Transgenic soybean event LP207-1 and detection method thereof

Abstract

The invention belongs to the field of molecular biology, and particularly relates to a transgenic soybean event LP207-1 and a detection method thereof. The invention provides a nucleic acid sequence for detecting a transgenic soybean event LP207-1, the nucleic acid sequence is selected from one or more of sequences SEQ ID NO: 1-7 or complementary sequences thereof, and the nucleic acid sequence is derived from a plant, a seed or a cell of the transgenic soybean event LP207-1. A representative sample of a seed of the transgenic soybean event LP207-1 is preserved in the China Center for Type Culture Collection on May 23, 2025, and the preservation number is CCTCC NO: P202516. The transgenic soybean event LP207-1 has good resistance to lepidoptera pests and can tolerate agricultural herbicides containing glyphosate and glufosinate-ammonium, economic loss caused by the lepidoptera pests can be avoided, and the yield is not reduced; and the breeding efficiency is enhanced, and the molecular marker can be used for tracking a breeding population and transgenic insertion fragments in offspring of the breeding population. The detection method provided by the invention can quickly, accurately and stably identify the existence of the plant material derived from the transgenic soybean event LP207-1.

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular biology, and particularly relates to a transgenic soybean event LP207-1, and a nucleic acid sequence and method for detecting transgenic soybean LP207-1. Background Art

[0002] Soybean ( Glycine max (Linn.) Merr.) is an important food crop and oil crop in many regions of the world. Biotechnology has been applied to soybeans to improve their agronomic traits and quality. Insect resistance is an important agronomic trait in soybean production, especially resistance to Lepidoptera insects (such as Leguminivora glycinivorella, Spodoptera frugiperda, Spodoptera exigua, Prodenia litura, Helicoverpa armigera, etc.). The resistance of soybeans to Lepidoptera insects can be obtained by transgenic methods to express the resistance genes of Lepidoptera insects in soybean plants. Another important agronomic trait is herbicide tolerance, especially tolerance to glyphosate herbicide. The tolerance of soybeans to glyphosate and glufosinate herbicides can be obtained by transgenic methods to express the glyphosate herbicide tolerance gene (such as epsps ) and the glufosinate herbicide tolerance gene (such as pat ) in soybean plants.

[0003] In addition to functional genes ( epsps gene and patThe gene itself, the selection of regulatory elements and their sequential arrangement are crucial for obtaining good transformation events, and their technical effects are difficult to predict. Additionally, it is known that the expression of foreign genes in plants is affected by their insertion positions in the soybean genome, possibly due to the proximity of chromatin structures (such as heterochromatin) or transcriptional regulatory elements (such as enhancers) to the integration site. For this reason, it is usually necessary to screen a large number of events to potentially identify events that can be commercialized (i.e., events in which the introduced target gene is optimally expressed). For example, it has been observed in plants and other organisms that the expression levels of introduced genes can vary greatly among events; there may also be differences in the spatial or temporal patterns of expression, such as differences in the relative expression of transgenes between different plant tissues, and this difference is manifested in that the actual expression pattern may not be consistent with the expression pattern expected by the transcriptional regulatory elements in the introduced gene construct. Therefore, it is usually necessary to generate hundreds or thousands of different events and screen out a single event with the expected transgene expression level and expression pattern for commercial purposes from these events. Such transformation events have excellent resistance to Lepidoptera pests (such as soybean pod borer, Spodoptera frugiperda, Spodoptera exigua, Spodoptera litura, Helicoverpa armigera, etc.) and glyphosate herbicides and do not affect soybean yield, and the transgenic traits can be introgressed into other genetic backgrounds through hybridization using conventional breeding methods. The offspring generated by this hybridization method maintain the transgenic expression characteristics and trait performances of the original transformant. Applying this strategic model can ensure reliable gene expression in many varieties, with stable resistance to Lepidoptera pests (such as soybean pod borer, Spodoptera frugiperda, Spodoptera exigua, Spodoptera litura, Helicoverpa armigera, etc.) and glyphosate herbicides, protecting these varieties from major Lepidoptera pests and having a broad-spectrum weed control ability, while being well adapted to local growth conditions.

[0004] It would be beneficial to be able to detect the presence of a specific event to determine whether the offspring of a sexual cross contain the gene of interest. Additionally, methods for detecting specific events would also assist in complying with relevant regulations, such as the need for formal approval and labeling of foods derived from recombinant crops before they are put on the market. It is possible to detect the presence of transgenes by any well-known polynucleotide detection method, such as polymerase chain reaction (PCR) or DNA hybridization using polynucleotide probes. These detection methods typically focus on commonly used genetic elements, such as promoters, terminators, marker genes, etc. Therefore, unless the sequence of the chromosomal DNA ("flanking DNA") adjacent to the inserted transgenic DNA is known, the above methods cannot be used to distinguish different events, especially those generated with the same DNA construct. So, currently, a pair of primers spanning the junction of the inserted T-DNA and flanking DNA is often used by PCR to identify specific transgenic events, specifically the first primer contained in the flanking sequence and the second primer contained in the inserted sequence.

[0005] In modern agricultural production, soybeans are important cash crops, and weed control and pest resistance during their cultivation have always been key issues. Currently, significant progress has been made in the technical development of genetically modified herbicide-tolerant soybeans. Mainly through gene editing and transgenic technologies, soybeans are endowed with tolerance to specific herbicides or insect-resistant characteristics, thus achieving the dual goals of efficient weed management and crop protection. However, this field still faces challenges such as low conversion rates of some herbicide-tolerant genes in soybeans and unstable traits in offspring, as well as the decline in the effectiveness of traditional herbicides due to enhanced weed resistance, which has prompted the research direction to shift towards the development of new complex traits (such as tolerance to more herbicides) and environmentally friendly products. Moreover, most of the transgenic insect-resistant varieties used in China are single-gene insect-resistant, and there is no research on the combined tandem expression of Cry1Ab and Cry1Fa genes for insect resistance and the simultaneous combination with herbicide-tolerant genes pat and epsps for use. Therefore, there is a need in production for a transgenic crop with combined insect resistance and herbicide tolerance and its cultivation method. Summary of the Invention

[0006] The object of the present invention is to provide a transgenic soybean event LP207-1 and its detection method, which can accurately and rapidly identify whether a biological sample contains the DNA molecule of a specific transgenic soybean event LP207-1.

[0007] To achieve the above object, the present invention provides a nucleic acid sequence for detecting transgenic soybean event LP207-1, which comprises one or more selected from the sequences SEQ ID NO:1-7 (i.e., SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7) or their complementary sequences. In some embodiments, the nucleic acid sequence is derived from a plant, seed or cell containing transgenic soybean event LP207-1. A representative sample of the seeds containing the event was deposited at the China Center for Type Culture Collection (abbreviated as CCTCC, address: No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province, on the campus of Wuhan University, the Preservation Center of Wuhan University, postal code 430072) on May 23, 2025, with the deposit number CCTCC NO:P202516, and the taxonomic name is soybean seed LP207-1 Glycine max L. LP207-1. In some embodiments, the nucleic acid sequence is an amplicon for diagnosing the presence of soybean event LP207-1.

[0008] In some embodiments of the present invention, the present invention provides a nucleic acid sequence comprising at least 11 consecutive nucleotides in SEQ ID NO:3 or its complementary sequence and / or at least 11 consecutive nucleotides in SEQ ID NO:4 or its complementary sequence. In some embodiments, the nucleic acid sequence comprises SEQ ID NO:1 or its complementary sequence and / or SEQ ID NO:2 or its complementary sequence. In some embodiments, the nucleic acid sequence comprises SEQ ID NO:3 or its complementary sequence and / or SEQ ID NO:4 or its complementary sequence. In some embodiments, the nucleic acid sequence comprises SEQ ID NO:5 or its complementary sequence.

[0009] The sequence SEQ ID NO:1 or its complementary sequence is a 20-nucleotide sequence located near the insertion junction at the 5' end of the inserted sequence in the transgenic soybean event LP207-1. The sequence SEQ ID NO:1 or its complementary sequence spans the flanking genomic DNA sequence at the soybean insertion site and the DNA sequence at the 5' end of the inserted sequence. The presence of the transgenic soybean event LP207-1 can be identified by including the sequence SEQ ID NO:1 or its complementary sequence. The sequence SEQ ID NO:2 or its complementary sequence is a 20-nucleotide sequence located near the insertion junction at the 3' end of the inserted sequence in the transgenic soybean event LP207-1. The sequence SEQ ID NO:2 or its complementary sequence spans the DNA sequence at the 3' end of the inserted sequence and the flanking genomic DNA sequence at the soybean insertion site. The presence of the transgenic soybean event LP207-1 can be identified by including the sequence SEQ ID NO:2 or its complementary sequence.

[0010] The nucleic acid sequences provided by the present invention may be at least 11 or more consecutive polynucleotides of any part of the transgene insertion sequence in the sequence SEQ ID NO:3 or its complementary sequence (first nucleic acid sequence), or at least 11 or more consecutive polynucleotides of any part of the 5'-flanking soybean genomic DNA region in the sequence SEQ ID NO:3 or its complementary sequence (second nucleic acid sequence). The nucleic acid sequences may further be a part of the sequence SEQ ID NO:3 that is homologous to or complementary to the sequence SEQ ID NO:1 that includes the complete sequence. When the first nucleic acid sequence and the second nucleic acid sequence are used together, these nucleic acid sequences include a DNA primer pair in a DNA amplification method for generating an amplification product. When the amplification product generated by using the DNA primer pair in the DNA amplification method is an amplification product that includes the sequence SEQ ID NO:1, the presence of the transgenic soybean event LP207-1 or its progeny can be diagnosed. As is well known to those skilled in the art, the first and second nucleic acid sequences do not have to consist solely of DNA, but may also include RNA, a mixture of DNA and RNA, or a combination of DNA, RNA, or other nucleotides or their analogs that do not serve as templates for one or more polymerases. In addition, the probes or primers described in the present invention should be at least approximately 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 consecutive nucleotides in length, and they may be selected from the nucleotides described in the sequences SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, and SEQ ID NO:5. When selected from the nucleotides shown in the sequences SEQ ID NO:3, SEQ ID NO:4, and SEQ ID NO:5, the probes and primers may be from approximately 17 to 50 or more consecutive nucleotides in length. The sequence SEQ ID NO:3 or its complementary sequence is a 1080-nucleotide sequence located near the insertion junction at the 5'-end of the insertion sequence in the transgenic soybean event LP207-1. The sequence SEQ ID NO:3 or its complementary sequence consists of a 514-nucleotide soybean flanking genomic DNA sequence (nucleotides 1-514 of the sequence SEQ ID NO:3), a 380-nucleotide pLP207 construct DNA sequence (nucleotides 515-894 of the sequence SEQ ID NO:3), and a 3'-end DNA sequence of the pAtUbi10 promoter of 186 nucleotides (nucleotides 895-1080 of the sequence SEQ ID NO:3). The presence of the transgenic soybean event LP207-1 can be identified by including the sequence SEQ ID NO:3 or its complementary sequence.

[0011] The nucleic acid sequence can be at least 11 or more consecutive polynucleotides (third nucleic acid sequence) of any part of the transgenic insertion sequence in the sequence SEQ ID NO:4 or its complementary sequence, or at least 11 or more consecutive nucleotides (fourth nucleic acid sequence) of any part of the 3'-flanking soybean genomic DNA region in the sequence SEQ ID NO:4 or its complementary sequence. The nucleic acid sequence can further be a part of the sequence SEQ ID NO:4 that is homologous to or complementary to the sequence SEQ ID NO:2 containing the complete sequence. When the third nucleic acid sequence and the fourth nucleic acid sequence are used together, these nucleic acid sequences in a DNA amplification method for generating an amplification product include a DNA primer pair. When the amplification product generated by using the DNA primer pair in the DNA amplification method is an amplification product including the sequence SEQ ID NO:2, the presence of the transgenic soybean event LP207-1 or its progeny can be diagnosed. The sequence SEQ ID NO:4 or its complementary sequence is a sequence of 1060 nucleotides located near the insertion junction at the 3'-end of the insertion sequence in the transgenic soybean event LP207-1. The sequence SEQ ID NO:4 or its complementary sequence consists of a 402-nucleotide partial sequence of the tPsE9 terminator (nucleotides 1-402 of the sequence SEQ ID NO:4), a 210-nucleotide DNA sequence of the pLP207 construct (nucleotides 403-612 of the sequence SEQ ID NO:4), and a 448-nucleotide genomic DNA sequence flanking the soybean integration site (nucleotides 613-1060 of the sequence SEQ ID NO:4). The presence of the transgenic soybean event LP207-1 can be identified by including the sequence SEQ ID NO:4 or its complementary sequence.

[0012] The sequence SEQ ID NO:5 or its complementary sequence is a sequence of 14370 nucleotides characterizing the transgenic soybean event LP207-1, and the specific genomic and genetic elements it contains are shown in Table 1. The presence of the transgenic soybean event LP207-1 can be identified by including the sequence SEQ ID NO:5 or its complementary sequence.

[0013] Table 1. Genomic and genetic elements contained in the sequence SEQ ID NO:5 Genetic element Length Position on sequence SEQ ID NO:5 5’ genome 514bp 1-514 RB region 380bp 515-894 pAtUbi10 1322bp 895-2216 Cry1Fa 1818bp 2225-4042 tNos 253bp 4057-4309 p35s 530bp 4310-4839 PAT 552bp 4840-5391 t35S 195bp 5392-5586 pAtRbcS4 1723bp 5593-7315 spAtRbcS4 264bp 7318-7581 Cry1Ab 2457bp 7588-10044 tMtPt 400bp 10048-10447 pGm17gTsf1 999bp 10458-11456 spAtCTP2 (AtCTP2) 228bp 11458-11685 EPSPS 1368bp 11686-13053 tPse9 643bp 13070-13712 LB region 210bp 13713-13922 3’ genome 448bp 13923-14370

[0014] The nucleic acid sequence or its complementary sequence can be used in a DNA amplification method to generate an amplification product, and the presence of the transgenic soybean event LP207-1 or its progeny in a biological sample can be diagnosed by detecting the amplification product; the nucleic acid sequence or its complementary sequence can be used in a nucleotide detection method to detect the presence of the transgenic soybean event LP207-1 or its progeny in a biological sample.

[0015] The present invention provides a DNA primer pair, comprising a first primer and a second primer, wherein each of the first primer and the second primer comprises a fragment of SEQ ID NO:5 or its complementary sequence, and when the first primer and the second primer are used together with DNA containing soybean event LP207-1 in an amplification reaction, an amplification product for detecting soybean event LP207-1 in a test sample is generated.

[0016] In some embodiments, the first primer is selected from SEQ ID NO:1 or its complementary sequence, SEQ ID NO:8 or SEQ ID NO:10; the second primer is selected from SEQ ID NO:2 or its complementary sequence, SEQ ID NO:11 or SEQ ID NO:14.

[0017] In some embodiments of the present invention, the amplification product comprises at least 11 consecutive nucleotides in SEQ ID NO:3 or its complementary sequence, or at least 11 consecutive nucleotides in SEQ ID NO:4 or its complementary sequence.

[0018] Furthermore, the amplification product comprises the 1st - 10th or 11th - 20th consecutive nucleotides in SEQ ID NO:1 or its complementary sequence, or the 1st - 10th or 11th - 20th consecutive nucleotides in SEQ ID NO:2 or its complementary sequence.

[0019] Even further, the amplification product comprises SEQ ID NO:1 or its complementary sequence, SEQ ID NO:2 or its complementary sequence, SEQ ID NO:6 or its complementary sequence, or SEQ ID NO:7 or its complementary sequence.

[0020] In the above technical solution, the primer comprises at least one of the nucleic acid sequences. Specifically, the primer comprises a first primer and a second primer, the first primer is selected from SEQ ID NO:1 or its complementary sequence, SEQ ID NO:8 or SEQ ID NO:12, and the second primer is selected from SEQ ID NO:9 or SEQ ID NO:13; or, the first primer is selected from SEQ ID NO:2 or its complementary sequence, SEQ ID NO:10 or SEQ ID NO:15, and the second primer is selected from SEQ ID NO:11 or SEQ ID NO:14.

[0021] The present invention also provides a DNA probe, which comprises one or more of the sequences SEQ ID NO: 1-7 or their complementary sequences, and the DNA probe hybridizes with a DNA molecule comprising a nucleic acid sequence selected from the sequences SEQ ID NO: 1-7 or their complementary sequences under stringent hybridization conditions and does not hybridize with a DNA molecule that does not contain a nucleic acid sequence selected from the sequences SEQ ID NO: 1-7 or their complementary sequences under stringent hybridization conditions.

[0022] In some embodiments, the DNA probe comprises a sequence selected from the sequence SEQ ID NO: 1 or its complementary sequence, SEQ ID NO: 2 or its complementary sequence, SEQ ID NO: 6 or its complementary sequence, and SEQ ID NO: 7 or its complementary sequence.

[0023] In some embodiments, the DNA probe is labeled with a fluorescent group.

[0024] In some embodiments, the probe comprises at least 11 consecutive nucleotides in the sequence SEQ ID NO: 3 or its complementary sequence, or at least 11 consecutive nucleotides in the sequence SEQ ID NO: 4 or its complementary sequence; further, the probe comprises the 1st-10th or 11th-20th consecutive nucleotides in the sequence SEQ ID NO: 1 or its complementary sequence, or the 1st-10th or 11th-20th consecutive nucleotides in the sequence SEQ ID NO: 2 or its complementary sequence.

[0025] The present invention also provides a labeled nucleic acid molecule, which comprises one or more of the sequences SEQ ID NO: 1-7 or their complementary sequences, and the labeled nucleic acid molecule hybridizes with a DNA molecule comprising a nucleic acid sequence selected from the sequences SEQ ID NO: 1-7 or their complementary sequences under stringent hybridization conditions and does not hybridize with a DNA molecule that does not contain a nucleic acid sequence selected from the sequences SEQ ID NO: 1-7 or their complementary sequences under stringent hybridization conditions.

[0026] In some embodiments, the labeled nucleic acid molecule comprises a sequence selected from the sequence SEQ ID NO: 1 or its complementary sequence, SEQ ID NO: 2 or its complementary sequence, SEQ ID NO: 6 or its complementary sequence, and SEQ ID NO: 7 or its complementary sequence.

[0027] In one embodiment, the labeled nucleic acid molecule comprises at least 11 consecutive nucleotides in the sequence SEQ ID NO: 3 or its complementary sequence, or at least 11 consecutive nucleotides in SEQ ID NO: 4 or its complementary sequence; In some embodiments, the marker nucleic acid molecule comprises consecutive nucleotides at positions 1-10 or 11-20 in SEQ ID NO:1 or its complementary sequence, or consecutive nucleotides at positions 1-10 or 11-20 in SEQ ID NO:2 or its complementary sequence.

[0028] Further, the present invention provides a method for detecting the presence of DNA of transgenic soybean event LP207-1 in a sample, comprising: (1) contacting the sample to be detected with the DNA primer pair in a nucleic acid amplification reaction; (2) performing a nucleic acid amplification reaction; (3) detecting the presence of the amplification product; The amplification product comprises a nucleic acid sequence selected from SEQ ID NO:1-7 or its complementary sequence, indicating the presence of DNA of transgenic soybean event LP207-1 in the detected sample.

[0029] The present invention also provides a method for detecting the presence of DNA of transgenic soybean event LP207-1 in a sample, comprising: (1) contacting the sample to be detected with the DNA probe and / or the marker nucleic acid molecule; (2) hybridizing the sample to be detected with the probe and / or the marker nucleic acid molecule under stringent hybridization conditions; (3) detecting the hybridization of the sample to be detected with the probe and / or the marker nucleic acid molecule.

[0030] The stringent conditions may be hybridization in a solution of 6×SSC (sodium citrate), 0.5% SDS (sodium dodecyl sulfate) at 65°C, followed by washing the membrane once with 2×SSC, 0.1% SDS and once with 1×SSC, 0.1% SDS.

[0031] Among them, detecting the hybridization of the sample to be detected and the marker nucleic acid molecule, and then analyzing by marker-assisted breeding to determine that insect resistance and / or herbicide tolerance are genetically linked to the marker nucleic acid molecule.

[0032] The present invention also provides a DNA detection kit, comprising: a DNA primer pair for generating an amplicon for diagnosing transgenic soybean event LP207-1, a probe specific for SEQ ID NO:1-7 or a marker nucleic acid molecule specific for SEQ ID NO:1-7. Specifically, the detection kit comprises the probe, primer pair or marker nucleic acid molecule of the present invention.

[0033] In some embodiments, the present invention provides a DNA detection kit, comprising at least one DNA molecule, wherein the DNA molecule comprises at least 11 consecutive nucleotides of a homologous sequence of SEQ ID NO:3 or its complementary sequence, or at least 11 consecutive nucleotides of a homologous sequence of SEQ ID NO:4 or its complementary sequence, which can be used as a DNA primer or probe specific for the transgenic soybean event LP207-1 or its progeny.

[0034] Further, the DNA molecule comprises the 1st to 10th or 11th to 20th consecutive nucleotides of SEQ ID NO:1 or its complementary sequence, or the 1st to 10th or 11th to 20th consecutive nucleotides of SEQ ID NO:2 or its complementary sequence.

[0035] Furthermore, the DNA molecule comprises a homologous sequence of SEQ ID NO:1 or its complementary sequence, a homologous sequence of SEQ ID NO:2 or its complementary sequence, a homologous sequence of SEQ ID NO:6 or its complementary sequence, or a homologous sequence of SEQ ID NO:7 or its complementary sequence. To achieve the above object, the present invention also provides a plant cell, comprising a nucleic acid sequence encoding insect-resistant Cry1Ab and Cry1Fa proteins, a nucleic acid sequence encoding glyphosate herbicide-tolerant EPSPS protein, a nucleic acid sequence encoding glufosinate herbicide-tolerant PAT protein, and a nucleic acid sequence of a specific region, wherein the nucleic acid sequence of the specific region comprises SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:6 or SEQ ID NO:7.

[0036] The sequences provided by the present invention include the sequences listed in Table 2 below: Table 2. Sequences related to the present invention Sequence number (SEQ ID NO) Sequence description 1 RB-end cross-junction sequence (including part of the T-DNA RB-end sequence and genomic sequence, 20bp) 2 LB-end cross-junction sequence (including part of the T-DNA LB-end sequence and genomic sequence, 20bp) 3 Nucleotide sequence at the 5’ end of the inserted sequence near the insertion junction site, which is the RB end for T-DNA (including about 500bp of genomic sequence and about 500bp of T-DNA) 4 Nucleotide sequence at the 3’ end of the inserted sequence near the insertion junction site, which is the LB end for T-DNA (including about 500bp of genomic sequence and about 400bp of T-DNA) 5 Full-length T-DNA sequence (including about 500bp of genomic sequence extended from the LB end and about 600bp of genomic sequence extended from the RB end) 6 Sequence within SEQ ID NO:3, LP207 T-DNA sequence 7 Sequence within SEQ ID NO:4, LP207 T-DNA sequence 8 First primer for amplifying SEQ ID NO:3, primer 11 9 Second primer for amplifying SEQ ID NO:3, primer 12 10 First primer for amplifying SEQ ID NO:4, primer 13 11 Second primer for amplifying SEQ ID NO:4, primer 14 12 Primer on the 5’ flanking genome, primer 15 13 Primer on T-DNA paired with sequence 12, primer 16 14 Primer on the 3’ flanking genome, primer 17 15 Primer on T-DNA paired with sequence 14, primer 18 16 Taqman detection Cry1Fa primer 1 17 Taqman detection Cry1Fa primer 2 18 Taqman detection Cry1Fa probe 1 19 Taqman detection Pat primer 3 20 Taqman detection Pat primer 4 21 Taqman detection Pat probe 2 22 Taqman detection Cry1Ab primer 5 23 Taqman detection Cry1Ab primer 6 24 Taqman detection Cry1Ab probe 3 25 Taqman detection EPSPS primer 7 26 Taqman detection EPSPS primer 8 27 Taqman detection EPSPS probe 4 28 First primer 9 for the soybean endogenous gene GM-EF1α 29 The second primer 10 of the endogenous gene GM-EF1α in soybean 30 Probe 5 of Cry1Fa in Southern blot detection 31 Probe 6 of Pat in Southern blot detection 32 Probe 7 of Cry1Ab in Southern blot detection 33 Probe 8 of EPSPS in Southern blot detection 34 Primer 19 located on T-DNA, in the same direction as SEQ ID NO: 13 35 Primer 20 located on T-DNA, in the opposite direction to SEQ ID NO: 13 36 Primer 21 located on T-DNA, in the opposite direction to SEQ ID NO: 13 37 Primer 22 located on T-DNA, in the same direction as SEQ ID NO: 15 38 Primer 23 located on T-DNA, in the opposite direction to SEQ ID NO: 15 39 Primer 24 located on T-DNA, in the opposite direction to SEQ ID NO: 15 The present invention also provides a method for protecting soybean plants from insect infestation, comprising providing at least one transgenic soybean plant cell in the diet of a target insect, wherein the transgenic soybean plant genome sequentially comprises SEQ ID NO:1, the nucleic acid sequence at positions 525-13912 of SEQ ID NO:5, and SEQ ID NO:2; or the transgenic soybean plant genome comprises SEQ ID NO:5; and the target insect feeding on the transgenic soybean plant cell is inhibited from further feeding on the soybean plant.

[0037] The present invention also provides a method for protecting soybean plants from damage caused by herbicides, which comprises growing at least one genetically modified soybean plant, wherein the genome of the genetically modified soybean plant sequentially comprises the sequence of SEQ ID NO:1, the nucleic acid sequence at positions 525-13912 of SEQ ID NO:5 and SEQ ID NO:2; or the genome of the genetically modified soybean plant comprises the sequence of SEQ ID NO:5. The method includes applying an effective dose of glyphosate and / or glufosinate herbicide to a field in which at least one genetically modified soybean plant is grown, and the genetically modified soybean plant is the genetically modified soybean event LP207-1.

[0038] The present invention also provides a method for controlling weeds in a field where soybean plants are grown, which includes applying a herbicide containing an effective dose of glyphosate and / or glufosinate herbicide to a field in which at least one genetically modified soybean plant is grown, wherein the genome of the genetically modified soybean plant sequentially comprises the sequence of SEQ ID NO:1, the nucleic acid sequence at positions 525-13912 of SEQ ID NO:5 and SEQ ID NO:2; or the genome of the genetically modified soybean plant comprises SEQ ID NO:5.

[0039] The present invention also provides a method for cultivating soybean plants resistant to insects, which includes: growing at least one soybean seed, wherein the genome of the soybean seed sequentially comprises the sequence of SEQ ID NO:1, the nucleic acid sequence at positions 525-13912 of SEQ ID NO:5 and SEQ ID NO:2; or the genome of the soybean seed comprises the sequence shown in SEQ ID NO:5; growing the soybean seed into a soybean plant; infesting the soybean plant with a target insect, and harvesting a plant with reduced plant damage compared to other plants that are not the soybean seeds.

[0040] In some embodiments, the present invention provides a method for cultivating soybean plants resistant to insects and tolerant to glyphosate and glufosinate herbicides, which includes: growing at least one soybean seed, wherein the genome of the soybean seed sequentially comprises the sequence of SEQ ID NO:1, the nucleic acid sequence at positions 525-13912 of SEQ ID NO:5 and SEQ ID NO:2; or the genome of the soybean seed comprises the sequence of SEQ ID NO:5; growing the soybean seed into a soybean plant; infesting the soybean plant with a target insect and / or spraying the soybean plant with an effective dose of glyphosate and glufosinate herbicides, and harvesting a plant with reduced plant damage compared to other plants that are not the soybean seeds, and the plant with reduced plant damage is also resistant to feeding damage by insects.

[0041] In some embodiments, the present invention also provides a method for generating a soybean plant resistant to insects, comprising introducing the transgenic soybean event LP207-1 into the genome of the soybean plant and selecting soybean plants with reduced plant damage from insect feeding. In some embodiments, the method comprises: sexually crossing a first parental soybean plant of the transgenic soybean event LP207-1 resistant to insects with a second parental soybean plant lacking insect resistance to produce a large number of progeny plants; infesting the progeny plants with a target insect; and selecting the progeny plants with reduced plant damage compared to other plants not having the transgenic soybean event LP207-1.

[0042] In some embodiments, the present invention also provides a method for generating a soybean plant tolerant to glyphosate and glufosinate herbicides, comprising introducing the transgenic soybean event LP207-1 into the genome of the soybean plant and selecting soybean plants tolerant to glyphosate and glufosinate. In some embodiments, the method comprises: sexually crossing a first parental soybean plant of the transgenic soybean event LP207-1 tolerant to glyphosate and glufosinate herbicides with a second parental soybean plant lacking glyphosate and glufosinate tolerance to produce a large number of progeny plants; treating the progeny plants with glyphosate and glufosinate; and selecting the progeny plants tolerant to glyphosate and glufosinate.

[0043] In some embodiments, the present invention also provides a method for generating a soybean plant resistant to insects and tolerant to the application of glyphosate and glufosinate herbicides, comprising: introducing the transgenic soybean event LP207-1 into the genome of the soybean plant and selecting soybean plants tolerant to glyphosate, glufosinate and having insect resistance. In some embodiments, the method comprises sexually crossing a first parental soybean plant of the transgenic soybean event LP207-1 tolerant to glyphosate, glufosinate and having insect resistance with a second parental soybean plant lacking glyphosate and glufosinate tolerance and / or insect resistance to produce a large number of progeny plants; treating the progeny plants with glyphosate and glufosinate; selecting the progeny plants tolerant to glyphosate and glufosinate, and the progeny plants tolerant to glyphosate and glufosinate are also resistant to insect feeding damage.

[0044] The present invention also provides a processed product derived from the transgenic soybean event LP207-1, and the processed product is soybean flour, soybean oil, soy protein, soy products, dregs, etc. In some embodiments, the processed product can be soybean flour, soybean oil, soy protein, soy products, dregs, feed, or industrial products or commodities. If a sufficient expression level is detected in the processed product, the processed product is expected to contain a nucleic acid sequence capable of diagnosing the presence of the transgenic soybean event LP207-1 material in the composition. Specifically, the processed product includes but is not limited to soybean flour, soybean oil, soy protein, soy products, dregs, and any other food to be used as a food source for animal consumption, or alternatively as a component of soybean oil or stearic acid for food industrial uses, etc.

[0045] The detection method and / or kit based on probes or primer pairs of the present invention can be used to detect the nucleic acid sequence of the transgenic soybean event LP207-1 such as those shown in SEQ ID NO:1 or SEQ ID NO:2 in a biological sample, wherein the probe sequence or primer sequence is selected from the sequences shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, and SEQ ID NO:5 to diagnose the presence of the transgenic soybean event LP207-1.

[0046] In summary, the transgenic soybean event LP207-1 of the present invention has dual traits of insect resistance and herbicide tolerance, and has the following advantages: 1) being free from economic losses caused by Lepidoptera pests (such as the main pests in soybean planting areas, Helicoverpa armigera, Spodoptera frugiperda, Leguminivora glycinivorella, Spodoptera litura, Spodoptera exigua, etc.); 2) the ability to apply agricultural herbicides containing glyphosate and glufosinate to soybean crops for broad-spectrum weed control; 3) no reduction in soybean yield. Specifically, the event LP207-1 of the present invention has a high resistance level to target pests, and can cause a pest mortality rate as high as 100%, protecting plants with a damage rate as low as 0%; it has a high tolerance to glyphosate and glufosinate herbicides, and can safely tolerate 4 times the amount of glyphosate and glufosinate, protecting plants with a damage rate as low as 0%; and the plants containing this event have excellent agronomic traits, and the yield percentage has no significant difference from the control. In addition, the genes encoding insect resistance and glyphosate tolerance traits are linked on the same DNA segment and exist at a single locus in the genome of the transgenic soybean event LP207-1, which improves the breeding efficiency and enables the tracking of transgenic insertion fragments in breeding populations and their progeny using molecular markers. At the same time, the primer or probe sequences provided in the detection method of the present invention can produce amplification products identified as the transgenic soybean event LP207-1 or its offspring, and can quickly, accurately, and stably identify the presence of plant materials derived from the transgenic soybean event LP207-1.

[0047] Term The following definitions and methods can better define the present invention and guide those of ordinary skill in the art to implement the present invention. Unless otherwise specified, terms are understood according to the conventional usage of those of ordinary skill in the art.

[0048] The soybean ( Glycine max ), and includes all plant varieties that can be crossbred with the soybean, including wild soybean species.

[0049] The term "comprising" means "including but not limited to". The term "processed product" refers to the product obtained by processing raw materials such as plants and seeds, such as compositions and the like.

[0050] The term "plant" includes the whole plant, plant cells, plant organs, plant protoplasts, plant cell tissue cultures from which plants can be regenerated, plant callus, plant clumps, and intact plant cells in plants or plant parts. The plant parts include, for example, embryos, pollen, ovules, seeds, leaves, flowers, branches, fruits, stems, roots, root tips, anthers, etc. It should be understood that the parts of transgenic plants within the scope of the present invention include but are not limited to plant cells, protoplasts, tissues, callus, embryos, and flowers, stems, fruits, leaves, and roots, and the above plant parts are derived from transgenic plants or their progeny that have been previously transformed with the DNA molecule of the present invention and thus at least partially consist of transgenic cells.

[0051] The term "gene" refers to a nucleic acid fragment that expresses a specific protein, including the regulatory sequence (5' non-coding sequence) before the coding sequence and the regulatory sequence (3' non-coding sequence) after the coding sequence. A "natural gene" refers to a gene that is naturally found with its own regulatory sequence. A "chimeric gene" refers to any gene that is not a natural gene and contains regulatory and coding sequences that are not naturally found. An "endogenous gene" refers to a natural gene that is located at its natural position in the genome of an organism. An "exogenous gene" is a foreign gene that currently exists in the genome of an organism and did not originally exist, and also refers to a gene introduced into a recipient cell through a transgenic step. An exogenous gene can include a natural gene or a chimeric gene inserted into a non-natural organism. A "transgene" is a gene that has been introduced into the genome through a transformation procedure. The site in the plant genome where the recombinant DNA has been inserted can be referred to as the "insertion site" or "target site".

[0052] "Flanking DNA" can include genomic DNA that naturally occurs in an organism such as a plant or exogenous (heterologous) DNA introduced through a transformation process, such as a fragment associated with a transformation event. Thus, flanking DNA can include a combination of native and exogenous DNA. In the present invention, "flanking region" or "flanking sequence" or "genomic border region" or "genomic border sequence" refers to a sequence of at least 3, 5, 10, 11, 15, 20, 50, 100, 200, 300, 400, 1000, 1500, 2000, 2500 or 5000 base pairs or longer that is located immediately upstream or downstream of and adjacent to an initially exogenous inserted DNA molecule. When the flanking region is located downstream, it can also be referred to as "left border flanking" or "3' flanking" or "3' genomic border region" or "genomic 3' border sequence", etc. When the flanking region is located upstream, it can also be referred to as "right border flanking" or "5' flanking" or "5' genomic border region" or "genomic 5' border sequence", etc.

[0053] Transformation procedures that cause random integration of exogenous DNA result in transformants containing different flanking regions that are specific to each transformant. When recombinant DNA is introduced into a plant by traditional hybridization, its flanking region generally does not change. Transformants also contain unique junctions between segments of heterologous insert DNA and genomic DNA or between two segments of genomic DNA or between two segments of heterologous DNA. A "junction" is the point at which two specific DNA fragments are joined. For example, a junction exists at the position where insert DNA joins flanking DNA. Junction points also exist in the transformed organism where two DNA fragments are joined in a manner modified from that found in the native organism. "Junction DNA" refers to DNA that contains a junction point.

[0054] The present invention provides a transgenic soybean event designated LP207-1 and its progeny, the transgenic soybean event LP207-1 being the soybean plant LP207-1, which includes plants and seeds of the transgenic soybean event LP207-1 and their plant cells or their renewable parts, and plant parts of the transgenic soybean event LP207-1, including but not limited to cells, pollen, ovules, flowers, buds, roots, stems, inflorescences, leaves, and products from the soybean plant LP207-1, such as soybean meal, soybean flour, soybean oil, soybean milk, soybean silk, soybean starch, and biomass remaining in the soybean crop field.

[0055] The transgenic soybean event LP207-1 of the present invention contains a DNA construct that, when expressed within a plant cell, confers resistance to insects and tolerance to the herbicides glyphosate and glufosinate.

[0056] In some embodiments of the present invention, the DNA construct comprises four tandem expression cassettes. The first expression cassette comprises a suitable promoter for expression in plants and a suitable polyadenylation signal sequence. The promoter is operably linked to the nucleic acid sequence of the Cry1Fa protein (Cry1Fa) with insect resistance from Bacillus thuringiensis, and the Cry1Fa protein has resistance to lepidopteran insects. The second expression cassette comprises a suitable promoter for expression in plants and a suitable polyadenylation signal sequence. The promoter is operably linked to the gene encoding phosphinothricin acetyltransferase (PAT), and the PAT protein is tolerant to glufosinate herbicide. The third expression cassette comprises a suitable promoter for expression in plants and a suitable polyadenylation signal sequence. The promoter is operably linked to the nucleic acid sequence of the Cry1Ab protein, and the nucleic acid sequence of the Cry1Ab protein is mainly resistant to lepidopteran insects. The fourth expression cassette comprises a suitable promoter for expression in plants and a suitable polyadenylation signal sequence. The promoter is operably linked to the gene encoding 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS), and the nucleic acid sequence of the EPSPS protein is tolerant to glyphosate herbicide. Further, the promoter can be a suitable promoter isolated from plants, including constitutive, inducible, and / or tissue-specific promoters. The suitable promoters include, but are not limited to, the cauliflower mosaic virus (CaMV) 35S promoter, the figwort mosaic virus (FMV) 35S promoter, the ubiquitin protein (Ubiquitin) promoter, the actin (Actin) promoter, Agrobacterium tumefaciens ( Agrobacterium tumefaciens ) nopaline synthase (NOS) promoter, octopine synthase (OCS) promoter, Cestrum yellow leaf curling virus promoter, patatin promoter, ribulose-1,5-bisphosphate carboxylase / oxygenase (RuBisCO) promoter, glutathione S-transferase (GST) promoter, E9 promoter, GOS promoter, alcA / alcR promoter, Agrobacterium rhizogenes ( Agrobacterium rhizogenes ) RolD promoter, and Arabidopsis thaliana ( Arabidopsis thaliana ) Suc2 promoter. The polyadenylation signal sequence can be a suitable polyadenylation signal sequence that functions in plants. The suitable polyadenylation signal sequences include, but are not limited to, those derived from Agrobacterium tumefaciens ( Agrobacterium tumefaciensPolyadenylation signal sequences of nopaline synthase (NOS) gene, terminator derived from cauliflower mosaic virus (CaMV) 35S, polyadenylation signal sequences derived from protease inhibitor II (PINII) gene, and polyadenylation signal sequences derived from α-tubulin gene.

[0057] In addition, the expression cassette may further include other genetic elements, which include but are not limited to, enhancers and nucleic acid coding sequences of signal peptides / transit peptides. The enhancer can enhance the gene expression level, and the enhancers include but are not limited to, translation activator of tobacco etch virus (TEV), CaMV 35S enhancer, and FMV 35S enhancer. The signal peptide / transit peptide can direct the transport of Cry1Ab protein and / or EPSPS protein to the outside of the cell or specific organelles or compartments inside the cell. For example, the chloroplast transit peptide sequence is used to target chloroplasts, or the 'KDEL' retention sequence is used to target the endoplasmic reticulum.

[0058] The Cry1Ab and Cry1Fa genes can be isolated from Bacillus thuringiensis ( Bacillus thuringiensis , abbreviated as Bt), and the nucleic acid sequences of Cry1Ab and Cry1Fa genes can be changed by optimizing codons or in other ways to increase the stability and availability of transcripts in transformed cells.

[0059] In some embodiments of the present invention, soybean cells, seeds or plants containing transgenic soybean event LP207-1 sequentially contain the sequences SEQ ID NO:1, the nucleic acid sequence from position 525 to 13912 of SEQ ID NO:5, and SEQ ID NO:2 in their genomes, or contain the sequence SEQ ID NO:5.

[0060] The "Lepidoptera", scientific name Lepidoptera, includes two types of insects, moths and butterflies, which is the order with the most agricultural and forestry pests, such as Helicoverpa armigera, Spodoptera frugiperda, Spodoptera litura, Spodoptera exigua, and Leguminivora glycinivorella, etc.

[0061] The 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) gene can be isolated from Agrobacterium tumefaciens ( Agrobacterium tumefaciens sp.) strain CP4, and the polynucleotide encoding the EPSPS gene can be changed by optimizing codons or in other ways to increase the stability and availability of transcripts in transformed cells. The 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) gene can also be used as a selectable marker gene.

[0062] The said phosphinothricin acetyltransferase (PAT) gene can be isolated from Streptomyces viridochromogenes, and the polynucleotide encoding the EPSPS gene can be optimized for codons or otherwise modified to increase the stability and availability of the transcript in the transformed cells. The said phosphinothricin acetyltransferase (PAT) gene can also be used as a selectable marker gene.

[0063] The said "glyphosate" refers to N-(phosphonomethyl)glycine and its salts, and the treatment with "glyphosate herbicide" means the treatment with any herbicide formulation containing glyphosate. The said "glufosinate" refers to 4-[hydroxy(methyl)phosphinyl]-DL-homoserine or ammonium 2-amino-4-[hydroxy(methyl)phosphinyl]butyrate, and the treatment with "glufosinate herbicide" means the treatment with any herbicide formulation containing glufosinate. The selection of the application rate of a certain glyphosate and glufosinate formulation to achieve an effective biological dose is within the skills of an ordinary agronomist. Treating a field containing plant material derived from the transgenic soybean event LP207-1 with any herbicide formulation containing glyphosate and glufosinate will control the growth of weeds in the said field and will not affect the growth or yield of the plant material derived from the transgenic soybean event LP207-1.

[0064] The said DNA construct is introduced into a plant by a transformation method, which includes but is not limited to, Agrobacterium-mediated transformation, gene gun transformation, and pollen tube pathway transformation.

[0065] The said Agrobacterium-mediated transformation is a commonly used method for plant transformation. The foreign DNA to be introduced into the plant is cloned between the left and right border common sequences of the vector, namely the T-DNA region. The said vector is transformed into Agrobacterium cells, and subsequently, the said Agrobacterium cells are used to infect plant tissues, and the T-DNA region of the vector containing the foreign DNA is inserted into the plant genome.

[0066] The said gene gun transformation means bombarding plant cells with a vector containing foreign DNA (particle-mediated biolistic transformation).

[0067] The said pollen tube pathway transformation is to utilize the natural pollen tube pathway (also known as pollen tube guiding tissue) formed after plant pollination, and through the nucellus channel, carry the foreign DNA into the embryo sac.

[0068] After transformation, transgenic plants must be regenerated from the transformed plant tissues, and the progeny with foreign DNA are selected using suitable markers.

[0069] A DNA construct is a combination of DNA molecules linked to each other that provides one or more expression cassettes. Specifically, the DNA construct is a plasmid that can self-replicate in bacterial cells and contains different restriction endonuclease sites, which are used to introduce DNA molecules providing functional gene elements, namely promoters, introns, leader sequences, coding sequences, 3'-terminator regions, and other sequences. The expression cassettes contained in the DNA construct include the gene elements necessary for the transcription of messenger RNA, and the expression cassettes can be designed to be expressed in prokaryotic or eukaryotic cells. The expression cassettes of the present invention are designed to be most specifically expressed in plant cells.

[0070] A transgenic "event" is obtained by transforming a plant cell with a heterologous DNA construct, i.e., including at least one nucleic acid expression cassette containing a target gene, inserted into the plant genome by transgenic methods to produce a plant population, regenerating the plant population, and selecting specific plants with the characteristics of insertion at specific genomic loci. The term "event" refers to the original transformant containing the heterologous DNA and the progeny of the transformant. The term "event" also refers to the progeny obtained by sexual hybridization between the transformant and other individuals of a variety containing the heterologous DNA. Even after repeated backcrossing with the backcross parent, the inserted DNA and the flanking genomic DNA from the transformant parent are present at the same chromosomal position in the hybrid progeny. The term "event" also refers to the DNA sequence from the original transformant, which contains the inserted DNA and the flanking genomic sequences closely adjacent to the inserted DNA, and this DNA sequence is expected to be transferred to the progeny produced by sexual hybridization between a parental line containing the inserted DNA (such as the original transformant and its self-progeny) and a parental line without the inserted DNA, and the progeny has received the inserted DNA containing the target gene.

[0071] In the present invention, "recombinant" refers to a form of DNA and / or protein and / or organism that is not normally found in nature and is thus produced by artificial intervention. Such artificial intervention can produce recombinant DNA molecules and / or recombinant plants. The "recombinant DNA molecule" is obtained by artificially combining two sequence segments that are otherwise separated, for example, by chemical synthesis or by manipulating isolated nucleic acid segments by genetic engineering techniques. The techniques for nucleic acid manipulation are well known.

[0072] The term "transgenic" includes any cell, cell line, callus, tissue, plant part or plant whose genotype has been altered due to the presence of heterologous nucleic acid, and said "transgenic" includes the original transgenic organism so altered and progeny individuals generated from the original transgenic organism by sexual hybridization or asexual propagation. In the present invention, the term "transgenic" does not include genomic (chromosomal or extrachromosomal) alterations by conventional plant breeding methods or natural-occurring events such as random allogamy, non-recombinant viral infection, non-recombinant bacterial transformation, non-recombinant transposition or spontaneous mutation.

[0073] "Heterologous" in the present invention means that the first molecule is not normally found in nature in combination with the second molecule. For example, a molecule can be derived from a first species and inserted into the genome of a second species. Thus such a molecule is heterologous to the host and is artificially introduced into the genome of the host cell.

[0074] Culturing the transgenic soybean event LP207-1 that is resistant to Lepidoptera insects and tolerant to glyphosate and glufosinate herbicides can be carried out by the following steps: First, sexually hybridize a first parental soybean plant with a second parental soybean plant to produce a diverse population of first-generation progeny plants, wherein the first parental soybean plant consists of soybean plants cultivated from the transgenic soybean event LP207-1 and its progeny, and the transgenic soybean event LP207-1 and its progeny are obtained by transformation using an expression cassette of the present invention that is resistant to Lepidoptera insects and tolerant to glyphosate and glufosinate herbicides, and the second parental soybean plant lacks resistance to Lepidoptera insects and / or tolerance to glyphosate and glufosinate herbicides; then select the progeny plants that are resistant to the invasion of Lepidoptera insects and / or tolerant to glyphosate and glufosinate herbicides, and soybean plants that are resistant to Lepidoptera insects and tolerant to glyphosate and glufosinate herbicides can be cultivated. These steps can further include backcrossing the progeny plants with Lepidoptera insect resistance and / or glyphosate and glufosinate tolerance to the second parental soybean plant or a third parental soybean plant, and then selecting the progeny by infesting with Lepidoptera insects, applying glyphosate and glufosinate herbicides or by identification with molecular markers related to the trait (such as a DNA molecule containing the junction sites identified at the 5' end and 3' end of the inserted sequence in the transgenic soybean event LP207-1), thereby producing soybean plants that are resistant to Lepidoptera insects and tolerant to glyphosate and glufosinate herbicides.

[0075] It should also be understood that two different transgenic plants can also be crossed to produce progeny containing two independent, separately added foreign genes. Self-crossing of appropriate progeny can result in progeny plants that are homozygous for both added foreign genes. Backcrossing to the parental plants and outcrossing to non-transgenic plants, as described above, are also contemplated, as is asexual reproduction.

[0076] The term "probe" is an isolated nucleic acid molecule to which a conventional detectable label or reporter molecule, such as a radioisotope, ligand, chemiluminescent agent, or enzyme, can be attached. Such a probe is complementary to one strand of the target nucleic acid, and in the present invention, the probe is complementary to a DNA strand from the genome of transgenic soybean event LP207-1, whether the genomic DNA is from transgenic soybean event LP207-1 or a seed, or from a plant or seed or extract of transgenic soybean event LP207-1. The probes of the present invention include not only deoxyribonucleic acid or ribonucleic acid, but also polyamides and other probe materials that specifically bind to the target DNA sequence and can be used to detect the presence of the target DNA sequence.

[0077] The term "primer" is an isolated nucleic acid molecule that anneals, by nucleic acid hybridization, to a complementary target DNA strand to form a hybrid between the primer and the target DNA strand, and then extends along the target DNA strand under the action of a polymerase (such as DNA polymerase). The primer pairs of the present invention relate to their use in the amplification of target nucleic acid sequences, for example, by polymerase chain reaction (PCR) or other conventional nucleic acid amplification methods.

[0078] Methods for designing and using primers and probes are well known in the art. DNA molecules containing the full length or fragments of SEQ ID NO:1-7 can be used as primers and probes for detecting soybean event LP207-1 and can be readily designed by those skilled in the art using the sequences provided herein.

[0079] Probes and primers are generally 11 or more polynucleotides in length, preferably 18 or more polynucleotides in length, more preferably 24 or more polynucleotides in length, and most preferably 30 or more polynucleotides in length. Such probes and primers hybridize specifically to the target sequence under highly stringent hybridization conditions. Although probes that are different from the target DNA sequence and retain the ability to hybridize to the target DNA sequence can be designed by conventional methods, preferably, the probes and primers in the present invention have complete DNA sequence identity with the contiguous nucleic acids of the target sequence.

[0080] Primers and probes based on the flanking genomic DNA and the inserted sequence of the present invention can be determined by conventional methods, for example, by isolating the corresponding DNA molecule from plant material derived from the transgenic soybean event LP207-1 and determining the nucleic acid sequence of the DNA molecule. The DNA molecule contains the transgenic inserted sequence and the soybean genomic flanking region, and fragments of the DNA molecule can be used as primers or probes.

[0081] The nucleic acid probes and primers of the present invention hybridize with the target DNA sequence under stringent conditions. Any conventional nucleic acid hybridization or amplification method can be used to identify the presence of DNA derived from the transgenic soybean event LP207-1 in a sample. Nucleic acid molecules or fragments thereof are capable of specifically hybridizing with other nucleic acid molecules under certain circumstances. As used in the present invention, if two nucleic acid molecules can form an antiparallel double-stranded nucleic acid structure, it can be said that the two nucleic acid molecules can specifically hybridize with each other. If two nucleic acid molecules show complete complementarity, one of the nucleic acid molecules is said to be the "complement" of the other nucleic acid molecule. As used in the present invention, when each nucleotide of one nucleic acid molecule is complementary to the corresponding nucleotide of another nucleic acid molecule, the two nucleic acid molecules are said to show "complete complementarity". If two nucleic acid molecules can hybridize with each other with sufficient stability so that they anneal and bind to each other under at least conventional "low stringency" conditions, the two nucleic acid molecules are said to be "minimally complementary". Similarly, if two nucleic acid molecules can hybridize with each other with sufficient stability so that they anneal and bind to each other under conventional "high stringency" conditions, the two nucleic acid molecules are said to have "complementarity". Deviation from complete complementarity is allowed as long as such deviation does not completely prevent the two molecules from forming a double-stranded structure. In order for a nucleic acid molecule to be used as a primer or probe, it is only necessary to ensure that it has sufficient complementarity in sequence so that a stable double-stranded structure can be formed under the specific solvent and salt concentration employed.

[0082] As used in the present invention, a substantially homologous sequence is a nucleic acid molecule that is capable of specifically hybridizing under highly stringent conditions to the complementary strand of a matching nucleic acid molecule. Suitable stringent conditions for promoting DNA hybridization are known to those skilled in the art, for example, treatment with 6.0× sodium chloride / sodium citrate (SSC) at approximately 45°C, followed by washing with 2.0× SSC at 50°C. For example, the salt concentration in the washing step can be selected from about 2.0× SSC at 50°C for low stringency conditions to about 0.2× SSC at 50°C for high stringency conditions. In addition, the temperature conditions in the washing step can range from room temperature of about 22°C for low stringency conditions to about 65°C for high stringency conditions. The temperature conditions and salt concentration can both be changed, or one can remain unchanged while the other variable is changed. Specifically, a nucleic acid molecule of the present invention can specifically hybridize under moderately stringent conditions, for example, at about 2.0× SSC and about 65°C, to one or more nucleic acid molecules of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, and SEQ ID NO:7 or their complementary sequences, or any fragment of the above sequences. More specifically, a nucleic acid molecule of the present invention specifically hybridizes under highly stringent conditions to one or more nucleic acid molecules of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, and SEQ ID NO:7 or their complementary sequences, or any fragment of the above sequences. In the present invention, the preferred marker nucleic acid molecule has the sequence SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:6, or SEQ ID NO:7 or their complementary sequences, or any fragment of the above sequences. Another preferred marker nucleic acid molecule of the present invention has 80% to 100% or 90% to 100% sequence identity with the sequence SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:6, or SEQ ID NO:7 or their complementary sequences, or any fragment of the above sequences. The sequences SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:6, and SEQ ID NO:7 can be used as markers in plant breeding methods to identify the offspring of genetic crosses. Hybridization of the probe to the target DNA molecule can be detected by any method known to those skilled in the art, including but not limited to, fluorescence labeling, radioactive labeling, antibody-based labeling, and chemiluminescent labeling.

[0083] For amplification of a target nucleic acid sequence using specific amplification primers (e.g., by PCR), "stringent conditions" refers to conditions in a DNA thermal amplification reaction that permit hybridization of the primers to the target nucleic acid sequence only, such that primers having a wild-type sequence (or its complementary sequence) corresponding to the target nucleic acid sequence are capable of binding to the target nucleic acid sequence and preferably produce a unique amplification product, the amplification product being the amplicon.

[0084] The term "specifically binds (to a target sequence)" means that a probe or primer hybridizes only to a target sequence in a sample containing the target sequence under stringent hybridization conditions.

[0085] As used in the present invention, "amplified DNA", "amplification product", or "amplicon" refers to a nucleic acid amplification product of a target nucleic acid sequence that is part of a nucleic acid template. For example, to determine whether a soybean plant was produced by sexual hybridization with a transgenic soybean event LP207-1 of the present invention, or whether a soybean sample collected from a field contains the transgenic soybean event LP207-1, or whether a soybean extract, such as a meal, flour, or oil, contains the transgenic soybean event LP207-1, DNA extracted from a soybean plant tissue sample or extract can be subjected to a nucleic acid amplification method using a primer pair to produce an amplicon that is diagnostic for the presence of DNA of the transgenic soybean event LP207-1. The primer pair includes a first primer derived from a flanking sequence adjacent to the insertion site of the inserted foreign DNA in the plant genome and a second primer derived from the inserted foreign DNA. The amplicon has a certain length and sequence that is also diagnostic for the transgenic soybean event LP207-1. The length range of the amplicon can be the binding length of the primer pair plus one nucleotide base pair, preferably plus about fifty nucleotide base pairs, more preferably plus about two hundred and fifty nucleotide base pairs, and most preferably plus about four hundred and fifty nucleotide base pairs or more.

[0086] Optionally, the primer pair can be derived from the flanking genomic sequences on both sides of the inserted DNA to produce an amplicon that includes the entire inserted nucleic acid sequence. One of the primer pairs derived from the plant genomic sequence can be located at a certain distance from the inserted DNA sequence, and the range of this distance can be from one nucleotide base pair to about twenty thousand nucleotide base pairs. The use of the term "amplicon" specifically excludes primer dimers formed in a DNA thermal amplification reaction.

[0087] The nucleic acid amplification reaction can be achieved by any nucleic acid amplification reaction method known in the art, including polymerase chain reaction (PCR). Various nucleic acid amplification methods are well-known to those skilled in the art. The PCR amplification method has been developed to amplify genomic DNA of 22 kb and phage DNA of 42 kb. These methods and other DNA amplification methods in the art can be used in the present invention. The inserted exogenous DNA sequence and the flanking DNA sequence from the transgenic soybean event LP207-1 can be amplified by using the provided primer sequences to amplify the genome of the transgenic soybean event LP207-1, and after amplification, standard DNA sequencing is performed on the PCR amplicon or the cloned DNA.

[0088] The DNA detection kit based on the DNA amplification method may contain DNA primer molecules that specifically hybridize to the target DNA under appropriate reaction conditions and amplify diagnostic amplicons. The kit can provide an agarose gel-based detection method or many methods for detecting diagnostic amplicons known in the prior art. The kit provided by the present invention contains DNA primers that are homologous or complementary to any part of the soybean genomic region of SEQ ID NO: 3 or SEQ ID NO: 4, and homologous or complementary to any part of the transgenic insertion region of SEQ ID NO: 5. In particular, the primer pair useful in the DNA amplification method is SEQ ID NO: 8 and SEQ ID NO: 9, which amplify a diagnostic amplicon homologous to a part of the 5'-transgenic / genomic region of the transgenic soybean event LP207-1, wherein the amplicon includes SEQ ID NO: 1. Other DNA molecules used as DNA primers can be selected from SEQ ID NO: 5.

[0089] The amplicons generated by these methods can be detected by a variety of techniques. One method is GeneticBit Analysis, which designs a DNA oligonucleotide chain spanning the inserted DNA sequence and the adjacent flanking genomic DNA sequence. The oligonucleotide chain is immobilized in the wells of a microplate. After PCR amplification of the target region (using one primer in the inserted sequence and one primer in the adjacent flanking genomic sequence), the single-stranded PCR product can hybridize with the immobilized oligonucleotide chain and serve as a template for a single-base extension reaction that uses DNA polymerase and ddNTPs specifically labeled for the next expected base. The results can be obtained by fluorescence or ELISA-like methods. The signal represents the presence of the insertion / flanking sequence, indicating that the amplification, hybridization, and single-base extension reactions are successful.

[0090] Another method is the Pyrosequencing technique. In this method, an oligonucleotide strand spanning the inserted DNA sequence and the adjacent genomic DNA binding site is designed. This oligonucleotide strand is hybridized with the single-stranded PCR product of the target region (using one primer each within the inserted sequence and the adjacent flanking genomic sequences), and then incubated with DNA polymerase, ATP, sulfurylase, luciferase, apyrase, adenosine-5'-phosphosulfate, and luciferin. dNTPs are added separately, and the generated light signal is measured. The light signal represents the presence of the inserted / flanking sequence, indicating that the amplification, hybridization, and single-base or multi-base extension reactions are successful.

[0091] The fluorescence polarization phenomenon described by Chen et al. (Genome Res. 9:492-498, 1999) is also a method that can be used to detect the amplicons of the present invention. Using this method requires designing an oligonucleotide strand spanning the inserted DNA sequence and the adjacent genomic DNA binding site. This oligonucleotide strand is hybridized with the single-stranded PCR product of the target region (using one primer each within the inserted sequence and the adjacent flanking genomic sequences), and then incubated with DNA polymerase and a fluorescently labeled ddNTPs. Single-base extension results in the insertion of ddNTPs. This insertion can be measured for the change in polarization using a fluorometer. The change in polarization represents the presence of the inserted / flanking sequence, indicating that the amplification, hybridization, and single-base extension reactions are successful.

[0092] Taqman is described as a method for detecting and quantitatively analyzing the presence of a DNA sequence, which is detailed in the instructions provided by the manufacturer. A brief example is as follows: Design a FRET oligonucleotide probe spanning the inserted DNA sequence and the adjacent genomic flanking binding site. This FRET probe and PCR primers (using one primer each within the inserted sequence and the adjacent flanking genomic sequences) are subjected to a cycling reaction in the presence of a thermostable polymerase and dNTPs. Hybridization of the FRET probe results in the cleavage of the fluorescent and quenching moieties on the FRET probe and the release of the fluorescent moiety. The generation of a fluorescent signal represents the presence of the inserted / flanking sequence, indicating that the amplification and hybridization are successful.

[0093] Based on the hybridization principle, suitable techniques for detecting plant materials derived from the transgenic soybean event LP207-1 may also include Southern blot hybridization, Northern blot hybridization, and in situ hybridization. In particular, the suitable techniques include incubating a probe and a sample, washing to remove unbound probe, and detecting whether the probe has hybridized. The detection method depends on the type of label attached to the probe. For example, a radiolabeled probe can be detected by X-ray film exposure and development, or an enzyme-labeled probe can be detected by a color change due to substrate conversion.

[0094] Tyangi et al. (Nat. Biotech. 14:303-308, 1996) described the application of molecular markers in sequence detection. Briefly, a FRET oligonucleotide probe spanning the inserted DNA sequence and the adjacent genomic flanking junction was designed. The unique structure of the FRET probe results in it containing a secondary structure that can keep the fluorescent part and the quenching part in close proximity. The FRET probe and PCR primers (one primer each within the inserted sequence and the adjacent flanking genomic sequence) were subjected to cycling reactions in the presence of a thermostable polymerase and dNTPs. After successful PCR amplification, hybridization of the FRET probe to the target sequence causes the loss of the probe secondary structure, thus spatially separating the fluorescent part and the quenching part, generating a fluorescent signal. The generation of the fluorescent signal represents the presence of the insert / flanking sequence, indicating that the amplification and hybridization were successful.

[0095] Other described methods, such as microfluidics, provide methods and devices for separating and amplifying DNA samples. Optical dyes are used to detect and assay specific DNA molecules. Electronic sensors for detecting DNA molecules or nanotube devices containing nanobeads that bind to specific DNA molecules and can thus be detected are useful for detecting the DNA molecules of the present invention.

[0096] The compositions of the present invention and methods described or known in the field of DNA detection can be used to develop DNA detection kits. The kits are useful for identifying the presence of DNA of the transgenic soybean event LP207-1 in a sample and can also be used to cultivate soybean plants containing DNA of the transgenic soybean event LP207-1. The kits can contain DNA primers or probes that are homologous or complementary to at least a part of the sequences SEQ ID NO:1, 2, 3, 4, or 5, or contain other DNA primers or probes that are homologous or complementary to the DNA contained in the transgenic genetic elements of the DNA, and these DNA sequences can be used in DNA amplification reactions or as probes in DNA hybridization methods.

[0097] Contained in the soybean genome and inFigure 1 The DNA structure of the transgenic insertion sequence and the soybean genome as described in Table 1 includes: the soybean LP207-1 flanking genomic region at the 5' end of the transgenic insertion sequence, a part of the insertion sequence from the right border region (RB) of Agrobacterium, the first expression cassette consists of the Arabidopsis ubiquitin gene promoter Ubi (pAtUbi10), operably linked to the insect resistance gene Cry1Fa (Cry1Fa) of Bacillus thuringiensis, and operably linked to the terminator tORF25PolyA from Agrobacterium tumefaciens pTi15955; the second expression cassette consists of the cauliflower mosaic virus (CaMV) p35S promoter, operably linked to the phosphinothricin acetyltransferase (cPAT), and operably linked to the cauliflower mosaic virus (CaMV) 35S terminator; the third expression cassette consists of the promoter and leader sequence of the Arabidopsis thaliana gene encoding the small subunit of ribulose-1,5-bisphosphate carboxylase / oxygenase (pAtRbcS4) E9 Arabidopsis gene promoter, operably linked to the signal peptide sequence of the Arabidopsis thaliana gene encoding the small subunit of ribulose-1,5-bisphosphate carboxylase / oxygenase (spAtRbcS4), operably linked to the Cry1Ab protein (Cry1Ab) of Bacillus thuringiensis for insect resistance, and operably linked to the transcriptional terminator of the 3' UTR sequence of the PT1 gene encoding a phosphate transporter from Medicago truncatula (tMtPt); the fourth expression cassette consists of the promoter of the Tsf1 gene of the elongation factor EF-lalpha from soybean (pGm17gTsf1), operably linked to the Arabidopsis chloroplast transit peptide (spAtCTP2), operably linked to the glyphosate tolerance 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) of Agrobacterium sp. strain CP4, and operably linked to the non-transcribed sequence terminator of the 3' end of the ribulose-1,5-bisphosphate carboxylase small subunit (RbcS2) E9 gene from pea (tPsE9). A part of the insertion sequence from the left border region (LB) of Agrobacterium, and the soybean plant LP207-1 flanking genomic region (SEQ ID NO:5) at the 3' end of the transgenic insertion sequence. In the DNA amplification method, the DNA molecule used as a primer can be any part of the transgenic insertion sequence in the transgenic soybean event LP207-1, or any part of the DNA region of the flanking soybean genome in the transgenic soybean event LP207-1.

[0098] The transgenic soybean event LP207-1 can be combined with other transgenic soybean varieties, such as soybeans with herbicide (e.g., PPO, dicamba, etc.) tolerance, or transgenic soybean varieties carrying other insect-resistant genes (such as Japanese beetles, white grubs, plant bugs, two-spotted leaf beetles, etc.). All these various combinations of different transgenic events, when bred together with the transgenic soybean event LP207-1 of the present invention, can provide improved hybrid transgenic soybean varieties that are resistant to multiple pests and tolerant to multiple herbicides. These varieties can exhibit more excellent characteristics such as increased yield compared to non-transgenic varieties and single-trait transgenic varieties.

[0099] The present invention provides the transgenic soybean event LP207-1, a nucleic acid sequence for detecting soybean plants containing this event and its detection method. The transgenic soybean event LP207-1 is resistant to feeding damage by Lepidoptera pests and tolerant to the phytotoxic effects of agricultural herbicides containing glyphosate and glufosinate. This dual-trait soybean plant expresses the Cry1Ab and Cry1Fa proteins of Bacillus thuringiensis, which provide resistance to feeding damage by Lepidoptera pests (such as Helicoverpa armigera, Spodoptera exigua, Spodoptera litura, Leguminivora glycinivorella, Spodoptera frugiperda); and it expresses the glyphosate-resistant 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) protein of Agrobacterium sp. strain CP4 and the glufosinate-resistant phosphinothricin acetyltransferase (PAT) protein of Streptomyces viridochromogenes, which confer plant tolerance to glyphosate and glufosinate. BRIEF DESCRIPTION OF THE DRAWINGS

[0100] Figure 1 It is a schematic structural diagram of the transgenic insertion sequence of the present invention and the soybean genome; Figure 2 It is a schematic structural diagram of the recombinant expression vector pLP207 of the present invention; Figure 3 It is the in vitro resistance effect of the transgenic soybean containing the transgenic soybean event LP207-1 of the present invention against Lepidoptera pests; Figure 4 It is the field artificial inoculation effect diagram of the transgenic soybean containing the transgenic soybean event LP207-1 of the present invention with Helicoverpa armigera; Figure 5 It is the effect diagram of the transgenic soybean containing the transgenic soybean event LP207-1 of the present invention under natural occurrence conditions of Spodoptera exigua; Figure 6 It is the field effect diagram of the transgenic soybean containing the transgenic soybean event LP207-1 of the present invention under natural occurrence conditions of Spodoptera frugiperda; Figure 7 It is the field effect diagram of the transgenic soybean containing the transgenic soybean event LP207-1 of the present invention when spraying 4 times the recommended field spraying concentration of glyphosate herbicide; Figure 8 This is the field effect diagram of the genetically modified soybean containing the genetically modified soybean event LP207-1 of the present invention when spraying the herbicide glufosinate-ammonium at 4 times the field recommended spraying concentration. Detailed implementation manners

[0101] The present invention will be further described in detail below through examples. Through these exemplary descriptions, the features and advantages of the present invention will become more clearly defined.

[0102] Here, the professional term "exemplary" means "serving as an example, embodiment, or illustration". Any embodiment described as "exemplary" here does not have to be construed as superior to or better than other embodiments.

[0103] In addition, the technical features involved in different embodiments of the present invention described below can be combined with each other as long as they do not conflict with each other.

[0104] The technical solutions of the genetically modified soybean event LP207-1 of the present invention and its detection method will be further described below through specific examples.

[0105] Example 1 Cloning and transformation 1.1 Vector cloning Use standard gene cloning techniques to construct the recombinant expression vector pLP207 (such as Figure 2as shown). The vector pLP207 contains 4 tandem transgenic expression cassettes. The first expression cassette consists of the Arabidopsis ubiquitin gene promoter Ubi (pAtUbi10), operably linked to the insect resistance gene Cry1Fa of Bacillus thuringiensis (Cry1Fa), and operably linked to the terminator tNos from Agrobacterium tumefaciens; the second expression cassette consists of the cauliflower mosaic virus (CaMV) p35S promoter, operably linked to the gene encoding phosphinothricin acetyltransferase (PAT), and operably linked to the cauliflower mosaic virus (CaMV) 35S terminator;; the third expression cassette consists of the promoter and leader sequence of the Arabidopsis thaliana gene encoding the small subunit of ribulose-1,5-bisphosphate carboxylase / oxygenase (pATRbcS4) E9 Arabidopsis thaliana gene promoter, operably linked to the signal peptide sequence of the Arabidopsis thaliana gene encoding the small subunit of ribulose-1,5-bisphosphate carboxylase / oxygenase (spAtRbcS4), operably linked to the Cry1Ab protein of Bacillus thuringiensis insect resistance (Cry1Ab), and operably linked to the transcriptional terminator of the 3'UTR sequence of the PT1 gene encoding a phosphate transporter from Medicago truncatula (tMtPt); the fourth expression cassette consists of the promoter of the Tsf1 gene of the elongation factor EF-lalpha from soybean (pGm17gTsf1) operably linked to the Arabidopsis chloroplast transit peptide (spAtCTP2), operably linked to the glyphosate tolerance 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) of Agrobacterium sp. strain CP4, and operably linked to the non-transcribed sequence terminator of the 3' end of the ribulose-1,5-bisphosphate carboxylase small subunit (RbcS2) E9 gene from pea (tPsE9). The vector pLP207 was transformed into Agrobacterium tumefaciens LBA4404 (Invitrgen, Chicago, USA; Cat. No: 18313-015) by the liquid nitrogen method, and the transformed cells were screened using 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) as a selection marker.

[0106] 1.2. Plant transformation Transformation was carried out using the conventional Agrobacterium infection method. The immature embryos of sterile-cultured soybean (soybean variety Tianlong No. 1) were co-cultured with the Agrobacterium tumefaciens described in Example 1.1 above to transfer the T-DNA in the constructed recombinant expression vector pLP207 into the soybean genome to generate transgenic soybean events.

[0107] For Agrobacterium-mediated soybean transformation, briefly, immature embryos were isolated from soybean and contacted with an Agrobacterium suspension, where the Agrobacterium was capable of transferring cry1Ab, cry1F, epsps and patThe nucleic acid sequence of the gene is transferred to at least one cell of one of the young embryos (Step 1: Infection step), in which step, the young embryos are specifically immersed in an Agrobacterium suspension (OD 660 = 0.4 - 0.6) in an infection medium (4.3 g / L of MS salts, MS vitamins, 300 mg / L of casein, 68.5 g / L of sucrose, 36 g / L of glucose, 40 mg / L of acetosyringone (AS), 1 mg / L of 2,4-dichlorophenoxyacetic acid (2,4-D), pH 5.3) to initiate inoculation. The young embryos are co-cultured with Agrobacterium for a period of time (3 days) (Step 2: Co-culture step). Specifically, the young embryos are cultured on a solid medium (4.3 g / L of MS salts, MS vitamins, 300 mg / L of casein, 20 g / L of sucrose, 10 g / L of glucose, 100 mg / L of acetosyringone (AS), 1 mg / L of 2,4-dichlorophenoxyacetic acid (2,4-D), 8 g / L of agar, pH 5.8) after the infection step. After this co-culture stage, there can be an optional "recovery" step. In the "recovery" step, at least one antibiotic (cefotaxime) known to inhibit the growth of Agrobacterium is present in a recovery medium (4.3 g / L of MS salts, MS vitamins, 300 mg / L of casein, 30 g / L of sucrose, 1 mg / L of 2,4-dichlorophenoxyacetic acid (2,4-D), 3 g / L of phytagel, pH 5.8), and the selection agent for the plant transformant is not added (Step 3: Recovery step). Specifically, the young embryos are cultured on a solid medium with antibiotics but without the selection agent to eliminate Agrobacterium and provide a recovery period for the infected cells. Then, the inoculated young embryos are cultured on a medium containing the selection agent (N-(phosphonomethyl)glycine) and the growing transformed calli are selected (Step 4: Selection step). Specifically, the young embryos are cultured on a screening solid medium with the selection agent (4.3 g / L of MS salts, MS vitamins, 300 mg / L of casein, 30 g / L of sucrose, 0.25 mol / L of N-(phosphonomethyl)glycine, 1 mg / L of 2,4-dichlorophenoxyacetic acid (2,4-D), 3 g / L of phytagel, pH 5.8), resulting in the selective growth of the transformed cells. Then, the calli are regenerated into plants (Step 5: Regeneration step). Specifically, the calli growing on the medium containing the selection agent are cultured on a solid medium (MS differentiation medium and MS rooting medium) to regenerate plants.

[0108] The selected resistant calli were transferred onto the MS differentiation medium (MS salts 4.3 g / L, MS vitamins, casein 300 mg / L, sucrose 30 g / L, 6-benzyladenine 2 mg / L, N-(phosphonomethyl)glycine 0.125 mol / L, phytagel 3 g / L, pH = 5.8) and cultured at 25 °C for differentiation. The differentiated seedlings were transferred onto the MS rooting medium (MS salts 2.15 g / L, MS vitamins, casein 300 mg / L, sucrose 30 g / L, indole-3-acetic acid 1 mg / L, agar 8 g / L, pH = 5.8), cultured at 25 °C until about 10 cm in height, and then transferred to the greenhouse for cultivation until fruiting. In the greenhouse, they were cultured at 28 °C for 16 hours per day and then at 20 °C for 8 hours per day.

[0109] 1.3 Identification and screening of transgenic events A total of 1500 independent transgenic T0 plants were generated. Through molecular detection of all T0 plants (including the copy number of target genes, insertion positions, etc.), evaluation of target traits (insect resistance and herbicide tolerance), and agronomic traits, after excluding abnormal transformant plants, LP207-1 was selected.

[0110] Example 2 Detection of transgenic soybean event LP207-1 using TaqMan Approximately 100 mg of leaves from transgenic soybean event LP207-1 were taken as samples, and their genomic DNA was extracted using Qiagen's DNeasy PlantMaxi Kit, and detected by Taqman probe fluorescence quantitative PCR method cry1Ab 、 cry1Fa 、 epsps and pat of the copy number. At the same time, wild-type soybean plants (non-transgenic, transformation receptor) were used as controls and detected and analyzed according to the above method. The experiment was set with 3 replicates and the average value was taken.

[0111] The specific method is as follows: Step 11: Take 100 mg of leaves from transgenic soybean event LP207-1, grind them into a homogenate in a mortar with liquid nitrogen, and take 3 replicates for each sample; Step 12: Use Qiagen's DNeasy Plant Mini Kit to extract the genomic DNA of the above samples, and refer to its product manual for the specific method; Step 13: Measure the genomic DNA concentration of the above samples using NanoDrop 2000 (Thermo Scientific); Step 14: Adjust the genomic DNA concentration of the above samples to the same concentration value, and the range of the concentration value is 80 - 100 ng / μl; Step 15: Identify the copy number of the sample by Taqman probe fluorescence quantitative PCR method. Use the sample with known copy number identified as the standard, and use the sample of wild-type soybean plants (non-transgenic, transformation receptor) as the control. Each sample has 3 replicates, and take the average value; the primer and probe sequences for fluorescence quantitative PCR are as follows: The following primers and probes are used to detect cry1Fa Gene sequence: Primer 1: CTCGGTCTATGTTCAAGCTGCTAA, as shown in sequence SEQ ID NO:16 in the sequence listing; Primer 2: ACCTTGCCCAAACGACACA, as shown in sequence SEQ ID NO:17 in the sequence listing; Probe 1: CTGCACTTGTCACTACTGCGCGACG, as shown in sequence SEQ ID NO:18 in the sequence listing; The following primers and probes are used to detect pat Gene sequence: Primer 3: TTGAGATTAGGCCAGCTAC, as shown in sequence SEQ ID NO:19 in the sequence listing; Primer 4: TGTGGTGTTTGTGGCTCTGTCCTAA, as shown in sequence SEQ ID NO:20 in the sequence listing; Probe 2: TAACCATTACATTGAGACGTCTACAGTGAA, as shown in sequence SEQ ID NO:21 in the sequence listing; The following primers and probes are used to detect cry1Ab Gene sequence: Primer 5: TGGGAGGACGGAATGATATTG, as shown in sequence SEQ ID NO:22 in the sequence listing; Primer 6: AACTCGTCCGTGAGCATCATC, as shown in sequence SEQ ID NO:23 in the sequence listing; Probe 3: AACTCCGCGCTGCGATGAATCC, as shown in sequence SEQ ID NO:24 in the sequence listing; The following primers and probes are used to detect epsps Gene sequence: Primer 7: GGTGTGCAGGTGAAGTCTGAAG, as shown in sequence SEQ ID NO:25 in the sequence listing; Primer 8: TTGGCGTTGGAGTCTTTGGT, as shown in sequence SEQ ID NO:26 in the sequence listing; Probe 4: CGGTGATCGTCTTCCAGTTACCTTGCG, as shown in SEQ ID NO:27 in the Sequence Listing; The PCR reaction system is as follows: JumpStartTM Taq ReadyMixTM (Sigma) 10 μL; 50× primer / probe mixture 1 μL; Genomic DNA 3 μL; Water (ddH2O) 6 μL; The 50× primer / probe mixture contains 45 μL of each primer at a concentration of 1 mM, 50 μL of the probe at a concentration of 100 μM, and 860 μL of 1× TE buffer, and is stored in an amber test tube at 4°C.

[0112] The PCR reaction conditions are as follows: Step Temperature Time 21 95°C 5 min; 22 95°C 30 s; 23 60°C 1 min; 24 Return to step 22 and repeat 40 times.

[0113] Analyze the data using SDS 2.3 software (Applied Biosystems) to obtain the single-copy transgenic soybean event LP207-1.

[0114] Example 3 Detection of Transgenic Soybean Event LP207-1 3.1 Genomic DNA Extraction DNA extraction was carried out according to the conventional CTAB (cetyltrimethylammonium bromide) method: 2 g of young leaves of transgenic soybean event LP207-1 were ground into powder in liquid nitrogen, and then 0.5 mL of DNA extraction CTAB Buffer [20 g / L CTAB, 1.4 M NaCl, 100 mM Tris-HCl, 20 mM EDTA (ethylenediaminetetraacetic acid)] preheated at 65 °C was added. The pH was adjusted to 8.0 with NaOH. After thorough mixing, extraction was carried out at 65 °C for 90 min; 0.5 volume of phenol and 0.5 volume of chloroform were added, and the mixture was inverted and mixed well; centrifugation was carried out at 12,000 rpm (revolutions per minute) for 10 min; the supernatant was aspirated, 1 volume of isopropanol was added, the centrifuge tube was gently shaken, and it was left to stand at -20 °C for 30 min; centrifugation was carried out again at 12,000 rpm for 10 min; the DNA was collected at the bottom of the tube; the supernatant was discarded, and the precipitate was washed with 0.5 mL of ethanol with a volume concentration of 70%; centrifugation was carried out at 12,000 rpm for 5 min; vacuum drying or air drying was carried out in a laminar flow hood; the DNA precipitate was dissolved in an appropriate amount of TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8.0) and stored at -20 °C.

[0115] 3.2 Analysis of flanking DNA sequences The concentration of the above-extracted DNA sample was measured to make the concentration of the sample to be measured between 80 - 100 ng / μL. With the selected restriction endonuclease Spe I Pst I Bss HII (5'-end analysis) and Sac I Kpn I Xma I NheI (3'-end analysis) Digest genomic DNA with restriction enzymes respectively. Add 26.5 μL of genomic DNA, 0.5 μL of the above-selected restriction enzyme and 3 μL of restriction enzyme buffer to each digestion system, and digest at an appropriate temperature for 1 hour. After the digestion is completed, add 70 μL of absolute ethanol to the digestion system, incubate on ice for 30 min, centrifuge at 12,000 rpm for 7 min, discard the supernatant, dry it, and then add 8.5 μL of double-distilled water (ddH2O), 1 μL of 10×T4 Buffer and 0.5 μL of T4 ligase and ligate overnight at 4°C. Use a series of nested primers for PCR amplification to isolate 5' and 3' transgenic / genomic DNA. Specifically, the primer combinations for isolating 5' transgenic / genomic DNA include SEQ ID NO:13 and SEQ ID NO:34 as the first primers, SEQ ID NO:35 and SEQ ID NO:36 as the second primers, and SEQ ID NO:13 as the sequencing primer. The primer combinations for isolating 3' transgenic / genomic DNA include SEQ ID NO:15 and SEQ ID NO:37 as the first primers, SEQ ID NO:38 and SEQ ID NO:39 as the second primers, and SEQ ID NO:15 as the sequencing primer. The PCR reaction conditions are shown in Table 3.

[0116] The obtained amplicons are electrophoresed on a 2.0% agarose gel to separate the PCR reactants, and then the target fragments are separated from the agarose matrix using a QIAquick Gel Extraction Kit (Catalog #_28704, Qiagen Inc., Valencia, CA). Then the purified PCR products are sequenced (e.g., ABI PrismTM 377, PE Biosystems, Foster City, CA) and analyzed (e.g., DNASTAR sequence analysis software, DNASTAR Inc., Madison, WI).

[0117] Use standard PCR methods to confirm the 5' and 3' flanking sequences and the junction sequences. The 5' flanking sequence and the junction sequence can be confirmed using SEQ ID NO:8 or SEQ ID NO:12, and the combined sequences SEQ ID NO:9, SEQ ID NO:13 or SEQ ID NO:34. The 3' flanking sequence and the junction sequence can be confirmed using SEQ ID NO:11 or SEQ ID NO:14, and the combined sequences SEQ ID NO:10, SEQ ID NO:15 or SEQ ID NO:37. The PCR reaction systems and amplification conditions are shown in Tables 3 and 4. Those skilled in the art will understand that other primer sequences can also be used to confirm the flanking sequences and the junction sequences.

[0118] DNA sequencing of the PCR product provides DNA that can be used to design other DNA molecules that serve as primers and probes for the identification of soybean plants or seeds derived from the transgenic soybean event LP207-1.

[0119] It was found that positions 1-514 of nucleotide sequence SEQ ID NO:5 show the soybean genomic sequence flanking the right border (5' flanking sequence) of the insertion sequence in transgenic soybean event LP207-1, and positions 13923-14370 of nucleotide sequence SEQ ID NO:5 show the soybean genomic sequence flanking the left border (3' flanking sequence) of the insertion sequence in transgenic soybean event LP207-1. The 5' junction sequence is listed in sequence SEQ ID NO:1, and the 3' junction sequence is listed in sequence SEQ ID NO:2.

[0120] 3.3, PCR junction assay The junction sequence is a relatively short polynucleotide molecule, which is a new DNA sequence and is diagnostic for the DNA of transgenic soybean event LP207-1 when detected in a polynucleotide detection assay. The binding sequence of sequence SEQ ID NO:1 consists of 10 bp each on one side of the insertion site of the T-DNA RB region of transgenic soybean event LP207-1 and the insertion site of soybean genomic DNA. The binding sequence of sequence SEQ ID NO:2 consists of 10 bp each on the other side of the insertion site of the T-DNA LB region of transgenic soybean event LP207-1 and the insertion site of soybean genomic DNA. Longer or shorter polynucleotide junction sequences can be selected from sequence SEQ ID NO:3 or SEQ ID NO:4. The junction sequences (5' junction region SEQ ID NO:1 and 3' junction region SEQ ID NO:2) are useful as DNA probes or as DNA primer molecules in DNA detection methods. The junction sequences SEQ ID NO:6 and SEQ ID NO:7 are also new DNA sequences in transgenic soybean event LP207-1, and they can also be used as DNA probes or as DNA primer molecules to detect the presence of transgenic soybean event LP207-1 DNA. The sequence SEQ ID NO:6 (nucleotides 515-1080 of SEQ ID NO:3) spans the LP207 construct DNA sequence and the pAtUbi10 transcriptional promoter sequence, and the sequence SEQ ID NO:7 (nucleotides 1-612 of SEQ ID NO:4) spans the tPsE9 transcriptional termination sequence and the LP207 construct DNA sequence.

[0121] In addition, diagnostic amplicons of transgenic soybean event LP207-1 are generated by using primers from at least one of SEQ ID NO:3 or SEQ ID NO:4, which generate diagnostic amplicons of transgenic soybean event LP207-1 when used in a PCR method.

[0122] Specifically, a PCR product is generated from the 5'-end of the transgenic insertion sequence, which is a part of the genomic DNA flanking the 5'-end of the T-DNA insertion sequence in the genome of plant material from transgenic soybean event LP207-1. This PCR product contains SEQ ID NO:3. For PCR amplification, primer 11 (SEQ ID NO:8) that hybridizes to the genomic DNA sequence flanking the 5'-end of the transgenic insertion sequence and primer 12 (SEQ ID NO:9) located in the transgenic pAtUbi10 transcriptional promoter sequence are designed.

[0123] A PCR product is generated from the 3'-end of the transgenic insertion sequence, which contains a part of the genomic DNA flanking the 3'-end of the T-DNA insertion sequence in the genome of plant material from transgenic soybean event LP207-1. This PCR product contains SEQ ID NO:4. For PCR amplification, primer 14 (SEQ ID NO:11) that hybridizes to the genomic DNA sequence flanking the 3'-end of the transgenic insertion sequence and primer 13 (SEQ ID NO:10) located in the tNos transcriptional termination sequence at the 3'-end of the insert are designed.

[0124] The DNA amplification conditions described in Tables 3 and 4 can be used for the above PCR junction assays to generate diagnostic amplicons of transgenic soybean event LP207-1. Detection of the amplicons can be performed by using a Stratagene Robocycle, MJ Engine, Perkin-Elmer 9700, or Eppendorf Mastercycler Gradient thermal cycler, etc., or by methods and equipment known to those skilled in the art.

[0125] Table 3. 5'-Transgenic Insert / Genomic Junction Region for Transgenic Soybean Event LP207-1 Identified PCR Steps and Reaction Mixture Conditions

[0126] Table 4. Perkin-Elmer 9700 Thermal Cycler Conditions

[0127] Mix gently. If there is no thermal cover on the thermal cycler, add 1 - 2 drops of mineral oil above each reaction mixture. Perform PCR using the above cycling parameters (Table 4) on a Stratagene Robocycler (Stratagene, La Jolla, CA), MJ Engine (MJ R - Biorad, Hercules, CA), Perkin - Elmer 9700 (Perkin Elmer, Boston, MA), or Eppendorf Mastercycler Gradient (Eppendorf, Hamburg, Germany) thermal cycler. The MJ Engine or Eppendorf Mastercycler Gradient thermal cycler should be run in the calculated mode. The Perkin - Elmer 9700 thermal cycler should be run with the ramp speed set to the maximum value.

[0128] The experimental results showed that primers 11 and 12 (sequences SEQ ID NO:8 and 9), when used in the PCR reaction of transgenic soybean event LP207 - 1 genomic DNA, produced an amplification product of a 1080 - bp fragment, and when used in the PCR reactions of untransformed soybean genomic DNA and non - LP207 - 1 soybean genomic DNA, no fragment was amplified; primers 13 and 14 (sequences SEQ ID NO:10 and 11), when used in the PCR reaction of transgenic soybean event LP207 - 1 genomic DNA, produced an amplification product of a 1060 - bp fragment, and when used in the PCR reactions of untransformed soybean genomic DNA and non - LP207 - 1 soybean genomic DNA, no fragment was amplified.

[0129] The PCR zygosity assay can also be used to identify whether the material derived from transgenic soybean event LP207 - 1 is homozygous or heterozygous. Use primer 15 (sequence SEQ ID NO:12), primer 16 (sequence SEQ ID NO:13), and primer 17 (sequence SEQ ID NO:14), or primer 16 (sequence SEQ ID NO:13), primer 17 (sequence SEQ ID NO:14), and primer 18 (sequence SEQ ID NO:15) in the amplification reaction to generate diagnostic amplicons of transgenic soybean event LP207 - 1. The DNA amplification conditions described in Tables 5 and 6 can be used for the above zygosity test to generate diagnostic amplicons of transgenic soybean event LP207 - 1.

[0130] Table 5. Zygosity assay reaction mixture

[0131] Table 6. Conditions of the Perkin-Elmer 9700 thermal cycler for the conjugation assay

[0132] PCR was performed on a Stratagene Robocycler (Stratagene, La Jolla, CA), an MJ Engine (MJ R-Biorad, Hercules, CA), a Perkin-Elmer 9700 (Perkin Elmer, Boston, MA), or an Eppendorf Mastercycler Gradient (Eppendorf, Hamburg, Germany) thermal cycler using the above cycling parameters (Table 6). The MJ Engine or Eppendorf Mastercycler Gradient thermal cycler should be run in the calculated mode. The Perkin-Elmer 9700 thermal cycler should be run with the ramp speed set to the maximum value when operating.

[0133] In the amplification reaction, a biological sample containing template DNA contains DNA for diagnosing the presence of the transgenic soybean event LP207-1 in the sample. Alternatively, the reaction will produce two different DNA amplicons from a biological sample containing DNA from the soybean genome, and the DNA from the soybean genome is heterozygous with respect to the allele corresponding to the inserted DNA present in the transgenic soybean event LP207-1. These two different amplicons will correspond to a first amplicon from the wild-type soybean genomic locus and a second amplicon for diagnosing the presence of the transgenic soybean event LP207-1 DNA. A soybean DNA sample that produces only a single amplicon corresponding to the second amplicon described for the heterozygous genome can be diagnostically determined to have the transgenic soybean event LP207-1 present, and the sample is produced from soybean seeds that are homozygous with respect to the allele corresponding to the inserted DNA present in the transgenic soybean plant LP207-1.

[0134] Note that the primer pairs for the transgenic soybean event LP207-1 were used to generate amplicons diagnostic for the genomic DNA of the transgenic soybean event LP207-1. These primer pairs include, but are not limited to, primer 11 and 12 (sequences SEQ ID NO:8 and 9), and primer 13 and 14 (sequences SEQ ID NO:10 and 11), for use in the DNA amplification method described. Additionally, a control primer 9 and 10 (sequences SEQ ID NO:28 and SEQ ID NO:29) for amplifying a soybean endogenous gene was included as an internal standard for the reaction conditions. The analysis of the DNA extraction samples of the transgenic soybean event LP207-1 should include a positive tissue DNA extract control of the transgenic soybean event LP207-1, a negative DNA extract control from a non-transgenic soybean event LP207-1, and a negative control without a template soybean DNA extract. In addition to these primer pairs, any primer pairs from sequences SEQ ID NO:3 or SEQ ID NO:4, or their complementary sequences, can be used when they are used in the DNA amplification reaction to respectively generate amplicons containing sequences SEQ ID NO:1 or SEQ ID NO:2 that are diagnostic for tissues from transgenic event soybean plants LP207-1. The DNA amplification conditions described in Tables 4-6 can be used to generate diagnostic amplicons of the transgenic soybean event LP207-1 using appropriate primer pairs. Extracts presumptively containing soybean plant or seed DNA of the transgenic soybean event LP207-1, or products derived from the transgenic soybean event LP207-1, that generate amplicons diagnostic for the transgenic soybean event LP207-1 when tested in the DNA amplification method can be used as templates for amplification to determine the presence of the transgenic soybean event LP207-1.

[0135] Example 4 Detection of Transgenic Soybean Event LP207-1 by Southern Blot Hybridization 4.1 DNA Extraction for Southern Blot Hybridization Southern blot analysis was performed using homozygous T4 and T5 generation transformation events. Using a mortar and pestle, approximately 5 to 10 g of plant tissue was ground in liquid nitrogen. The plant tissue was resuspended in 12.5 mL of extraction buffer A (0.2 M Tris pH = 8.0, 50 mM EDTA, 0.25 M NaCl, 0.1% v / v β-mercaptoethanol, 2.5% w / v polyvinyl-pyrrolidone) and centrifuged at 4000 rpm for 10 minutes (2755 g). After discarding the supernatant, the pellet was resuspended in 2.5 mL of extraction buffer B (0.2 M Tris pH = 8.0, 50 mM EDTA, 0.5 M NaCl, 1% v / v β-mercaptoethanol, 2.5% w / v polyvinyl-pyrrolidone, 3% sarcosyl, 20% ethanol) and incubated at 37 °C for 30 minutes. During incubation, the sample was mixed once with a sterile loop. After incubation, an equal volume of chloroform / isoamyl alcohol (24:1) was added, gently mixed by inverting, and centrifuged at 4000 rpm for 20 minutes. The aqueous layer was collected, and DNA was precipitated by centrifuging at 4000 rpm for 5 minutes after adding 0.54 volume of isopropanol. The supernatant was discarded, and the DNA pellet was resuspended in 500 μL of TE. To degrade any RNA present, the DNA was incubated with 1 μL of 30 mg / mL RNase A at 37 °C for 30 minutes, centrifuged at 4000 rpm for 5 minutes, and DNA was precipitated by centrifuging at 14000 rpm for 10 minutes in the presence of 0.5 volume of 7.5 M ammonium acetate and 0.54 volume of isopropanol. After discarding the supernatant, the pellet was washed with 500 μL of 70% ethanol and dried before resuspending in 100 μL of TE.

[0136] 4.2, Restriction Enzyme Digestion The DNA concentration was quantitatively detected using a spectrophotometer or fluorometer (using 1× TAE and GelRED dye). In a 100 μL reaction system, 5 μg of DNA was digested each time. With restriction enzymes SnaB I and Mfe I digested genomic DNA, using a partial sequence of Cry1Fa on the T-DNA as a probe; with restriction enzymes Sph I and Sac I digested genomic DNA, using a partial sequence of PAT on the T-DNA as a probe; with restriction enzymes Sac I and Hind III digested genomic DNA respectively, using partial sequences of Cry1Ab and EPSPS on the T-DNA as probes. For each enzyme, the digest was incubated overnight at the appropriate temperature. The sample was spun down using a speed vacuum to reduce the volume to 30 μL.

[0137] 4.3, Gel Electrophoresis Add bromophenol blue loading dye to each sample from Example 4.2, and load each sample onto a 0.7% agarose gel containing ethidium bromide, electrophoretically separate in TBE electrophoresis buffer, and electrophorese the gel overnight at 20 volts.

[0138] Wash the gel in 0.25 M HCl for 15 minutes to depurinate the DNA, and then wash with water. Set up the Southern blot hybridization as follows: Place 20 thick dry blotting papers in a tray, and then place 4 thin dry blotting papers on top. Pre-wet 1 thin blotting paper in 0.4 M NaOH and place it on the stack of papers, then place a Hybond-N+ transfer membrane (Amersham Pharmacia Biotech, #RPN303B) pre-wet in 0.4 M NaOH on top. Place the gel on the upper part, ensuring there are no air bubbles between the gel and the membrane. 3 additional pre-soaked blotting papers are placed on top of the gel, and the buffer tray is filled with 0.4 M NaOH. Connect the gel stack and the buffer tray with a wick pre-soaked in 0.4 M NaOH to transfer the DNA to the membrane. Carry out the DNA transfer at room temperature for about 4 hours. After the transfer, rinse the Hybond membrane in 2×SSC for 10 seconds, and bind the DNA to the membrane by UV cross-linking.

[0139] 4.4, Hybridization Suitable DNA sequences were amplified by PCR for probe preparation. The DNA probes were sequences SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32 and SEQ ID NO:33, or were partially homologous or complementary to the above sequences. 25 ng of probe DNA was boiled in 45 μL of TE for 5 minutes, placed on ice for 7 minutes, and then transferred to a RediprimeⅡ (Amersham Pharmacia Biotech, #RPN1633) tube. After adding 5 μl of 32P-labeled dCTP to the Rediprime tube, the probe was incubated at 37 °C for 15 minutes. The probe was purified by centrifugation through a MicroSpin G-50 column (Amersham Pharmacia Biotech, #27-5330-01) according to the manufacturer's instructions to remove unincorporated dNTPs. The probe activity was measured using a scintillation counter. The Hybond membrane was prehybridized by wetting it with 20 mL of pre-warmed Church prehybridization solution (500 mM Na3P04, 1 mM EDTA, 7% SDS, 1% BSA) at 65 °C for 30 minutes. The labeled probe was boiled for 5 minutes and placed on ice for 10 minutes. An appropriate amount of probe (1 million counts per 1 mL of prehybridization buffer) was added to the prehybridization buffer, and hybridization was carried out overnight at 65 °C. The next day, the hybridization buffer was discarded, and after rinsing with 20 mL of Church wash solution 1 (40 mM Na3P04, 1 mM EDTA, 5% SDS, 0.5% BSA), the membrane was washed in 150 mL of Church wash solution 1 at 65 °C for 20 minutes. This process was repeated 2 times with Church wash solution 2 (40 mM Na3P04, 1 mM EDTA, 1% SDS). The membrane was exposed to a phosphor screen or X-ray film to detect the position of probe binding.

[0140] Each Southern included two control samples: (1) DNA from negative (untransformed) segregants, which was used to identify any endogenous soybean sequences that could hybridize to the element-specific probe; (2) DNA from positive segregants, into which Hin dIII-digested pLP207 was introduced, and the amount was equivalent to one copy number based on the probe length to demonstrate the sensitivity of the experiment in detecting a single gene copy within the soybean genome.

[0141] The hybridization data provided conclusive evidence to support the TaqMan TM PCR analysis, i.e., the soybean plant LP207-1 contained Cry1Fa , PAT , Cry1Ab and EPSPS gene as a single copy. Using this Cry1Fa probe,SnaB I and Mfe I digestion respectively produced single bands with sizes of approximately 4.1 kb and 9.5 kb; using the PAT probe, Sph I and Sac I digestion respectively produced single bands with sizes of approximately 17.6 kb and 10.6 kb; using the Cry1Ab probe, Sac I and Hind III digestion respectively produced single bands with sizes of approximately 10.6 kb and 9.7 kb; using the EPSPS probe, Sac I and Hind III digestion respectively produced single bands with sizes of approximately 18.7 kb and 9.7 kb. This indicates that one copy of each of Cry1Ab, PAT, Cry1Fa, and EPSPS exists in the soybean transformation event LP207-1.

[0142] Example 5 Insect Resistance Detection 5.1 Bioassay of Soybean Plant LP207-1 Two plants each of the transgenic soybean event LP207-1 and wild-type soybean plants (non-transgenic, transformation recipient control (CK-)) were bioassayed against the soybean pod borer ( Leguminivora glycinivorella ), Spodoptera frugiperda ( Spodoptera frugiperda ), Spodoptera litura ( Spodoptera litura ), Helicoverpa armigera ( Helicoverpa armigera ), and Spodoptera exigua ( Spodoptera exigua ) according to the following method: Fresh leaves (at the V3-V4 stage) were taken from two plants each of the transgenic soybean event LP207-1 and wild-type soybean plants (non-transgenic, transformation recipient control (CK-)), rinsed thoroughly with sterile water and the water on the leaves was blotted dry with absorbent paper. Then the leaf veins were removed from the soybean leaves, and at the same time, the leaves were cut into strips approximately 1 cm × 2 cm in size. 1-3 strips (the number of strips was determined according to the food consumption of the insects) of the cut leaves were placed on the filter paper at the bottom of a round plastic petri dish, and the filter paper was moistened with distilled water. 10 newly hatched larvae reared artificially were introduced into each petri dish. After covering the petri dishes for the insect test, the results were counted after placing them for 5 days under the conditions of a temperature of 26-28 °C, a relative humidity of 70%-80%, and a photoperiod (light / dark) of 16:8. The mortality rate (mortality rate = (number of dead insects / number of tested insects) × 100%) was counted to identify the resistance level, and the results are shown in Table 7 and Figure 3 as follows.

[0143] Table 7. In vitro insect resistance bioassay results of transgenic soybean event LP207-1 - Mortality rate (%) Insect / Plant LP207-1 CK- Helicoverpa armigera 100 1 Spodoptera exigua 100 2 Spodoptera frugiperda 100 1 Spodoptera litura 100 1 Leguminivora glycinivorella 100 2 5.2 Determination of the Field Insect Resistance Effect of Transgenic Soybean Event LP207-1 (1) Helicoverpa armigera Artificial insect inoculation was carried out on transgenic soybean event LP207-1 at the seedling stage of soybean. A total of 2 inoculations were carried out. On the front side of each soybean leaf, 20 newly hatched larvae reared artificially were inoculated. Three days after the first inoculation, the second inoculation was carried out with the same number of insects as the first time. Fourteen to twenty-one days after the inoculation, the leaf damage rate, the number of surviving larvae per leaf, and the damaged length of the leaf were investigated plant by plant. Usually, the investigation starts 14 days after the inoculation. If the damage level of the negative control material (CK-) reaches susceptible or highly susceptible, it is considered effective. If it does not reach the corresponding level, the investigation can be postponed appropriately, but if it still does not reach the corresponding level 21 days after the inoculation, this inoculation is considered invalid. According to the leaf damage rate and the number of surviving larvae, the average damage level of Helicoverpa armigera to soybean leaves at the seedling stage in each plot was statistically calculated according to the standard in Table 8, and the resistance level of soybean at the seedling stage to Helicoverpa armigera was judged according to the standard in Table 9. The resistance results of transgenic soybean event LP207-1 to Helicoverpa armigera at the seedling stage are as Figure 4 shown in Table 10. The results show that transgenic soybean event LP207-1 has a relatively high resistance level to Helicoverpa armigera, and the leaf damage rate, the number of surviving larvae, and the leaf damage level of transgenic soybean event LP207-1 are all significantly lower than those of the transformation receptor control (CK-).

[0144] Table 8. Classification Criteria for the Damage Degree of Soybean Leaves by Helicoverpa armigera Degree of leaf damage Symptom description 0 No insects, leaves flat 1 Sparse distribution of Helicoverpa armigera on leaves, no damage symptoms on leaves 3 A small amount of Helicoverpa armigera on the terminal leaf and tender stem, no obvious damage symptoms on leaves 5 More Helicoverpa armigera on the terminal leaf and tender stem, gnawed leaf spots appear 7 Terminal leaf and tender stem covered with Helicoverpa armigera, large gnawed area 9 Extremely large number of Helicoverpa armigera on the whole plant, leaves severely gnawed, plant short Table 9. Resistance Evaluation Criteria for Soybean Leaves to Helicoverpa armigera Average value of degree of leaf damage Resistance type 0-1.0 High resistance (HR) 1.1-3.0 Resistant (R) 3.1-5.0 Moderate resistance (MR) 5.1-7.0 Susceptible (S) ≥7.1 Highly susceptible (HS) Table 10. Resistance Results of Transgenic Soybean Event LP207-1 to Helicoverpa armigera at the Seedling Stage Item / Plant LP207-1 CK- Leaf damage rate (%) 0 100 Number of surviving larvae 0 15 Degree of leaf damage 0 6.5 Resistance level High resistance Susceptible (2) Spodoptera exigua In March 2023, a field natural insect infection experiment of Spodoptera exigua was carried out on transgenic soybeans in Yazhou District, Sanya City, Hainan Province. Ten to fifteen days after the initial insect pest occurrence, and when the control (CK-) plants were mostly damaged by 4-6 instar high-instar larvae, the damage rate of Spodoptera exigua to soybean plants was investigated plant by plant. The resistance results of transgenic soybean event LP207-1 to Spodoptera exigua are as Figure 5 shown in Table 11. The results show that under the natural occurrence conditions of Spodoptera exigua, compared with the control (CK-), the damage rate of Spodoptera exigua to transgenic soybean event LP207-1 is significantly reduced, indicating that transgenic soybean event LP207-1 has a relatively high resistance to Spodoptera exigua.

[0145] Table 11. Resistance Results of Transgenic Soybean Event LP207-1 to Spodoptera exigua under Natural Insect Infection Conditions Item / Plant LP207-1 CK- Damage rate (%) 0 97 (3) Spodoptera frugiperda In March 2023, a field natural infestation experiment of Spodoptera frugiperda was conducted in the transgenic soybean planting base in Yazhou District, Sanya City, Hainan Province. Ten to fifteen days after the initial pest infestation, and when the transformation receptor control (CK-) was mostly damaged by 4-6 instar larvae, the damage rate of Spodoptera frugiperda to soybean plants was investigated plant by plant. The resistance results of transgenic soybean event LP207-1 to Spodoptera frugiperda are as Figure 6 shown in Table 12. The results showed that under natural occurrence conditions of Spodoptera frugiperda, compared with the control (CK-), the damage rate of Spodoptera frugiperda to transgenic soybean event LP207-1 was significantly reduced, indicating that transgenic soybean event LP207-1 has high resistance to Spodoptera frugiperda.

[0146] Table 12. Resistance results of transgenic soybean event LP207-1 to Spodoptera frugiperda under natural infestation conditions Item / Plant LP207-1 CK- Damage rate (%) 0 95 (4) Spodoptera litura In March 2023, a field natural infestation experiment of Spodoptera litura was conducted in the transgenic soybean planting base in Yazhou District, Sanya City, Hainan Province. Ten to fifteen days after the initial pest infestation, and when the transformation receptor control (CK-) was mostly damaged by 4-6 instar larvae, the damage rate of Spodoptera litura to soybean plants was investigated plant by plant. The resistance results of transgenic soybean event LP207-1 to Spodoptera litura are shown in Table 13. The results showed that under natural occurrence conditions of Spodoptera litura, compared with the control (CK-), the damage rate of Spodoptera litura to transgenic soybean event LP207-1 was significantly reduced, indicating that transgenic soybean event LP207-1 has high resistance to Spodoptera litura.

[0147] Table 13. Resistance results of transgenic soybean event LP207-1 to Spodoptera litura under natural infestation conditions Item / Plant LP207-1 CK- Damage Rate (%) 0 98 (5) Leguminivora glycinivorella In March 2023, a field natural infestation experiment of Leguminivora glycinivorella was conducted in the transgenic soybean planting base in Yazhou District, Sanya City, Hainan Province. Ten to fifteen days after the initial pest infestation, and when the transformation receptor control (CK-) was mostly damaged by 4-6 instar larvae, the damage rate of Leguminivora glycinivorella to soybean plants was investigated plant by plant. The resistance results of transgenic soybean event LP207-1 to Leguminivora glycinivorella are shown in Table 14. The results showed that under natural occurrence conditions of Leguminivora glycinivorella, compared with the control (CK-), the damage rate of Leguminivora glycinivorella to transgenic soybean event LP207-1 was significantly reduced, indicating that transgenic soybean event LP207-1 has high resistance to Leguminivora glycinivorella.

[0148] Table 14. Resistance Results of Transgenic Soybean Event LP207-1 to Leguminivora glycinivorella under Natural Insect Infestation Conditions Item / Plant LP207-1 CK- Damage Rate (%) 0 95 Example 6. Detection of Glyphosate Herbicide Tolerance of Transgenic Soybean Event LP207-1 In this experiment, Roundup herbicide (41% glyphosate isopropylammonium salt aqueous solution) was selected for spraying. A randomized block design was adopted with 3 replicates. The plot area was 20 m 2 (5 m × 4 m), with 340 seedlings per plot, and conventional cultivation management was carried out. There was a 1 m wide isolation belt between plots. The transgenic soybean event LP207-1 and the transformation receptor control (CK-) were respectively subjected to the following 2 treatments: 1) spraying clear water; 2) spraying Roundup herbicide at a dose of 3360 g a.e. / ha at the V3 leaf stage, and then spraying Roundup herbicide again at the same dose at the V8 stage. It should be noted that glyphosate herbicides with different contents and formulations are converted into the form of equivalent glyphosate acid and applied to the following conclusions. The phytotoxicity symptoms were investigated 1 week and 2 weeks after the application of the drug, and the yield of each plot was measured at harvest. The grading standard for phytotoxicity symptoms is shown in Table 15. The herbicide injury rate was used as an index to evaluate the herbicide tolerance of the transformation event. Specifically, the herbicide injury rate (%) = ∑(the number of plants damaged at the same level × the level number) / (the total number of plants × the highest level) × 100; where the herbicide injury rate refers to the glyphosate injury rate, and the glyphosate injury rate is determined based on the phytotoxicity investigation results 2 weeks after the glyphosate treatment. The soybean yield of each plot was the total yield (weight) of the soybean grains in the middle 3 rows of each plot, and the yield difference between different treatments was measured in the form of a yield percentage. The yield percentage (%) = spraying yield / spraying clear water yield × 100. The results of the herbicide tolerance of transgenic soybean event LP207-1 and the soybean yield results are as Figure 7 shown in Table 16.

[0149] Table 15. Grading Standard for the Degree of Phytotoxicity of Glyphosate Herbicide to Soybeans Herbicide Injury Level Symptom Description Level 0 No herbicide injury, growth is the same as the water control; Level 1 Slight herbicide injury symptoms are slightly visible, local color change, and the herbicide injury spots account for less than 10% of the leaf area; Level 2 Growth is slightly inhibited or chlorosis occurs, and the herbicide injury spots account for less than 1 / 4 of the leaf area; Level 3 Great impact on growth and development, leaf deformity or plant dwarfing or the herbicide injury spots account for less than 1 / 2 of the leaf area Level 4 Great impact on growth and development, severe leaf deformity or obvious plant dwarfing or the herbicide injury spots account for less than 3 / 4 of the leaf area; Level 5 Extremely severe herbicide injury, plant death or the herbicide injury spots account for more than 3 / 4 of the leaf area. Table 16. Results of the Herbicide Tolerance of Transgenic Soybean Event LP207-1 to Glyphosate Herbicide and Soybean Yield Results Item / Plant LP207-1 CK- Damage Rate (%) (spraying water) 0 0 Damage Rate of Glyphosate (%) (3360 g a.e. / ha) 0 100 Yield Percentage % (3360 g a.e. / ha) 102 0 The results showed that in terms of the herbicide (glyphosate) injury rate: 1) The injury rate of transgenic soybean event LP207-1 was basically 0 under the treatment of glyphosate herbicide (3360 g a.e. / ha). Therefore, transgenic soybean event LP207-1 has good glyphosate herbicide tolerance.

[0150] In terms of yield: There was no significant difference in the yield of the genetically modified soybean event LP207-1 under the two treatments of spraying clear water and spraying glyphosate at 3360 g a.e. / ha. After spraying the glyphosate herbicide, the yield of the genetically modified soybean event LP207-1 basically did not decrease. Thus, it further indicates that the genetically modified soybean event LP207-1 has good tolerance to glyphosate herbicide.

[0151] Example 7 Detection of the tolerance of the genetically modified soybean event LP207-1 to glufosinate herbicide In this experiment, the herbicide Basta (glufosinate) was selected for spraying. A randomized block design was adopted with 3 replicates. The plot area was 20 m 2 (5 m × 4 m), with 350 plants per plot, and conventional cultivation management was carried out. There was a 1 m wide isolation belt between plots. The genetically modified soybean event LP207-1 was subjected to the following two treatments: 1) No spraying; 2) Spraying Basta herbicide at a dose of 1680 g a.e. / ha at the V3 leaf stage, and then spraying Basta herbicide again at the same dose at the V8 stage. It should be noted that different contents and formulations of glufosinate herbicides are converted into the form of equivalent glufosinate acid and applied to the following conclusions. The phytotoxicity symptoms were investigated 1 week and 2 weeks after applying the herbicide, and the yield of each plot was measured at harvest. The classification criteria for the phytotoxicity of the herbicide are shown in Table 17. The herbicide injury rate was used as an index to evaluate the tolerance of the transgenic event to the herbicide. Specifically, the herbicide injury rate (%) = ∑(the number of plants damaged at the same level × the level number) / (the total number of plants × the highest level); where the herbicide injury rate refers to the glufosinate injury rate, and the glufosinate injury rate was determined based on the phytotoxicity investigation results 2 weeks after the glufosinate treatment. The soybean yield of each plot was the total yield (weight) of the soybean grains in the middle 3 rows of each plot. The yield difference between different treatments was measured in the form of a yield percentage, and the yield percentage (%) = the yield of spraying / the yield of non-spraying. The results of the tolerance of the genetically modified soybean event LP207-1 to glufosinate herbicide and the soybean yield results are as Figure 8 shown in Table 18.

[0152] Table 17 Classification criteria for the phytotoxicity of glufosinate herbicide to soybeans Herbicide Injury Level Symptom Description Level 0 No herbicide injury, growth is the same as the water control; Level 1 Slight burning appears at the leaf base, and the burning area is less than or equal to 10%; Level 2 Obvious burning appears at the leaf base, and the burning area is greater than 10%. There may be slight curling of the leaves or tilting of the plants, and it can recover within 14 days; Level 3 The plant leaves are deformed, or the plants grow obliquely and have not recovered after 14 days; the leaves break off from the herbicide injury site; Level 4 The plants are severely deformed; the leaves wilt and dry up; Table 18 Results of the tolerance of the genetically modified soybean event LP207-1 to glufosinate herbicide and soybean yield results Item / Plant LP0207-1 CK- Damage Rate of Glufosinate (%) 0 0 Damage Rate of Glufosinate (%) (Basta 1680g a.e. / ha, recommended application rate 200 - 300ml / mu) 0 100 Yield Percentage % (Basta 1680g a.e. / ha, recommended application rate 200 - 300ml / mu) 101 0 The results show that in terms of the injury rate of the herbicide (glufosinate): 1) The injury rate of the genetically modified soybean event LP207-1 was basically 0 under the treatment of glufosinate herbicide (1680 g a.e. / ha). Thus, the genetically modified soybean event LP207-1 has good tolerance to glufosinate herbicide.

[0153] In terms of yield: There was no significant difference in the yield of the transgenic soybean event LP207-1 under the two treatments of no spraying and spraying glufosinate ammonium at 1680 g a.e. / ha. After spraying the glufosinate ammonium herbicide, the yield of the transgenic soybean event LP207-1 basically did not decrease. Thus, it further indicates that the transgenic soybean event LP0207-1 has good tolerance to glufosinate ammonium herbicide.

[0154] In summary, through TaqMan TM analysis (see Example 2), it was detected whether the regenerated transgenic soybean plants contained cry1Ab, cry1Fa, epsps and pat genes, and the copy numbers of the insect-resistant and glyphosate- and glufosinate-ammonium herbicide-tolerant lines were characterized. According to the copy number of the target gene, good insect resistance, glyphosate- and glufosinate-ammonium herbicide tolerance, and agronomic trait performance (see Examples 5 and 6), through screening, the transgenic soybean event LP207-1 was selected as excellent, which has a single-copy transgene, good insect resistance, glyphosate- and glufosinate-ammonium herbicide tolerance, and agronomic trait performance.

[0155] The above are only the preferred embodiments of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the technical principle of the present invention, several improvements and modifications can be made, and these improvements and modifications should also be regarded as the protection scope of the present invention.

Claims

1. A nucleic acid sequence for detecting transgenic soybean event LP207-1, characterized in that, The nucleic acid sequence is selected from one or more of SEQ ID NO: 1-7 or its complementary sequences, and the nucleic acid sequence is derived from plants, seeds or cells of the transgenic soybean event LP207-1. A representative sample of the seeds of the transgenic soybean event LP207-1 was deposited at the China Center for Type Culture Collection on May 23, 2025, with the deposit number CCTCC NO: P202516, and the taxonomic name is soybean seed LP207-1 Glycine max L. LP207-1.

2. A DNA primer pair, comprising a first primer and a second primer, characterized in that, When the first primer and the second primer are used together with the DNA containing the transgenic soybean event LP207-1 in an amplification reaction, an amplicon of the transgenic soybean event LP207-1 in the test sample is produced; The first primer is selected from SEQ ID NO: 1 or its complementary sequence, SEQ ID NO: 8 or SEQ ID NO: 12, and the second primer is selected from SEQ ID NO: 2 or its complementary sequence, SEQ ID NO: 11 or SEQ ID NO: 14; or, The first primer is selected from SEQ ID NO: 1 or its complementary sequence, SEQ ID NO: 8 or SEQ ID NO: 12, and the second primer is selected from SEQ ID NO: 9 or SEQ ID NO: 13; or, The first primer is selected from SEQ ID NO: 2 or its complementary sequence, SEQ ID NO: 10 or SEQ ID NO: 15, and the second primer is selected from SEQ ID NO: 11 or SEQ ID NO:

14.

3. A DNA probe, characterized in that, The DNA probe contains the nucleic acid sequence of claim 1, and the DNA probe hybridizes with a DNA molecule containing a nucleic acid sequence selected from SEQ ID NO: 1-7 or its complementary sequence under stringent hybridization conditions and does not hybridize with a DNA molecule that does not contain a nucleic acid sequence selected from SEQ ID NO: 1-7 or its complementary sequence under stringent hybridization conditions; The DNA probe contains a sequence selected from SEQ ID NO: 3 or its complementary sequence, SEQ ID NO: 4 or its complementary sequence; or, The DNA probe contains a sequence selected from SEQ ID NO: 1 or its complementary sequence, SEQ ID NO: 2 or its complementary sequence, SEQ ID NO: 6 or its complementary sequence, and SEQ ID NO: 7 or its complementary sequence.

4. A labeled nucleic acid molecule, characterized in that, The marker nucleic acid molecule contains the nucleic acid sequence of claim 1, and the marker nucleic acid molecule hybridizes with a DNA molecule containing a nucleic acid sequence selected from SEQ ID NO: 1-7 or its complementary sequence under stringent hybridization conditions and does not hybridize with a DNA molecule that does not contain a nucleic acid sequence selected from SEQ ID NO: 1-7 or its complementary sequence under stringent hybridization conditions; The labeled nucleic acid molecule comprises a sequence selected from the sequence SEQ ID NO:3 or its complementary sequence, SEQ ID NO:4 or its complementary sequence; or, The labeled nucleic acid molecule comprises a sequence selected from the sequence SEQ ID NO:1 or its complementary sequence, SEQ ID NO:2 or its complementary sequence, SEQ ID NO:6 or its complementary sequence, and SEQ ID NO:7 or its complementary sequence.

5. A method for detecting the presence of DNA of transgenic soybean event LP207-1 in a sample, characterized in that, Comprising: (1) contacting the sample to be detected with the DNA primer pair according to claim 2 in a nucleic acid amplification reaction; (2) performing a nucleic acid amplification reaction; (3) detecting the presence of the amplification product; The amplification product comprises a nucleic acid sequence selected from the sequences SEQ ID NO:1-7 or its complementary sequence, which indicates the presence of the DNA of the transgenic soybean event LP207-1 in the detected sample.

6. A method for detecting the presence of DNA of transgenic soybean event LP207-1 in a sample, characterized in that, Comprising: (1) contacting the sample to be detected with the DNA probe according to claim 3 and / or the labeled nucleic acid molecule according to claim 4; (2) hybridizing the sample to be detected with the DNA probe and / or the labeled nucleic acid molecule in step (1) under stringent hybridization conditions; (3) detecting the hybridization of the sample to be detected with the probe and / or the labeled nucleic acid molecule in step (1).

7. A DNA detection kit, characterized in that, Comprising: The DNA primer pair according to claim 2, the DNA probe according to claim 3, and / or the labeled nucleic acid molecule according to claim 4.

8. A method for protecting soybean plants from insect attack, characterized in that, Comprising providing at least one transgenic soybean plant cell in the diet of a target insect, wherein the genome of the transgenic soybean plant sequentially comprises the sequence SEQ ID NO:1, the nucleic acid sequence at positions 525-13912 of SEQ ID NO:5, and SEQ ID NO:2; or the genome of the transgenic soybean plant comprises the sequence SEQ ID NO:5; and the target insect feeding on the transgenic soybean plant cell is inhibited from further feeding on the soybean plant.

9. A method for protecting soybean plants from damage caused by herbicides, characterized in that, Planting at least one transgenic soybean plant, wherein the genome of the transgenic soybean plant sequentially comprises the sequence SEQ ID NO:1, the nucleic acid sequence at positions 525-13912 of SEQ ID NO:5, and SEQ ID NO:2; or the genome of the transgenic soybean plant comprises the sequence SEQ ID NO:

5.

10. A method for controlling weeds in a field of soybean plants, characterized in that, Comprising applying an effective dose of glyphosate and / or glufosinate herbicide to a field planted with at least one transgenic soybean plant, wherein the genome of the transgenic soybean plant sequentially comprises the sequence SEQ ID NO:1, the nucleic acid sequence at positions 525-13912 of SEQ ID NO:5, and SEQ ID NO:2; or the genome of the transgenic soybean plant comprises the sequence SEQ ID NO:

5.

11. A processed product derived from the transgenic soybean event LP207-1, characterized in that, The processed product includes soybean meal, soybean oil, soy protein, soy products, dregs, feed or industrial products or commodities, and any other food to be used as a food source for animal consumption, or alternatively as a component of soybean oil or stearic acid for food industrial use.

Images