 HiPer plus Taq HiFi PCR mix (with blue dye) was selected as the polymerase for annealing temperature investigation. Using an ABI VERITI96 PCR instrument, the PCR reaction system is shown in Table 3 below, and the PCR reaction program is shown in Table 4 below. The Lycopodium clavatum (Lycopodium) and Palhinhaea cernua samples obtained in Example 2 were detected. Numbers 1, 2, and 3 were Lycopodium clavatum (Lycopodium) SJC01, SJC02, and SJC03 respectively, and 4 and 5 were Palhinhaea cernua CSSS01 and CSSS02 respectively. N was sterile water, and M was 2000bp plus DNA Marker.

[0052] Table 3 Single-PCR Reaction System

[0053] Composition Volume 2×M5 HiPer plus Taq HiFi PCR mix 12.5 μL 10 μM Forward Primer 0.25 μL 10 μM Reverse Primer 0.25 μL DNA Template 30 ng <![CDATA[ddH2O]]> Make up to 25 μL

[0054] Among them, for the Lycopodium clavatum (Lycopodium) samples SJC01, SJC02, and SJC03, the Lycopodium clavatum (Lycopodium)-specific primer pair was used; for the Palhinhaea cernua samples CSSS01 and CSSS02, the Palhinhaea cernua-specific primer pair was used; for the sterile water sample, both primer pairs were used simultaneously.

[0055] Table 4 Single - PCR Reaction Conditions

[0056]

[0057]

[0058] The results are as Figure 1 shown. Specific bands can be amplified at the 131 - bp position for *Lycopodium clavatum* and at the 201 - bp position for *Lycopodiastrum cernuum* when the annealing temperature is 54, 56, or 58 °C, which can be used as the annealing temperature for the single - PCR reaction.

[0059] 2. Determination of Multiplex - PCR Reaction Conditions

[0060] 2.1 Screening of Multiplex - PCR Reaction Systems

[0061] ExTaq DNA Polymerase, 2×M5 HiPer plus Taq HiFi PCR mix (with blue dye), rTaq DNA Polymerase, and Taq HS DNA Polymerase were respectively selected as polymerases for the investigation of multiplex - PCR polymerases.

[0062] Using the ABI VERITI 96 PCR instrument, the PCR reaction system is shown in Table 3 - 6 below, and the PCR reaction program is shown in Table 7 below. The samples of *Lycopodium clavatum* and *Lycopodiastrum cernuum* obtained in Example 2 were detected. Numbers 1, 2, and 3 are respectively *Lycopodium clavatum* SJC01, SJC02, and SJC03, and 4 and 5 are respectively *Lycopodiastrum cernuum* CSSS01 and CSSS02. N is sterile water, and M is 2000bp plus DNA Marker.

[0063] Table 3 Reaction System of ExTaq DNA Polymerase

[0064] Composition Volume 10×ExTaq Buffer 2.5 μL ExTaq DNA Polymerase 0.2 μL 2.5 mM dNTPs 1.5 μL 10 μM Forward Primer 0.25 μL 10 μM Reverse Primer 0.25 μL DNA Template 30 ng <![CDATA[ddH2O]]> Make up to 25 μL

[0065] Table 4 Reaction System of 2×M5 HiPer plus Taq HiFi PCR mix

[0066]

[0067]

[0068] Table 5 Reaction System of rTaq DNA Polymerase

[0069] Composition Volume 10×Taq Taq Buffer 2.5 μL rTaq DNA Polymerase 0.2 μL 2.5 mM dNTPs 1.5 μL 10 μM Forward Primer 0.25 μL 10 μM Reverse Primer 0.25 μL DNA Template 30 ng <![CDATA[ddH2O]]> Make up to 25 μL

[0070] Table 6 Reaction system of Taq HS DNA Polymerase

[0071] Composition Volume 10×Taq Taq Buffer 2.5 μL Taq HSDNA Polymerase 0.2 μL 2.5 mM dNTPs 1.5 μL 10 μM Forward Primer 0.25 μL 10 μM Reverse Primer 0.25 μL DNA Template 30 ng <![CDATA[ddH2O]]> Make up to 25 μL

[0072] Among them, all detections were performed using the two primer pairs obtained in Example 1.

[0073] Table 7 Multiplex PCR reaction conditions

[0074]

[0075] The results are as Figure 2 shown. In the multiplex PCR reaction, the bands of the Lycopodium clavatum (Lycopodium japonicum) samples amplified by the 2×M5 HiPer plus Taq HiFi PCR mix (with blue dye) system were all darker; the ExTaq DNA Polymerase system could not amplify the bands of the Lycopodium clavatum (Lycopodium japonicum) SJC01 sample; the rTaq DNA polymerase and Taq HS DNA polymerase systems could amplify accurate bands of all samples and were suitable for multiplex PCR reactions.

[0076] 2.2 Screening of the number of cycles in multiplex PCR reactions

[0077] The rTaq DNA Polymerase system was selected for screening the number of cycles in multiplex PCR reactions.

[0078] Using the ABI VERITI 96 PCR instrument, the PCR reaction system was as shown in Table 5, and the PCR reaction program was as shown in Table 8 below. The Lycopodium clavatum (Lycopodium japonicum) and Palhinhaea cernua samples obtained in Example 2 were detected. Numbers 1, 2, and 3 were Lycopodium clavatum (Lycopodium japonicum) SJC01, SJC02, and SJC03 respectively, 4 and 5 were Palhinhaea cernua CSSS01 and CSSS02 respectively, N was sterile water, and M was 2000bp plus DNA Marker.

[0079] Table 8 Screening conditions for the number of cycles in multiplex PCR

[0080]

[0081] The results are as Figure 3 shown. When the number of cycles was 29 and 32, the bands were darker. When the number of cycles was 35 and 39, specific bands were amplified at the corresponding positions for both Lycopodium clavatum (Lycopodium japonicum) and Palhinhaea cernua. Therefore, 35 or 39 cycles were selected as the optimal number of cycles.

[0082] 2.3 Determination of the amount of DNA template in multiplex PCR reactions

[0083] The rTaq DNA Polymerase system was selected to screen the amount of DNA template for multiplex PCR reaction.

[0084] Using the ABI VERITI 96 PCR instrument, the PCR reaction system is shown in Table 9, and the PCR reaction program is shown in Table 7. The samples of Lycopodium clavatum (Lycopodium japonicum) and Palhinhaea cernua obtained in Example 2 were detected. Numbers 1, 2, and 3 are Lycopodium clavatum (Lycopodium japonicum) SJC01, SJC02, and SJC03 respectively, 4 and 5 are Palhinhaea cernua CSSS01 and CSSS02 respectively, N is sterile water, and M is 2000bp plus DNA Marker.

[0085] Table 9 Screening conditions for the amount of DNA template in multiplex PCR reaction

[0086]

[0087]

[0088] The results are as Figure 4 shown. When the DNA template concentration is 3, 10, 30, 100 ng / μL, specific bands are amplified at the corresponding positions for all samples. Therefore, when amplifying, it is recommended that the template amount be 3 - 100 ng.

[0089] 2.4. Evaluation of the applicability of the PCR instrument

[0090] The rTaq DNA Polymerase system was selected to evaluate the applicability of the PCR instrument.

[0091] The PCR reaction system is shown in Table 5, and the PCR reaction program is shown in Table 7. The samples of Lycopodium clavatum (Lycopodium japonicum) and Palhinhaea cernua obtained in Example 2 were detected. Numbers 1, 2, and 3 are Lycopodium clavatum (Lycopodium japonicum) SJC01, SJC02, and SJC03 respectively, 4 and 5 are Palhinhaea cernua CSSS01 and CSSS02 respectively, N is sterile water, and M is 2000bp plus DNA Marker. Multiplex PCR reactions were performed using the ABI VERITI 96 PCR instrument or the BIO - RAD T100 PCR instrument respectively.

[0092] The results are as Figure 5 shown. Specific bands can be amplified at the corresponding positions for all samples, indicating good PCR instrument compatibility of this primer composition for the chloroplast gene rbcL barcode sequence.

[0093] 2.5. Evaluation of the applicability of multiplex PCR

[0094] The rTaq DNA Polymerase system was selected to screen the amount of DNA template for multiplex PCR reaction.

[0095] Using an ABI VERITI 96 PCR instrument, the PCR reaction system is shown in Table 5, and the PCR reaction program is shown in Table 7. The samples of Lycopodium clavatum (Lycopodium japonicum Thunb.) and Palhinhaea cernua (L.) Vasc. obtained in Example 2 were detected. Numbers 1-6 correspond to Lycopodium clavatum (Lycopodium japonicum Thunb.) SJC01-SJC06 in Table 1, 16-18 correspond to Lycopodium clavatum (Lycopodium japonicum Thunb.) SJC07-SJC09 in Table 1, 7-10 correspond to the mixed samples HY01-HY04 in Table 1, 11-15 correspond to Palhinhaea cernua (L.) Vasc. CSSS01-CSSS05 in Table 1, 19-25 correspond to Palhinhaea cernua (L.) Vasc. CSSS06-CSSS012 in Table 1, N is sterile water, and M is 2000bp plus DNA Marker.

[0096] The results are as Figure 6 shown. Specific bands were amplified at 131bp for Lycopodium clavatum (Lycopodium japonicum Thunb.) and at 201bp for Palhinhaea cernua (L.) Vasc. Bands were present at the corresponding 131bp and 201bp in the mixed samples of Lycopodium clavatum (Lycopodium japonicum Thunb.) and Palhinhaea cernua (L.) Vasc.

[0097] Meanwhile, an adaptability investigation of the mixing ratio was carried out. The PCR reaction system is shown in Table 5, and the PCR reaction program is shown in Table 7. The samples of Lycopodium clavatum (Lycopodium japonicum Thunb.) and Palhinhaea cernua (L.) Vasc. obtained in Example 2 were detected. The results are as Figure 7 shown. Numbers 26-34 are all Lycopodium clavatum (SJC01): Palhinhaea cernua (CSSS01), and the mass ratios are respectively: 1:399, 1:199, 1:39, 1:9, 1:1, 9:1, 39:1, 199:1, 399:1; Numbers 35-43 are all Lycopodium clavatum (SJC06): Palhinhaea cernua (CSSS055), and the mass ratios are respectively: 1:399, 1:199, 1:39, 1:9, 1:1, 9:1, 39:1, 199:1, 399:1.

[0098] The results are as Figure 7 shown. In all the mixed samples, bands were present at the corresponding 131bp and 201bp in the mixed samples of Lycopodium clavatum (Lycopodium japonicum Thunb.) and Palhinhaea cernua (L.) Vasc.

Claims

1. A primer composition for chloroplast gene rbcL barcode sequence, characterized in that, The primer composition contains at least one pair of primers derived from the nucleotide sequences shown in SEQ ID NO: 1 and / or SEQ ID NO:

2.

2. The primer composition of the chloroplast gene rbcL barcode sequence according to claim 1, wherein The primer composition includes: Primer pair A: an upstream primer having the nucleotide sequence shown in SEQ ID NO: 3 and a downstream primer having the nucleotide sequence shown in SEQ ID NO: 4, and / or primer pair B: an upstream primer having the nucleotide sequence shown in SEQ ID NO: 5 and a downstream primer having the nucleotide sequence shown in SEQ ID NO:

6.

3. An identification kit, characterized in that, The identification kit contains the primer composition of the chloroplast gene rbcL barcode sequence as described in claim 1 or 2.

4. Use of the primer composition of the chloroplast gene rbcL barcode sequence as described in claim 1 or the identification kit as described in claim 4 in identifying Lycopodiaceae plants.

5. The application according to claim 4, wherein The Lycopodiaceae plants include: Lycopodium japonicum Thunb. of the genus Lycopodium and Palhinhaea cernua (L.) Vasc. of the genus Palhinhaea.

6. The application according to claim 4, characterized in that The steps of the use include: (1) Extract genomic DNA from the sample to be tested; (2) Perform PCR amplification using the aforementioned primer composition of the chloroplast gene rbcL barcode sequence or the identification kit; (3) Analyze the PCR product to determine the variety of the sample.

7. The application according to claim 6, wherein The primer composition or the identification kit described in step 2 contains: an upstream primer having the nucleotide sequences shown in SEQ ID NO: 3 and 5, and a downstream primer having the nucleotide sequences shown in SEQ ID NO: 4 and 6.

8. The application according to claim 7, wherein The PCR amplification described in step 2 includes single PCR or multiplex PCR.

9. The application according to claim 7 or 8, characterized in that, The method for analyzing the PCR product described in step 3 is agarose gel electrophoresis.

10. The application according to claim 9, wherein When analyzing the PCR product by agarose gel electrophoresis, if a 131 bp band appears, the sample to be tested is Lycopodium japonicum Thunb.; if a 201 bp band appears, the sample to be tested is Palhinhaea cernua (L.) Vasc.; if both a 131 bp band and a 201 bp band appear, the sample to be tested is a mixture of Lycopodium japonicum Thunb. and Palhinhaea cernua (L.) Vasc.

Images