TET-R expression cassette and cell line

By expressing tetracycline operon repressor protein (TetR) in host cells and using the TetO operon sequence to inhibit toxic polypeptides, the problem of low yield of adenovirus vectors in the prior art is solved, and efficient production and application of adenovirus vectors is achieved.

CN120359300APending Publication Date: 2025-07-22CEVEC PHARMA GMBH
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202380084858.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Priority Date
2022-12-11
Filing Date
2023-12-11
Publication Date
2025-07-22

AI Technical Summary

Technical Problem

The prior art is difficult to efficiently produce non-replicative E1 and/or E3 deletion adenovirus vectors containing toxic transgenes, resulting in extremely low yields.

Method used

By expressing tetracycline operon repressor protein (TetR) in host cells, the expression of toxic polypeptides is inhibited by using the TetO operon sequence, and adenovirus vectors containing the TetR expression cassette are used to achieve vector replication and amplification.

Benefits of technology

Effectively inhibit the expression of toxic polypeptides, improve the yield and quality of adenovirus vectors, and is suitable for vaccination and gene therapy.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0005441780210000311
    Figure BDA0005441780210000311
  • Figure BDA0005441780210000312
    Figure BDA0005441780210000312
  • Figure BDA0005441780210000321
    Figure BDA0005441780210000321
Patent Text Reader

Abstract

The present disclosure relates to cell lines comprising a polynucleotide comprising at least one tetracycline operon repressor protein (TetR) expression cassette for use in the production of recombinant adenovirus (Ad) vectors encoding other toxic transgenes.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present disclosure relates to an adenovirus early region 1 (E1) complementary cell line that contains an integrated polynucleotide that includes at least one tetracycline operator repressor (TetR) expression cassette to permit repression of an E1-deleted adenoviral vector encoding another toxic transgene under a promoter that contains one or more tetracycline operator genes (TetO). Background Art

[0002] A recognized problem in the art is that the production of non-replicating E1- and / or E3-deleted adenoviral vectors ("Ad vectors") containing certain transgenes encoding toxic proteins (as used herein, "toxic" refers to a transgene encoding a protein that, when expressed, interferes with the amplification and / or packaging of viral particles during production using an E1 complementary cell line), such as but not limited to the pro-apoptotic caspase-8 protein-encoding gene, B-cell lymphoma 2 (BCL2)-associated X, Fas cell surface death receptor ligand protein-encoding gene, envelope protein-encoding gene from hepatitis C, envelope protein-encoding gene from HIV, circumsporozoite (CS) protein-encoding gene from Plasmodium, EBO protein-encoding gene from Ebola virus, certain influenza hemagglutinin (HA) protein-encoding genes, spike protein-encoding gene from severe acute respiratory syndrome coronavirus (SARS-CoV1 / 2), or other human or viral protein-encoding genes, is limited. This problem cannot be solved with standard procedures, which results in very low yields. The reagents and methods disclosed herein provide solutions to such recognized problems in the art. Brief Description of the Drawings

[0003] Figure 1 : Sequence of TetR expression cassette #1 (SEQ ID NO:1). The CAG / chimeric intron sequence is underlined singly; the TetR gene sequence is in bold characters, and the BGH polyA sequence is underlined doubly.

[0004] Figure 2 : Sequence of the CAG promoter / chimeric intron (SEQ ID NO:2).

[0005] Figure 3 : Sequence of the TetR gene (SEQ ID NO:3).

[0006] Figure 4 : Sequence of the BGH polyA (SEQ ID NO:4).

[0007] Figure 5: Sequence of TetR expression cassette #2 (SEQ ID NO:5). The CAG / chimeric intron sequence is indicated by single underlining; the TetR gene sequence is in bold characters, and the SV40 polyA sequence is indicated by double underlining.

[0008] Figure 6 : Sequence of SV40 polyA (SEQ ID NO:6).

[0009] Figure 7 : Sequence of TetR expression cassette #3 (SEQ ID NO:7). The CMV promoter sequence is indicated by single underlining; the β-globin intron sequence is in lowercase letters; the TetR gene sequence is in bold characters, and the BGH polyA sequence is indicated by double underlining.

[0010] Figure 8 : Sequence of CMV promoter (SEQ ID NO:8).

[0011] Figure 9 : Sequence of β-globin intron (SEQ ID NO:9).

[0012] Figure 10 : Sequence of TetR expression cassette #4 (SEQ ID NO:10).

[0013] Figure 11 : Sequence of TetR expression cassette #5 (SEQ ID NO:11).

[0014] Figure 12 : Sequence of TetR expression cassette #6 (SEQ ID NO:12).

[0015] Figure 13 : Sequence of TetR expression cassette #7 (SEQ ID NO:13).

[0016] Figure 14 : Detection of TetR in CAP-TetR cells Z3634 and Z3635 by Western blot.

[0017] Figure 15 : Detection of TetR in CAP-TetR cells C235 and C236 by Western blot.

[0018] Figure 16 : Detection of TetR in CAP-TetR cells Z3616, Z3617 and Z3618 by Western blot.

[0019] Figure 17: Synthesized 2XTetO-coCA09 DNA fragment (SEQ ID NO:14). The double TetO sequences are shown in bold and italics, and the coCA09 HA sequence (codon-optimized HA gene of influenza A (H1N1)pdm09 virus) is underlined. Detailed implementation

[0020] As described above, the problems recognized in the art that the subject matter of the present disclosure addresses relate to production limitations encountered with non-replicating E1 and / or E3-deleted adenoviral vectors (“Ad vectors”) expressing certain toxic transgenes. As used herein, “toxic” refers to a transgene that, upon expression, produces a polypeptide (“toxic polypeptide”) that interferes with the amplification and / or packaging of viral particles during production using an E1-complementary cell line. In embodiments, the transgene is inserted into the E1 position of the Ad vector. In some embodiments, the toxic polypeptide may be derived from an organism selected from the group consisting of Actinomyces, Anabaena, Bacillus (e.g., Bacillus anthracis, e.g., protective antigen, lethal factor, or edema factor), Bacteroides, Bordetella (e.g., Bordetella pertussis, e.g., adenylate cyclase toxin or pertussis toxin), Caulobacter, Chlamydia, Chlorobium, Chromatium, Clostridium (e.g., Clostridium perfringens, e.g., perfringolysin), Clostridium botulinum, e.g., botulinum toxin), or Clostridium tetani, e.g., tetanus toxin)), Corynebacterium diphtheriae (e.g., diphtheria toxin), Cytophaga, Deinococcus, Escherichia (e.g., Escherichia coli, e.g., ST toxin or LT toxin), Halobacterium, Helicobacter, Hyphomicrobium, Methanobacterium, Micrococcus, Mycobacterium, Mycoplasma, Myxococcus, Neisseria, Nitrobacter, Oscillatoria, Prochloron, Proteus, Pseudomonas (e.g., Pseudomonas aeruginosa, e.g., exotoxin A), Rhodospirillum, Rickettsia, Salmonella, Shigella (e.g., Shigella dysenteriae, e.g., shiga toxin), Spirillum, Spirochaeta, Staphylococcus (e.g., Staphylococcus aureus, e.g., enterotoxin, toxic shock syndrome toxin, or exfoliative toxin), Streptococcus (e.g., Streptococcus pyogenes, e.g., erythrogenic toxin), Streptomyces, Sulfolobus, Thermoplasma, Thiobacillus, Treponema, Vibrio cholerae (e.g., cholera enterotoxin), Sporozoa (e.g., Plasmodium), Ciliophora, Rhizopoda, Zoomastigina. Preferably, the parasite belongs to the phylum Apicomplexa and the genus Plasmodium (e.g.,Circumsporozoite protein (CSP), sporozoite surface protein 2 (SSP2), liver stage antigen 1 (LSA-1), Pf exported protein 1 (PfExp-1) / Py hepatocyte erythrocyte protein 17 (PyHEP17), Pf antigen 2, merozoite surface protein 1 (MSP-1), merozoite surface protein 2 (MSP-2), erythrocyte binding antigen 175 (EBA-175), ring-infected erythrocyte surface antigen (RESA), serine repeat antigen (SERA), glycophorin binding protein (GBP-130), histidine-rich protein 2 (HRP-2), rhoptry-associated proteins 1 and 2 (RAP-1 and RAP-2), Plasmodium falciparum erythrocyte membrane protein 1 (PfEMP1) or apical membrane antigen 1 (AMA-1)), Arenaviridae, Arterivirus, Astroviridae, Baculoviridae, Baculodnavirus, Baculoribovirus, Birnaviridae, Bromoviridae, Bunyaviridae, Caliciviridae, Capillovirus, Carlavirus, Caulimovirus, Circoviridae, Closterovirus, Comoviridae, Coronaviridae (e.g., Coronavirus, e.g., Severe Acute Respiratory Syndrome (SARS) virus), Corticoviridae, Cystoviridae, Deltavirus, Carnation ringspot virus, Capillovirus, Filoviridae (e.g., Marburg virus and Ebola virus (e.g., Zaire, Reston, Cote d'Ivoire or Sudan strains)), Flaviviridae (e.g., Hepatitis C virus, Dengue virus 1, Dengue virus 2, Dengue virus 3 and Dengue virus 4), Hepadnaviridae (e.g., Hepatitis B virus), Herpesviridae (e.g., Human herpesvirus 1, 3, 4, 5 and 6 and Cytomegalovirus), Hypoviridae, Iridoviridae, Leviviridae, Lipothrixviridae, Microviridae, Orthomyxoviridae (e.g., Influenza A and B viruses), Papovaviridae, Paramyxoviridae (e.g., Measles, Mumps and Human respiratory syncytial virus), Parvoviridae, Picornaviridae (e.g., Poliovirus, Rhinovirus, Hepatovirus and Aphthovirus), Poxviridae (e.g., Vaccinia virus), Reoviridae (e.g., Rotavirus), Retroviridae (e.g., Lentivirus, e.g., Human Immunodeficiency Virus (HIV) 1 and HIV 2), Rhabdoviridae, Totiviridae, Crimean-Congo hemorrhagic fever virus, Eastern equine encephalitis virus, Hendra virus, Lassa fever virus, Monkeypox virus, Nipah virus, Rift Valley fever virus, South American hemorrhagic fever virus, Venezuelan equine encephalitis virus, Human Immunodeficiency Virus (HIV, e.g., gag, env or pol proteins), Foot-and-Mouth Disease Virus (FMDV) proteins, Dengue, Coccidioides, Candida, Cryptococcus, Trichosporon, Acremonium, Cladophialophora, Pseudallescheria, Rhizopus, Actinomadura, Aspergillus, Aureobasidium, Bipolaris, Fusarium, Phialophora, Blastomyces, Histoplasma, Sporothrix, plants (e.g.,Lectins, such as ricin or abrin), alkaloids, glycosides, oxalates, phenols, resins, volatile oils, and phototoxins, such as coumarins) or animals (e.g., transforming growth factor β (TGFβ) or nitric oxide synthase (NOS)). In an embodiment, the transgene encodes at least one of pro-apoptotic caspase-8, BCL2-related X, Fas cell surface death receptor ligand, envelope proteins from hepatitis C, envelope proteins from HIV, circumsporozoite (CS) proteins from Plasmodium, and EBO from Ebola virus, certain influenza hemagglutinin (HA) genes, spike proteins from SARS-CoV1 / 2, and / or other antigens that cannot be rescued or produced in sufficient yield using standard procedures.,

[0021] The present disclosure provides reagents and methods for amplifying an Ad vector that contains a transgene encoding a polypeptide that would otherwise be toxic to an Ad host cell. The reagents and methods disclosed herein provide cells that express the tetracycline operator repressor protein (TetR) and infect the cells with an Ad vector that contains a heterologous transgene encoding a toxic polypeptide and at least one tetracycline operator gene sequence (TetO). In a preferred embodiment, the Ad vector polynucleotide encoding the transgene is operably linked to a promoter and at least one or more TetO sequences (TetO). In the presence of TetR, the expression of the toxic polypeptide in the host cell is inhibited such that the Ad vector replicates in the cell. The expression of the transgene is inhibited when TetR binds to the TetO operator sequence.,

[0022] In some embodiments, the present disclosure provides a tetracycline repressor protein (TetR) expression cassette and its transfected cell line, wherein the TetR expression cassette is preferably integrated into the genome of the cell. A preferred TetR expression cassette contains a polynucleotide that includes at least one promoter, at least one intron, at least one TetR coding sequence, and at least one poly(A) sequence. In a preferred embodiment, the cell in which the Ad vector is amplified contains at least one such TetR expression cassette. In some embodiments, the TetR polypeptide encoded by the TetR expression cassette can have the amino acid sequence shown below (represented as standard single-letter amino acid symbols):

[0023] MSRLDKSKVINSALELLNEVGIEGLTTRKLAQKLGVEQPTLYWHVKNKRALLDALAIEMLDRHHTHFCPLEGESWQDFLRNNAKSFRCALLSHRDGAKVHLGTRPTEKQYETLENQLAFLCQQGFSLENALYALSAVGHFTLGCVLEDQEHQVAKEERETPTTDSMPPLLRQAIELFDHQGAEPAFLFGLELIICGLEKQLKCESGSAYSGSREFRSY (SEQ ID NO:14); or a suitable derivative thereof (e.g., GenBank accession number J01830; the following conservative substitutions: positively charged residues (H, K, and R) are replaced by other positively charged residues, negatively charged residues (D and E) are replaced by other negatively charged residues, neutral polar residues (C, G, N, Q, S, T, and Y) are replaced by other neutral polar residues, and neutral nonpolar residues (A, F, I, L, M, P, V, and W) are replaced by other neutral nonpolar residues).In some embodiments, the TetR protein can be encoded by the polynucleotide sequence shown below: ATGTCTAGATTAGATAAAAGTAAAGTGATTAACAGCGCATTAGAGCTGCTTAATGAGGTCGGAATCGAAGGTTTAACAACCCGTAAACTCGCCCAGAAGCTAGGTGTAGAGCAGCCTACATTGTATTGGCATGTAAAAAATAAGCGGGCTTTGCTCGACGCCTTAGCCATTGAGATGTTAGATAGGCACCATACTCACTTTTGCCCTTTAGAAGGGGAAAGCTGGCAAGATTTTTTACGTAATAACGCTAAAAGTTTTAGATGTGCTTTACTAAGTCATCGCGATGGAGCAAAAGTACATTTAGGTACACGGCCTACAGAAAAACAGTATGAAACTCTCGAAAATCAATTAGCCTTTTTATGCCAACAAGGTTTTTCACTAGAGAATGCATTATATGCACTCAGCGCTGTGGGGCATTTTACTTTAGGTTGCGTATTGGAAGATCAAGAGCATCAAGTCGCTAAAGAAGAAAGGGAAACACCTACTACTGATAGTATGCCGCCATTATTACGACAAGCTATCGAATTATTTGATCACCAAGGTGCAGAGCCAGCCTTCTTATTCGGCCTTGAATTGATCATATGCGGATTAGAAAAACAACTTAAATGTGAAAGTGGGTCCGCGTACAGCGGATCCCGGGAATTCAGATCTTATTAA(SEQ ID NO:3); or a polynucleotide that encodes the TetR polypeptide but has at least about 90% identity thereto and retains TetR function (e.g., a conservatively substituted derivative). Codons that can be used to encode such a nearly identical TetR polypeptide are well understood by those of ordinary skill in the art.

[0024] Any suitable promoter can be used in conjunction with the other elements disclosed herein, as can be determined by those of ordinary skill in the art. For example, suitable promoters can include the cytomegalovirus (CMV) promoter, such as the CMV immediate-early promoter (described in, for example, U.S. Patent Nos. 5,168,062 and 5,385,839 and GenBank accession number X17403) or SEQ ID NO:8 herein ( Figure 8)); an HIV promoter (e.g., the HIV long terminal repeat promoter); a Rous sarcoma virus (RSV) promoter (e.g., the RSV long terminal repeat); a mouse mammary tumor virus (MMTV) promoter; an HSV promoter (e.g., the Lap2 promoter or the herpes thymidine kinase promoter (Wagner et al., Proc. Natl. Acad. Sci., 78, 144 - 145 (1981))); an SV40 promoter; and an Epstein Barr virus promoter; an adeno - associated virus promoter (e.g., the p5 promoter); and / or the like. In a preferred embodiment, the promoter is Figure 2 the CAG promoter shown in (within SEQ ID NO:2).

[0025] Any suitable intron sequence can also be used, as can be determined by one of ordinary skill in the art. In a preferred embodiment, the intron sequence is Figure 9 the β - globin intron sequence shown in (SEQ ID NO:9). In some preferred embodiments, the intron sequence is Figure 2 the chimeric intron sequence shown in (within SEQ ID NO:2).

[0026] Any suitable poly(A) polynucleotide sequence can also be used, as can be determined by one of ordinary skill in the art. In some preferred embodiments, the poly(A) sequence is Figure 4 the bovine growth hormone (BGH) polynucleotide sequence shown in (SEQ ID NO:4). In some preferred embodiments, the poly(A) sequence is Figure 6 the SV40 polynucleotide sequence shown in (SEQ ID NO:6).

[0027] As described above, in certain embodiments, the cells in which the Ad vector is amplified contain at least one TetR expression cassette disclosed herein. Other suitable TetR expression cassettes may also be suitable, as can be determined by one of ordinary skill in the art. In a preferred embodiment, the TetR expression cassette is as Figure 1 (SEQ ID NO:1; TetR expression cassette #1), Figure 5 (SEQ ID NO:5; TetR expression cassette #2), Figure 7 (SEQ ID NO:7; TetR expression cassette #3), Figure 10 (SEQ ID NO:10; TetR expression cassette #4), Figure 11 (SEQ ID NO:11; TetR expression cassette #5), Figure 12 (SEQ ID NO:12; TetR expression cassette #6) or Figure 13The expression cassette shown in (SEQ ID NO:13; TetR expression cassette #7); or a TetR expression cassette having at least about 90% identity thereto and capable of performing the functions disclosed herein.

[0028] The TetO polynucleotide sequence (e.g., TetO site) is included in the Ad vector and can be any suitable TetO polynucleotide sequence that inhibits the expression of a polynucleotide encoding a toxic polypeptide in the Ad vector host cell in the presence of TetR. In a preferred embodiment, the polynucleotide encoding the toxic polypeptide is operably linked to one or more TetO sites. In some embodiments, the TetO site can be and / or comprise the polynucleotide sequence:

[0029] AGCTCTCCCTATCAGTGATAGAGATCTCCCTATCAGTGATAGAG ATCGTCGACGAGCT (SEQ ID NO:15); or any derivative thereof that retains the above TetO function.

[0030] In a preferred embodiment, the TetO polynucleotide sequence is:

[0031] TCCCTATCAGTGATAGAGATCTCCCTATCAGTGATAGAGATCGT CGAC (SEQ ID NO:16).

[0032] The polynucleotide encoding the toxic polypeptide (i.e., the transgene of the Ad vector) is operably linked to at least one, but preferably at least two, such TetO polynucleotide sequences. The TetO polynucleotide sequence can be located upstream (e.g., 5'), between, or downstream (e.g., 3') of the promoter and / or the polynucleotide sequence encoding the toxic polypeptide.

[0033] In some embodiments, the cell line is an immortalized, E1-complemented human amniotic fluid cell-derived cell line (referred to herein as "CAP-TetR" cells), which was developed to rescue and produce non-replicating E1 / E3-deleted adenovirus vectors encoding toxic transgenes that are difficult to produce and amplify using standard procedures. CAP TetR cells express TetR, which inhibits the expression of the toxic polypeptide encoded by the Ad vector polynucleotide encoding the transgene, and the expression of TetR is controlled by a promoter (preferably the CMV promoter) and (or comprising) a TetO operator sequence (SEQ ID NO:16) that binds to TetR.

[0034] In some embodiments, the present disclosure provides CAP-TetR cells that constitutively express the TetR protein, wherein the cells comprise an Ad vector that contains one or more, preferably two copies of the tetracycline operator (TetO) sequence in the cytomegalovirus (CMV) promoter (Ad2xtetO-vector, which includes two copies of the TetO operator). Without being limited by the mode of operation, it is believed that in such CAP-TetR cells, the TetR protein binds to the TetO sequence of the Ad2xTetO-vector, blocking the expression of the toxic transgene and allowing the replication and amplification of the Ad2xTetO-vector to be effectively rescued. These Ad2xTetO-vectors can express the transgene at a high level after host cell infection and are used for vaccination and gene therapy.

[0035] As shown in the examples, in a preferred embodiment, the CAP-TetR cells are obtained using recombinant DNA technology provided by CAP (CEVEC Pharmaceuticals GmbH, Germany; "CEVEC") amniocytes (an immortalized cell line based on primary human amniocytes). CAP cells have a non-tumor origin, are immortalized by functioning in humans rather than being tumorigenic, and are obtained from an ethically acceptable source. Primary human amniocytes obtained by routine amniocentesis have been immortalized with a vector containing the E1 and pIX functions of adenovirus type 5. Thus, the CAP cell line constitutively expresses the E1 protein of adenovirus type 5, which complements the Ad vector and allows replication during the production process. CAP cells have been developed to avoid contamination with replication-competent adenovirus (RCA), as observed with other E1-complementing cell lines such as HEK293 cells. CAP cells grow as a single-cell suspension in a chemically defined serum-free medium suitable for pharmaceutical production.

[0036] In some preferred embodiments, the present disclosure provides a recombinant polynucleotide comprising at least one tetracycline operator repressor protein (TetR) expression cassette (TetR expression cassette), wherein each TetR expression cassette comprises: a CAG promoter / chimeric intron sequence, optionally SEQ ID NO:2; and a poly(A) polynucleotide sequence, optionally SEQ ID NO:4 or SEQ ID NO:6, the poly(A) polynucleotide sequence being operably linked to the coding sequence of the TetR coding sequence, the coding sequence optionally being SEQ ID NO:3; optionally, wherein the recombinant polynucleotide comprises a sequence having at least about 90% identity to SEQ ID NOs: 2, 3, 4, and / or 6. In some preferred embodiments, the recombinant polynucleotide of claim 1, wherein the TetR expression cassette is SEQ ID NO:1 or SEQ ID NO:5, or an expression cassette having at least about 90% identity thereto. In some preferred embodiments, the present disclosure provides a recombinant polynucleotide comprising at least one tetracycline operator repressor protein (TetR) expression cassette, the expression cassette optionally being SEQ ID NO:7 or an expression cassette having at least about 90% identity thereto; wherein each TetR expression cassette comprises a CMV promoter sequence, optionally SEQ ID NO:8 or a sequence having at least about 90% identity thereto; a rabbit β-globin intron sequence, optionally SEQ ID NO:9 or a sequence having at least about 90% identity thereto; and a poly(A) polynucleotide sequence operably linked to the coding sequence of the TetR expression sequence, the coding sequence optionally being SEQ ID NO:3 or a sequence having at least about 90% identity thereto. In some preferred embodiments, the present disclosure provides one or more cells expressing TetR, the cells comprising the recombinant polynucleotide disclosed herein integrated into the CAP cell genome. In some preferred embodiments, the cells expressing TetR comprise a TetR expression cassette selected from SEQ ID NO:1, SEQ ID NO:5, SEQ ID NO:7, and TetR expression cassettes having at least about 90% identity thereto. In some preferred embodiments, the cells are human cells. In some preferred embodiments, the human cells are an immortalized human amniotic fluid cell line, such as CAP cells.

[0037] In some preferred embodiments, the present disclosure provides a method for generating an adenoviral vector encoding a transgene, the method comprising: a) obtaining a cell that expresses a tetracycline operator repressor protein (TetR), the cell comprising in its genome an exogenous polynucleotide comprising at least one tetracycline operator repressor protein (TetR) expression cassette, each TetR expression cassette comprising a CAG promoter / chimeric intron sequence, which sequence is optionally SEQ ID NO:2; and a poly(A) polynucleotide sequence, which sequence is optionally SEQ ID NO:4 or SEQ ID NO:6, operably linked to the coding sequence of the TetR gene, which coding sequence is optionally SEQ ID NO:3; b) transfecting the TetR-expressing cell with at least one tetracycline operator operator gene (TetO) polynucleotide sequence linked to a promoter in a recombinant Ad genomic plasmid to generate a replication-defective Ad vector comprising at least one TetO polynucleotide sequence and encoding at least one transgene; and c) isolating Ad vector particles comprising at least one TetO polynucleotide sequence and encoding at least one transgene; wherein: the polynucleotide of part a) has at least about 90% identity to any one of SEQ ID NO:2, 3, 4, or 6; and the number of Ad vector particles isolated in step c) comprising at least one TetO polynucleotide sequence and encoding at least one transgene is at least about 2, 10, 15, 20, 50, 100, 150, 200, 250, or 300 times the number of Ad vector particles obtained from an Ad vector packaging cell lacking the TetR polynucleotide. In some preferred embodiments, the TetR expression cassette comprises SEQ ID NO:1 or SEQ ID NO:5, or an expression cassette having at least about 90% identity thereto. In some preferred embodiments, the chimeric intron comprises a chicken β-actin intron sequence and a rabbit β-globin intron sequence. In some preferred embodiments, the CAG / chimeric intron sequence is according to SEQ ID NO:2, or an intron sequence having at least about 90% identity thereto. In some preferred embodiments, the CAG / chimeric intron comprises SEQ ID NO:2 or a sequence having at least about 90% identity thereto, the poly(A) polynucleotide sequence is BGH (SEQ ID NO:4) or a sequence having at least about 90% identity thereto, the transgene comprises a coronavirus spike protein, and the number of Ad vector particles is at least about 20, 60, or 200 times the number of Ad vector particles obtained from an Ad vector packaging cell lacking the TetR polynucleotide.In some preferred embodiments, the CAG / chimeric intron comprises SEQ ID NO:2 or a sequence having at least about 90% identity thereto, the poly(A) polynucleotide sequence is SV40 (SEQ ID NO:6) or a sequence having at least about 90% identity thereto, the transgene comprises a coronavirus spike protein, and the number of Ad vector particles is at least any one of about 30, 150, or 200 times the number of Ad vector particles obtained from Ad vector packaging cells lacking the TetR polynucleotide. In some preferred embodiments, the CAG / chimeric intron comprises SEQ ID NO:2 or a sequence having at least about 90% identity thereto, the poly(A) polynucleotide sequence is the BGH poly(A) polynucleotide sequence (SEQ ID NO:4) or a sequence having at least about 90% identity thereto, the transgene comprises the influenza hemagglutinin (HA) surface protein antigen from A / Perth / 16 / 2009 (H3N2), and the number of Ad vector particles is at least any one of about 2, 10, or 20 times the number of Ad vector particles obtained from Ad vector packaging cells lacking the TetR polynucleotide. In some preferred embodiments, the CAG / chimeric intron comprises SEQ ID NO:2 or a sequence having at least about 90% identity thereto, the poly(A) polynucleotide sequence is the SV40 poly(A) polynucleotide sequence (SEQ ID NO:6) or a sequence having at least about 90% identity thereto, the transgene comprises the influenza hemagglutinin (HA) surface protein antigen from A / Perth / 16 / 2009 (H3N2), and the number of Ad vector particles is at least any one of about 5 or 10 times the number of Ad vector particles obtained from Ad vector packaging cells lacking the TetR polynucleotide.

[0038] In some preferred embodiments, the present disclosure provides a method for generating an adenovirus vector encoding a transgene, the method comprising: a) obtaining a tetracycline operator repressor (TetR) recombinant cell, the recombinant cell comprising in its genome an exogenous polynucleotide comprising at least one tetracycline operator repressor (TetR) expression cassette, each TetR expression cassette comprising a CMV promoter sequence (SEQ ID NO:8), a rabbit β-globin intron sequence (SEQ ID NO:9), and a poly(A) polynucleotide sequence (SEQ ID NO:4) operably linked to the coding sequence of the TetR gene (SEQ ID NO:3); b) transfecting the TetR-expressing cell with at least one tetracycline operator operator (TetO) polynucleotide sequence linked to a promoter in a recombinant Ad genomic plasmid to generate a replication-defective Ad vector comprising at least one TetO polynucleotide sequence and encoding at least one transgene; and c) isolating Ad vector particles comprising at least one TetO polynucleotide sequence and encoding at least one transgene; wherein: the polynucleotide of part a) has at least about 90% identity to any one of SEQ ID NO:3, 4, 8, or 9; and the number of Ad vector particles isolated in step c) comprising at least one TetO polynucleotide sequence and encoding at least one transgene is at least about 2, 10, 15, 20, 50, 100, 150, 200, 250, or 300 times the number of Ad vector particles obtained from an Ad vector packaging cell lacking the TetR polynucleotide (e.g., a host cell, a cell in which the Ad vector is amplified). In some preferred embodiments, the TetR expression cassette is the expression cassette according to SEQ ID NO:7 or having at least about 90% identity thereto. In some preferred embodiments, the intron sequence is SEQ ID NO:9 or having at least about 90% identity thereto.

[0039] In some preferred embodiments, the poly(A) polynucleotide sequence used in the method is a BGH or SV40 poly(A) polynucleotide sequence, optionally SEQ ID NO:4 or SEQ ID NO:6 or a polynucleotide sequence having at least about 90% identity thereto. In some preferred embodiments, the transgene is a viral or bacterial antigen. In some preferred embodiments, the viral antigen is a coronavirus or influenza antigen.

[0040] In some preferred embodiments, the polynucleotide of the method comprises a rabbit β-globin intron sequence, the sequence comprising SEQ ID NO:9 or a sequence having at least about 90% identity thereto, the poly(A) polynucleotide sequence is the BGH poly(A) polynucleotide sequence (SEQ ID NO:4) or a polynucleotide sequence having at least about 90% identity thereto, the transgene comprises a coronavirus spike protein, and the number of Ad vector particles is at least about 30 - 350 times (e.g., preferably any one of 30, 85, or 350 times) the number of Ad vector particles obtained from Ad vector packaging cells lacking the TetR polynucleotide.

[0041] In some preferred embodiments, the polynucleotide used in the method comprises a rabbit β-globin intron sequence, the sequence comprising SEQ ID NO:9 or a sequence having at least about 90% identity thereto, the poly(A) polynucleotide sequence is the BGH poly(A) polynucleotide sequence (SEQ ID NO:4) or a polynucleotide sequence having at least about 90% identity thereto, the transgene comprises the influenza hemagglutinin (HA) surface protein antigen from A / Perth / 16 / 2009 (H3N2), and the number of Ad vector particles is at least any one of about 5 to 15 times (preferably at least about 5 or 15 times) the number of Ad vector particles obtained from Ad vector packaging cells lacking the TetR polynucleotide.

[0042] In some preferred embodiments, the present disclosure provides adenovirus particles prepared using the polynucleotides and / or methods disclosed herein. In some preferred embodiments, the present disclosure provides compositions, preferably immunogenic compositions, comprising such adenovirus particles. In some preferred embodiments, the present disclosure provides vaccines comprising such compositions. In some preferred embodiments, the present disclosure provides methods of treating and / or preventing diseases using such compositions and / or vaccines (or vaccine compositions), particularly in mammalian subjects (preferably humans). Those skilled in the art understand that the effective dose in mice can be scaled proportionally for larger animals such as humans, dogs, pigs, etc. Thus, by allometric scaling (also known as bioscaling), the dose in larger animals can be extrapolated from the dose in mice to obtain an equivalent dose based on the body weight or body surface area of the mammalian subject. In some embodiments, the method comprises administering at least a priming dose and a booster dose of the present immunogenic composition / formulation / dose. In certain embodiments, the booster dose is administered about 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 9 weeks, 10 weeks, 11 weeks, 12 weeks, 13 weeks, 14 weeks, 15 weeks, 16 weeks, 17 weeks, 18 weeks, 19 weeks, 20 weeks, 21 weeks, 22 weeks, 23 weeks, 24 weeks, 25 weeks, 26 weeks, 27 weeks, 28 weeks, 29 weeks, 30 weeks, 31 weeks, 32 weeks, 33 weeks, 34 weeks, 35 weeks, 36 weeks, 37 weeks, 38 weeks, 39 weeks, 40 weeks, 41 weeks, 42 weeks, 43 weeks, 44 weeks, 45 weeks, 46 weeks, 47 weeks, 48 weeks, 49 weeks, 50 weeks, 51 weeks or 52 weeks, 2 years, 3 years, 4 years, 5 years or more after administration of the priming dose, or a booster dose is administered after a booster dose (e.g., a second, third or more boosters).

[0043] A pharmaceutically acceptable composition can be a solid composition. The fluorocarbon-linked peptide composition can be obtained in dry powder form. The cake obtained by lyophilization can be ground into powder form. Thus, the solid composition according to the present invention can be in the form of free-flowing particles. The solid composition is typically provided as a powder in a sealed vial, ampoule, or syringe. If for inhalation, the powder can be provided in a dry powder inhaler. Alternatively, the solid matrix can be provided as a patch. The powder can be compressed into tablet form. The dried (e.g., lyophilized) peptide or fluorocarbon-linked peptide composition can be reconstituted prior to administration. The term "reconstitution" as used herein is understood to be the dissolution of the dry vaccine product prior to use. After drying (e.g., lyophilization), the immunogenic peptide, such as the fluorocarbon-linked peptide product, is preferably reconstituted to form an isotonic, pH-neutral homogeneous suspension. The formulation is typically reconstituted in an aqueous phase, for example, by adding water for injection, a histidine buffer solution (e.g., 28 mM L-histidine buffer), sodium bicarbonate, Tris-HCl, or phosphate-buffered saline (PBS). The reconstituted formulation is typically dispensed into a sterile container, such as a vial, syringe, or any other suitable form for storage or administration. Prior to use, the composition can be stored in a container, such as a sterile vial or syringe.

[0044] The composition / formulation can be administered in a dose and by techniques well known to those skilled in the clinical art, taking into account factors such as age, sex, body weight, and route of administration. The formulation can be administered alone (i.e., as the sole active agent), or can be co-administered or sequentially administered with a composition (e.g., an "other" immunogenic composition or therapeutic composition), thereby providing the multivalent or "cocktail" or combination compositions of the present invention and methods of using them. In some embodiments, the formulation can include sucrose as a cryoprotectant and polysorbate-80 as a nonionic surfactant. In certain embodiments, the formulation further includes ethanol as a free radical oxidation inhibitor and histidine, ethylenediaminetetraacetic acid (EDTA) as a metal ion chelator, or other reagents having comparable activity (e.g., blocking or preventing metal ion-catalyzed free radical oxidation).

[0045] The composition (e.g., formulation) can be present in liquid preparations for mucosal administration, such as oral, nasal, ophthalmic, etc. formulations, such as suspensions, and in preparations for parenteral, subcutaneous, intradermal, intramuscular, intravenous (e.g., injection administration), such as sterile suspensions or emulsions. In the formulations, the adenovirus vector can be mixed with suitable carriers, diluents or excipients (such as sterile water, physiological saline, viscosity-increasing excipients, etc.). Certain specialized formulations for mucosal administration can be used, including mucoadhesives, muco - permeants and mucosal disruptors. The formulations can also be lyophilized or frozen. The formulations can contain auxiliary substances, such as wetting agents or emulsifiers, pH buffers, adjuvants, preservatives, etc., depending on the route of administration and the desired preparation. The formulations can contain at least one adjuvant compound. In an exemplary embodiment, the immunogenic composition (e.g., vaccine) is adjuvant - free. Suitable preparations can be prepared by referring to standard textbooks, such as "REMINGTON'S PHARMACEUTICAL SCIENCE", 17th edition, 1985 (incorporated herein by reference), without undue experimentation.

[0046] In some preferred embodiments, the present disclosure provides recombinant polynucleotides comprising at least one tetracycline operator repressor (TetR) expression cassette (TetR expression cassette), wherein each TetR expression cassette comprises: a CAG promoter / chimeric intron sequence, optionally SEQ ID NO:2; and a poly(A) polynucleotide sequence, optionally SEQ ID NO:4 or SEQ ID NO:6, the poly(A) polynucleotide sequence being operably linked to the coding sequence of the TetR coding sequence, the coding sequence optionally being SEQ ID NO:3; optionally, wherein the recombinant polynucleotide comprises a sequence having at least about 90% identity to SEQ ID NO:2, 3, 4, and / or 6. In some preferred embodiments, the TetR expression cassette comprises and / or is SEQ ID NO:1 or SEQ ID NO:5, or an expression cassette having at least about 90% identity thereto.

[0047] In some preferred embodiments, the present disclosure provides a recombinant polynucleotide comprising at least one tetracycline operator repressor (TetR) expression cassette, optionally the expression cassette of SEQ ID NO:7 or an expression cassette having at least about 90% identity thereto; wherein each TetR expression cassette comprises a CMV promoter sequence, optionally the sequence of SEQ ID NO:8 or a sequence having at least about 90% identity thereto; a rabbit β-globin intron sequence, optionally the sequence of SEQ ID NO:9 or a sequence having at least about 90% identity thereto; and a poly(A) polynucleotide sequence operably linked to the coding sequence of the TetR expression sequence, optionally the coding sequence of SEQ ID NO:3 or a coding sequence having at least about 90% identity thereto.

[0048] In some preferred embodiments, the present disclosure provides cells expressing TetR, which comprise a TetR expression cassette integrated into the CAP cell genome. In a preferred embodiment, the TetR expression cassette of the cells is selected from SEQ ID NO:1, SEQ ID NO:5, SEQ ID NO:7 and TetR expression cassettes having at least about 90% identity thereto. In some preferred embodiments, the cells are human cells. In some preferred embodiments, the cells are an immortalized human amniotic fluid cell line.

[0049] In some preferred embodiments, the present disclosure provides a method for generating an Ad vector encoding a transgene, the transgene encoding a toxic polypeptide, the method comprising obtaining a cell expressing a tetracycline operator repressor protein (TetR), the cell comprising in its genome an exogenous polynucleotide comprising at least one tetracycline operator repressor protein (TetR) expression cassette, each TetR expression cassette comprising a CAG promoter / chimeric intron sequence, which is optionally SEQ ID NO:2; and a poly(A) polynucleotide sequence, which is optionally SEQ ID NO:4 or SEQ ID NO:6, the poly(A) polynucleotide sequence being operably linked to the coding sequence of the TetR gene, the coding sequence being optionally SEQ ID NO:3; transfecting the cell expressing TetR with at least one tetracycline operator operator gene (TetO) polynucleotide sequence linked to a promoter in a recombinant Ad genomic plasmid to generate a replication-defective Ad vector comprising at least one TetO polynucleotide sequence and encoding at least one transgene; and isolating Ad vector particles comprising at least one TetO polynucleotide sequence and encoding at least one of the transgenes; wherein the TetR expression cassette of the cell comprises a polynucleotide having at least about 90% identity to any one of SEQ ID NO:2, 3, 4 or 6; and the number of Ad vector particles comprising at least one TetO polynucleotide sequence and encoding at least one transgene isolated from a cell comprising a TetR expression cassette is at least about 2, 10, 15, 20, 50, 100, 150, 200, 250 or 300 times the number of Ad vector particles obtained from an Ad vector packaging cell lacking the TetR polynucleotide. In some preferred embodiments, the TetR expression cassette of the cell comprises SEQ ID NO:1 or SEQ ID NO:5, or a TetR expression cassette having at least about 90% identity thereto. In some preferred embodiments, the TetR expression cassette comprises a chimeric intron, the chimeric intron comprising a chicken β-actin intron sequence and a rabbit β-globin intron sequence. In some preferred embodiments, the TetR expression cassette comprises a CAG / chimeric intron sequence, the sequence being an intron sequence according to SEQ ID NO:2 or having at least about 90% identity thereto. In some preferred embodiments, the CAG / chimeric intron comprises SEQ ID NO:2 or a sequence having at least about 90% identity thereto, the poly(A) polynucleotide sequence is BGH (SEQ ID NO:4) or a sequence having at least about 90% identity thereto, the transgene comprises a coronavirus spike protein, and the number of Ad vector particles is at least about 20, 60 or 200 times the number of Ad vector particles obtained from an Ad vector packaging cell lacking the TetR polynucleotide.In some preferred embodiments, the CAG / chimeric intron comprises SEQ ID NO:2 or a sequence having at least about 90% identity thereto, the poly(A) polynucleotide sequence is the SV40 (SEQ ID NO:6) or a sequence having at least about 90% identity thereto, the transgene comprises a coronavirus spike protein, and the number of Ad vector particles is at least any one of about 30, 150, or 200 times the number of Ad vector particles obtained from Ad vector packaging cells lacking the TetR polynucleotide.

[0050] In some preferred embodiments, the TetR expression cassette comprises at least one CAG / chimeric intron that comprises SEQ ID NO:2 or a sequence having at least about 90% identity thereto, the poly(A) polynucleotide sequence is the BGH poly(A) polynucleotide sequence (SEQ ID NO:4) or a sequence having at least about 90% identity thereto, the transgene comprises the influenza hemagglutinin (HA) surface protein antigen from A / Perth / 16 / 2009 (H3N2), and the number of Ad vector particles is at least any one of about 2, 10, or 20 times the number of Ad vector particles obtained from Ad vector packaging cells lacking the TetR polynucleotide. In some preferred embodiments, the CAG / chimeric intron comprises SEQ ID NO:2 or a sequence having at least about 90% identity thereto, the poly(A) polynucleotide sequence is the SV40 poly(A) polynucleotide sequence (SEQ ID NO:6) or a sequence having at least about 90% identity thereto, the transgene comprises the influenza hemagglutinin (HA) surface protein antigen from A / Perth / 16 / 2009 (H3N2), and the number of Ad vector particles is at least any one of about 5 or 10 times the number of Ad vector particles obtained from Ad vector packaging cells lacking the TetR polynucleotide.

[0051] In some preferred embodiments, the present disclosure provides a method for generating an adenovirus vector encoding a transgene, the method comprising: obtaining a tetracycline operator repressor (TetR) recombinant cell that contains in its genome an exogenous polynucleotide comprising at least one tetracycline operator repressor (TetR) expression cassette, each TetR expression cassette comprising a CMV promoter sequence (SEQ ID NO:8), a rabbit β-globin intron sequence (SEQ ID NO:9), and a poly(A) polynucleotide sequence (SEQ ID NO:4) operably linked to the coding sequence of the TetR gene (SEQ ID NO:3); transfecting the TetR-expressing cell with at least one tetracycline operator operator (TetO) polynucleotide sequence linked to a promoter in a recombinant Ad genomic plasmid to generate a replication-defective Ad vector comprising at least one TetO polynucleotide sequence and encoding at least one transgene; and isolating Ad vector particles comprising at least one TetO polynucleotide sequence and encoding at least one transgene; wherein the TetR-expressing cell comprises at least one polynucleotide having at least about 90% identity to any one of SEQ ID NO:3, 4, 8, or 9; and the number of Ad vector particles comprising at least one TetO polynucleotide sequence and encoding at least one of the transgenes isolated from a cell comprising at least one TetR expression cassette is at least about 2, 10, 15, 20, 50, 100, 150, 200, 250, or 300 times the number of Ad vector particles obtained from an Ad vector packaging cell lacking a TetR expression cassette. In some preferred embodiments, the TetR expression cassette of the cell is an expression cassette according to SEQ ID NO:7 or having at least about 90% identity thereto. In some preferred embodiments, the intron sequence of the TetR expression cassette is SEQ ID NO:9 or an intron sequence having at least about 90% identity thereto.

[0052] In some preferred embodiments, the rabbit β-globin intron sequence of the TetR expression cassette comprises SEQ ID NO:09 or a sequence having at least about 90% identity thereto, the poly(A) polynucleotide sequence is a BGH poly(A) polynucleotide sequence (preferably SEQ ID NO:4) or a polynucleotide sequence having at least about 90% identity thereto, the transgene comprises a coronavirus spike protein, and the number of Ad vector particles is at least about 30, 85, or 350 times the number of Ad vector particles obtained from an Ad vector packaging cell lacking a TetR polynucleotide.

[0053] In some preferred embodiments, the rabbit β-globin intron sequence of the TetR expression cassette comprises a rabbit β-globin intron sequence, the sequence comprising SEQ ID NO:9 or a sequence having at least about 90% identity thereto, the poly(A) polynucleotide sequence is the BGH poly(A) polynucleotide sequence (preferably SEQ ID NO:4) or a sequence having at least about 90% identity thereto, the transgene comprises the influenza hemagglutinin (HA) surface protein antigen from A / Perth / 16 / 2009 (H3N2), and the number of Ad vector particles is at least about 5 or 15 times any one of the number of Ad vector particles obtained from Ad vector packaging cells lacking the TetR polynucleotide.

[0054] In some preferred embodiments, the TetR expression cassette of the present disclosure and the TetR expression cassette used in the methods of the present disclosure comprise at least one poly(A) polynucleotide sequence, the poly(A) polynucleotide sequence being the BGH or SV40 poly(A) polynucleotide sequence, optionally SEQ ID NO:4 or SEQ ID NO:6, or a polynucleotide sequence having at least about 90% identity thereto.

[0055] In some preferred embodiments, the transgene encodes a viral or bacterial antigen. In some preferred embodiments, the viral antigen is a coronavirus or influenza antigen. In some preferred embodiments, the present disclosure provides adenovirus particles prepared using any of the reagents and / or methods disclosed herein.

[0056] Other embodiments are also contemplated herein, as would be understood by one of ordinary skill in the art.

[0057] As used herein, as is common in patent literature, the term "a" or "an" is used to include one or more than one, independent of any other instance or use of "at least one" or "one or more".

[0058] As used herein, the term "or" is used to mean non-exclusive or such that "A or B" includes "A but not B", "B but not A", and "A and B", unless otherwise specified.

[0059] As used herein, the term "about" is used to refer to an amount that is approximate, close, nearly, or approximately equal to or equal to the stated amount, e.g., the amount plus / minus about 5%, about 4%, about 3%, about 2%, or about 1%.

[0060] The compositions, formulations, and methods of the present invention may comprise, consist essentially of, or consist of the components and ingredients of the present invention and other ingredients described herein. As used herein, "consisting essentially of" means that the compositions, formulations, and methods may include additional steps, components, or ingredients, provided that the additional steps, components, or ingredients do not materially alter the basic and novel characteristics of the claimed compositions, formulations, and methods.

[0061] In certain embodiments, non-invasive administration of an immunogenic (preferably antiviral) composition includes, but is not limited to, topical administration to the skin, and / or intranasal and / or mucosal and / or transmucosal and / or sublingual and / or buccal and / or oral and / or intramuscular administration. Dosage forms for the application of an immunogenic (preferably antiviral) composition may include liquids, ointments, powders, and sprays. If desired, the active ingredient can be mixed under sterile conditions with a physiologically acceptable carrier and any preservatives, buffers, propellants, or absorption promoters.

[0062] It should also be noted that, as used in this specification and the appended claims, the term "configured" describes a system, device, or other structure that is constructed or configured to perform a particular task or adopt a particular configuration. The term "configured" may be used interchangeably with other similar phrases, such as arranged and configured, constructed and arranged, adapted and configured, adapted, constructed, made, and arranged, etc.

[0063] As used herein, an "adjuvant" is a substance that enhances the body's immune response to an antigen. In an embodiment, the monovalent influenza drug formulation of the present invention is an adjuvant-free vaccine composition.

[0064] By "administering" is meant introducing the vaccine composition of the present disclosure into a subject; it may also refer to the act of providing the composition of the present disclosure to a subject (e.g., by prescription).

[0065] As used herein, the term "ambient temperature" is the air temperature at which the monovalent influenza drug formulation is stored. In an embodiment, the ambient temperature is room temperature, such as any temperature selected from the range of about 15 to 30 °C, preferably from about 20 to 25 °C.

[0066] As used herein, the term "therapeutically effective amount" refers to the amount of a compound being administered which will induce a combined mucosal, humoral and cell-mediated immune response. The term also refers to the amount of the present composition which will, to some extent, alleviate or prevent one or more symptoms of the condition to be treated. With respect to a condition / disease which can be directly treated with the compositions of the present disclosure, a therapeutically effective amount is an amount having the effect of preventing the occurrence (prophylactic treatment) of the condition / disease in a mammal which may be predisposed to the disease but has not yet experienced or exhibited symptoms of the condition / disease, alleviating the symptoms of the condition / disease, reducing the severity of the condition / disease, stabilizing (e.g., not worsening) the condition / disease, preventing the spread of the condition / disease, delaying or slowing the progression of the condition / disease, improving or alleviating the state of the condition / disease, and combinations thereof. The term "effective amount" refers to the amount of a compound being administered which will produce a response different from the response which occurs in the absence of the compound.

[0067] As used herein, the term "percent (%) homology" and its grammatical variants, in the context of two sequences (e.g., protein sequences), refers to two or more sequences or subsequences (i.e., fragments thereof) having at least about 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% and / or 100% nucleotide or amino acid residue identity (homology) when compared and aligned for maximum correspondence, as measured using one of the well-known sequence comparison algorithms or by visual inspection.

[0068] As used herein, an "immunogenic composition" refers to a composition that generally comprises at least one type of peptide construct as disclosed herein and at least one pharmaceutically acceptable carrier, which when administered to a host induces, stimulates, and / or enhances an immune response against at least one type of viral (e.g., SARS-CoV-2 or influenza) antigen. A "vaccine" refers to such an immunogenic composition that when administered induces, stimulates, and / or enhances a protective immune response against the virus (e.g., SARS-CoV-2 or influenza) (e.g., protects the host from attack by the coronavirus (e.g., SARS-CoV-2 or influenza)). In certain embodiments, the immunogenic composition (e.g., vaccine) can comprise one or more peptide constructs that comprise at least one coronavirus antigen and / or influenza antigen, and other components of an immunogenic composition (e.g., vaccine) suitable for administration to a mammalian host, including, for example, one or more adjuvants, sustained-release compounds, solvents, buffers, other anti-coronavirus and / or anti-influenza agents, etc. In certain embodiments, the immunogenic composition and / or vaccine can comprise proteins and / or carbohydrates and / or lipids and / or other antigens, including but not limited to one or more killed antigens (e.g., killed or completely inactivated virus) or live attenuated antigens (e.g., attenuated virus). In some embodiments, the immunogenic composition and / or vaccine improves the immune response to any antigen, regardless of antigen source or its function.

[0069] As used herein, a "pharmaceutically acceptable carrier" refers to a carrier or diluent that does not cause significant irritation to human subjects and does not abrogate the biological activity and properties of the administered vaccine composition.

[0070] As used herein, the term "seroconversion" is defined as a four-fold or greater increase in serum neutralizing antibody titer (e.g., a sufficient amount of antibody in the serum that can neutralize the infective agent) after vaccination (e.g., administration of this immunogenic composition).

[0071] As used herein, the term "seropositive" means that serum neutralizing antibodies are measurable (e.g., detectable in an in vitro assay) after vaccination (e.g., administration of this immunogenic composition).

[0072] As used herein, the term "serum protection" refers to a subject protected from infection by the production of serum neutralizing antibodies after vaccination. In a population, this is referred to as the percentage (%) of seroprotected individuals (e.g., 50%). In embodiments, the present immunogenic composition and method of use provide serum protection against viral infection (e.g., SARS-CoV-2 or influenza) for mammalian subjects (e.g., human subjects).

[0073] The terms "treat", "treating", and "treatment" are methods of obtaining a beneficial or desired clinical outcome. Specifically, a beneficial or desired clinical outcome includes, but is not limited to, alleviating symptoms, reducing the extent of the disease, stabilizing (e.g., not worsening) the disease, delaying or slowing the progression of the disease, significantly preventing the spread of the disease, improving or alleviating the disease state, and remission (partial or complete), whether detectable or not. In addition, "treat", "treating", and "treatment" can also mean an extended survival period compared to the expected survival period if not treated, and / or can be therapeutic depending on the partial or complete cure of the disease and / or the side effects caused by the disease. As used herein, the term "prophylactic treat" or "prophylactic treating" refers to completely, significantly, or partially preventing a disease / condition or one or more of its symptoms in a host. Similarly, "delaying the onset of a condition" can also be included in "prophylactic treatment" and refers to an action that increases the time before the actual onset of the condition in a patient susceptible to the condition.

[0074] As used herein, a "vaccine" refers to a composition comprising an Ad vector that can be used to induce an antiviral immune response and other components of the vaccine formulation (including, for example, adjuvants, slow-release compounds, solvents, etc.). In embodiments of the present invention, the vaccine improves the immune response to any antigen, regardless of the antigen source or its function.

[0075] As described herein, an "antigen" refers to a substance that induces and / or enhances a specific immune response against the antigen and / or an infectious agent expressing such an antigen in a subject (including humans and / or animals). The antigen can comprise epitopes, haptens, and / or any combination thereof.

[0076] Ranges can be expressed herein as from about a particular value, and / or to about another particular value. When expressing such a range, another aspect includes from a particular value and / or to another particular value. Similarly, when a value is expressed as an approximation by use of the foregoing "about" or "approximately", it is understood that the particular value forms another aspect. It will be further understood that each endpoint of a range is valid relative to and independent of the other endpoint. A range (e.g., 90 - 100%) is intended to include the range itself and each individual value within the range as if each value were listed separately.

[0077] Examples

[0078] The following examples are provided to give a complete disclosure and description to those of ordinary skill in the art of how to use the embodiments provided herein, and are not intended to limit the scope of the present disclosure, nor are they intended to represent that the following examples are all the experiments conducted or the only experiments. Efforts have been made to ensure the accuracy of the numbers used (e.g., amounts, temperatures, etc.), but some experimental errors and deviations should be taken into account. Unless otherwise stated, parts are parts by volume, and temperatures are in degrees Celsius. It should be understood that the methods described can be varied without changing the basic aspects that the examples are intended to illustrate.

[0079] Example 1: Generation of a stably transfected CAP-TetR cell line (Z3634) based on TetR expression cassette #1

[0080] After transfecting parental CAP cells with a plasmid containing the "TetR expression cassette #1" (SEQ ID NO:1) described in Figure 1 a stably transfected CAP-TetR cell line (Z3634) was obtained. TetR expression cassette #1 (SEQ ID NO:1) contains a CAG promoter / chimeric intron sequence (SEQ ID NO:2), a tetracycline repressor (TetR) sequence (SEQ ID NO:3), and a poly A sequence from bovine growth hormone (BGH) (SEQ ID NO:4). Briefly, TetR expression cassette #1 was incorporated into the pStbl vector to generate plasmid p1085, which was linearized and transfected into CAP cells, followed by antibiotic selection and amplification to select a pool of stably transfected cells (see Table 1 below, for example, the CAP-TetR cell line Z3634 produced using plasmid p1085).

[0081] The CAG promoter / chimeric intron sequence (SEQ ID NO:2) consists of four components: (1) the CMV early enhancer / promoter element; (2) the first exon and the first intron of the chicken β-actin gene; (3) the splice acceptor of the rabbit β-globin gene; and (4) a chimeric intron containing a combination of intron sequences from chicken β-actin and rabbit β-globin, as described separately in Figure 2 The sequence of the TetR gene (SEQ ID NO:3) is described separately in Figure 3 The sequence of the BGH poly A sequence (SEQ ID NO:4) is described separately in Figure 4

[0082] To generate the Z3634 CAP-TetR cell pool, P1085 TetR expression cassette #1 ( Figure 1 ​) The plasmid was linearized and then subjected to phenol-chloroform extraction and ethanol precipitation. The parental CAP cells were thawed and cultured in protein expression medium (PEM) supplemented with 4 mM GlutaMax (PEM+). Nucleofection and pool generation were performed as described below. During the exponential growth phase of the culture, the CAP cells were counted and the viable cell density and viability were determined. For each nucleofection reaction, 1 x 10 7 viable cells were harvested by centrifugation (300 - 500 g, 5 minutes). The cells were resuspended in 100 μl of complete nucleofector solution V and mixed with 5 μg of linearized P1085 TetR expression cassette #1 plasmid DNA. The DNA / cell suspension was transferred to a cuvette and nucleofected using an in-house standard operating procedure (SOP). After pulsing, the cells were recovered by adding 500 μl of pre-warmed PEM+ to the cuvette and gently transferred to 11.5 ml of PEM+ in a 125 ml shake flask or 50 ml SpinTube. The cuvette was washed once with 500 μl of fresh PEM+ to recover residual cells.

[0083] The cells were cultured at 37 °C, 5% CO2 at 120 rpm, 5 cm orbit (shake flask) or at 37 °C, 5% CO2 at 185 rpm, 5 cm orbit (SpinTube). One generation after transfection, 5 μg / ml of blasticidin was added to select the pool. Six to eight cryovials of cells from the stable pool were frozen in 50% complete growth medium, 7.5% DMSO and 42.5% ProFreeze (1.5 x 10 7 cells, 1.8 ml / vial).

[0084] Example 2: Generation of a stably transfected CAP-TetR cell line (Z3635) based on TetR expression cassette #2 (p1086)

[0085] After transfecting the parental CAP cells with the plasmid containing the Figure 5 "TetR expression cassette #2" (SEQ ID NO:5) described in, a stably transfected CAP-TetR cell line (Z3635) was obtained. The TetR expression cassette #2 contains (1) a CAG promoter / chimeric intron sequence, (2) a tetracycline repressor (TetR) sequence, and (3) an SV40 polyA sequence. Briefly, the TetR expression cassette #2 was incorporated into the pStbl vector to generate the plasmid p1086, which was linearized and transfected into CAP cells, followed by antibiotic selection and amplification to select a stable transfected cell pool (CAP-TetR cell line Z3635).

[0086] The CAG promoter / chimeric intron sequence (SEQ ID NO:2) and the TetR gene sequence (SEQ ID NO:3) have been described in Example 1. The SV40 polyA sequence (SEQ ID NO:6) is described separately in Figure 6 and a pool of Z3635 CAP-TetR cells was generated by nucleofection of the p1086 TetR expression cassette #2 plasmid according to the method described in Example 1.

[0087] Example 3: Generation of a stably transfected CAP-TetR cell line (C235) based on TetR expression cassette #3 (p1116)

[0088] After transfection of parental CAP cells with a plasmid containing the "TetR expression cassette #3" (SEQ ID NO:7) described in Figure 7 a stably transfected CAP-TetR cell line (C235) was obtained. The TetR expression cassette #3 contains (1) a CMV promoter sequence, (2) a β-globin intron sequence, (3) a tetracycline repressor (TetR) sequence, and (4) a BGH polyA sequence. Briefly, the TetR expression cassette #3 was incorporated into the pStbl vector to generate plasmid p1116, which was linearized and transfected into CAP cells, followed by antibiotic selection and amplification to select a pool of stably transfected cells (CAP-TetR cell line C235).

[0089] The CMV promoter sequence (SEQ ID NO:8) is described separately in Figure 8 The β-globin intron sequence (SEQ ID NO:9) is described separately in Figure 9 The TetR gene sequence (SEQ ID NO:3) has been described in Example 1. The bovine growth hormone (BGH) polyA (SEQ ID NO:4) has been described in Example 1.

[0090] A pool of C235 CAP-TetR cells was generated by nucleofection of the p1116 TetR expression cassette #3 plasmid according to the method described in Example 1.

[0091] Example 4: Generation of stably transfected CAP-TetR cell line Z3616 based on TetR expression cassette #4 respectively

[0092] Based on a similar method described in Examples 1 to 3, after transfection with a plasmid containing Figure 10After transfection of the parental CAP cells with the plasmid of "TetR expression cassette #4" (SEQ ID NO: 10) described in [reference], the stably transfected CAP-TetR cell line (Z3616) was obtained. The TetR expression cassette #4 contains (1) CAG promoter sequence, (2) SV40 intron sequence, (3) tetracycline repressor (TetR) sequence, and (4) BGH polyA sequence. Briefly, the TetR expression cassette #4 was incorporated into the pStbl vector to generate the p1058 plasmid, which was linearized and transfected into CAP cells, followed by antibiotic selection and amplification to select the stably transfected cell pool (CAP-TetR cell line Z3616). According to the method described in Example 1, the Z3616 CAP-TetR cell pool was generated by nucleofection of the TetR expression cassette #4 plasmid p1058.

[0093] Example 5: Generation of the stably transfected CAP-TetR cell line Z3617 based on TetR expression cassette #5 respectively

[0094] Based on the similar methods described in Examples 1-3, after transfection of the parental CAP cells with the plasmid containing Figure 11 the "TetR expression cassette #5" (SEQ ID NO: 11) described in [reference], the stably transfected CAP-TetR cell line (Z3617) was obtained. The TetR expression cassette #5 contains (1) CAG promoter sequence, (2) SV40 intron sequence, (3) tetracycline repressor (TetR) sequence, and (4) SV40 polyA sequence. Briefly, the TetR expression cassette #5 was incorporated into the pStbl vector to generate the p1059 plasmid, which was linearized and transfected into CAP cells, followed by antibiotic selection and amplification to select the stably transfected cell pool (CAP-TetR cell line Z3617). According to the method described in Example 1, the Z3617 CAP-TetR cell pool was generated by nucleofection of the TetR expression cassette #5 plasmid p1059.

[0095] Example 6: Generation of the stably transfected CAP-TetR cell line Z3618 based on TetR expression cassette #6 respectively

[0096] Based on the similar methods described in Examples 1-3, after transfection of the parental CAP cells with the plasmid containing Figure 12After transfection of the parental CAP cells with the plasmid of "TetR expression cassette #6" (SEQ ID NO: 12) described in , the stably transfected CAP-TetR cell line (Z3618) was obtained. The TetR expression cassette #6 contains (1) CMV promoter sequence, (2) SV40 intron sequence, (3) tetracycline repressor (TetR) sequence, and (4) BGH polyA sequence. Briefly, the TetR expression cassette #6 was incorporated into the pStbl vector to generate the p1060 plasmid, which was linearized and transfected into CAP cells, followed by antibiotic selection and amplification to select the stably transfected cell pool (CAP-TetR cell line Z3618). According to the method described in Example 1, the Z3618 CAP-TetR cell pool was generated by nucleofection of the TetR expression cassette #6 plasmid p1060.

[0097] Example 7: Generation of stably transfected CAP-TetR cell line C236 based on TetR expression cassette #7 respectively

[0098] Based on the similar methods described in Examples 1-3, after transfection of the parental CAP cells with the plasmid of Figure 13 "TetR expression cassette #7" (SEQ ID NO: 13) described in , the stably transfected CAP-TetR cell line (C236) was obtained. The TetR expression cassette #7 contains (1) CMV promoter sequence, (2) tetracycline repressor (TetR) sequence, and (3) BGH polyA sequence. Briefly, the TetR expression cassette #7 was incorporated into the pStbl vector to generate the p1117 plasmid, which was linearized and transfected into CAP cells, followed by antibiotic selection and amplification to select the stably transfected cell pool (CAP-TetR cell line C236). According to the method described in Example 1, the C236 CAP-TetR cell pool was generated by nucleofection of the TetR expression cassette #7 plasmid p1117.

[0099] Example 8: Expression of TetR in the generated CAP-TetR cell lines

[0100] Based on the different expression cassettes described in Examples 2-8, successful expression tests of TetR protein were performed on 7 corresponding cell lines. Surprisingly, only cell lines Z3634, Z3635, and C235 were able to express detectable levels of TetR, as Figures 14 - 16 shown and summarized in Table 1.

[0101] Table 1 Tet expression in the generated different CAP-TetR cell lines

[0102] Box Number Identifier Promoter Intron Poly(A) Cell Line Pool TetR Expression #1 p1085 CAG Chimeric BGH Z3634 Yes #2 p1086 CAG Chimeric SV40 Z3635 Yes #3 p1116 CMV β - Globin BGH C235 Yes #4 p1058 CAG SV40 BGH Z3616 No #5 p1059 CAG SV40 SV40 Z3617 No #6 p1060 CMV SV40 BGH Z3618 No #7 p1117 CMV None BGH C236 No

[0103] The expression of TetR protein was detected by Western blotting. Briefly, the cultured cells were centrifuged and lysed with RIPA buffer. 25 μl of the sample (equivalent to 1.8E04 lysed cells / lane) was loaded onto a 4 - 12% NuPage gel. After electrophoresis, the gel was transferred to a PVDF membrane. The detection of TetR was carried out in two steps: (1) using anti - TetR mAb (MoBiTec, catalog number #TET02, dilution 1:500 (v / v)), and then (2) using a secondary antibody, HRP - conjugated anti - mouse IgG (CST, catalog number #7076, dilution 1:50000 (v / v)). The TetR - positive bands were detected using Super Signal West Atto substrate. The results of CAP - TetR cells Z3634 and Z3635 are as Figure 14 shown. The results of CAP - TetR cells C235 and C236 are as Figure 15 shown. The results of CAP - TetR cells Z3616, Z3617, and Z3618 are as Figure 16 shown.

[0104] Example 9: Construction and generation of Ad2xTetO - vector (containing the tetracycline operator gene) and the corresponding Ad vector control (without the tetracycline operator gene)

[0105] The generation of the Ad2xTetO - vector (Ad vector containing TetO) is briefly summarized as follows. The first step of the process involves constructing the pAdhigh shuttle plasmid, which contains the desired transgenic DNA fragment and the cytomegalovirus (CMV) promoter (pAdhigh2xTetO - shuttle) containing two copies of the tetracycline operator gene (TetO) sequence. Then, pAdhigh2xTetO - shuttle was linearized by PmeI digestion and then transformed into electrocompetent BJ5183 - AD - 1 cells containing the pAdEasy - 1 plasmid (Agilent) to generate the recombinant Ad genomic plasmid (pAd2xTetO - vector) containing the desired transgene. After amplification and purification, the resulting pAd2xTetO - vector plasmid was linearized by PacI digestion and then transfected into Ad vector packaging cells (such as CAP or CAP - TetR cells) to generate the Ad2xTetO - vector.

[0106] An example of a shuttle plasmid containing the CMV early promoter, two copies of the TetO sequence, and the hemagglutinin (HA) antigen sequence derived from the influenza A (H1N1)pdm09 virus is described below. Briefly, the DNA fragment (2XTetO-coCA09; SEQ ID NO:14) was synthesized by Genscript and contains two copies of the TetO sequence (TCCCTATCAGTGATAGAGA) and the codon-optimized sequence of HAcoCA09 ( Figure 17 ).

[0107] Subsequently, the synthesized 2XTetO-coCA09 HA DNA fragment (SEQ ID NO:14) was cloned by Genscript into the SnaBI and XbaI sites in Altimmune's pAdhighSwaI vector to generate the pAdhigh2xTetO-coCA09 shuttle vector for Altimmune.

[0108] All other pAdhigh2xTetO shuttle vectors were generated similarly by replacing the coCA09 DNA fragment in the pAdhigh2xTetO-coCA09 shuttle vector with the desired transgene DNA fragment. Specifically, pAdhigh2TetO-tPAWHS was generated, which encodes the codon-optimized full-length spike protein from the SARS-CoV-2 Wuhan strain, with the tissue plasminogen activator (tPA) signal sequence (tPAWHS); and pAdhigh2xTetO-coPerth was generated, which encodes the codon-optimized Perth HA gene (coPerth) from A / Perth / 16 / 2009 (H3N2).

[0109] Then, the pAdhigh2TetO-tPAWHS and pAdhigh2xTetO-coPerth shuttle plasmids were linearized by PmeI digestion and then transformed into BJ5183-AD-1 electrocompetent cells to generate the recombinant Ad genomic plasmids pAd2TetO-tPAWHS and pAd2xTetO-coPerth, respectively.

[0110] The control recombinant Ad genomic plasmids pAdtPAWHS and pAdcoPerth encoding tPAWHS and coPerth respectively (as described above) were generated without a TetO sequence in their CMV promoters. An additional Ad vector, AdE, was also generated, which contains no TetO sequence and no transgene. Briefly, the synthetic codon-optimized tPAWHS DNA fragment was cloned into the pAdhighSwaI shuttle vector to generate the pAdhightPAWHS shuttle plasmid. The synthetic codon-optimized Perth HA was cloned into the pAdhigh shuttle vector to generate the pAdhighcoPerth shuttle plasmid. The pAdhightPAWHS and pAdhighcoPerth shuttle plasmids were digested with PmeI and transformed into BJ5183-AD-1 electrocompetent cells to generate the pAdtPAWHS and pAdcoPerth recombinant Ad genomic plasmids.

[0111] Viral seeds of different Ad2xTetO-vectors (containing the tetracycline operator gene) and corresponding Ad vector controls (without the tetracycline operator gene) were generated by electroporation (EP) according to the Altimmune Inc EP protocol. Briefly, one day before EP, the CAP-TetR cell pools Z3634 (Example 2), Z3635 (Example 3) or C235 (Example 4) were centrifuged at 1100 ± 100 rpm for 10 minutes at room temperature and the cell pellet was resuspended in serum-free AEM medium supplemented with 4 mM L-glutamine (complete medium) to achieve a cell concentration of 1x10 6 cells / ml. The CAP-TetR (Z3634, Z3635 and C235) cells were cultured in a cell incubator at 37 °C, 5% CO2 and 120 rpm agitation for approximately 24 hours. For EP, the CAP-TetR (Z3634, Z3635 and C235) cells were centrifuged at 1100 ± 100 rpm for 10 minutes at room temperature and resuspended in EP buffer at a concentration of 1x10 8 viable cells / ml. 0.4 ml of the cell suspension was mixed with 80 μg of the PacI-digested recombinant Ad genomic plasmid.

[0112] Example 10: Generation of the seeded Ad2xTetO-vectors in CAP-TetR cells was improved in (Z3634, Z3635 and C235) compared to the corresponding Ad vector controls (without the tetracycline operator gene).

[0113] Using CAP-TetR cells Z3634 (EP38), C235 (EP39), and Z3635 (EP39), two transfection studies (EP38 and EP39) were performed with pAdtPAWHS, pAd2xTetO-tPAWHS, pAdcoPerth, and pAd2xTetO-coPerth, respectively.

[0114] The mixtures of Z3634, Z3635, and C235 cells and linearized plasmid DNA (pAdtPAWHS, pAd2xTetO-tPAWHS, pAdcoPerth, and pAd2xTetO-coPerth) were subjected to static EP using a disposable processing assembly OC-400 for rapid, high-titer viral vector production and a Maxcyte STX-100 instrument according to the production recommendations. After EP, the transfected CAP-TetR cells were incubated with DNase I at 37 °C for 30 minutes to digest unincorporated plasmid DNA. Thirty (30) mL of complete medium was added to the transfected cells, and the cells were incubated with stirring in a cell culture incubator at 37 °C and 5% CO2 for 6 days, and then harvested and processed to generate a viral seed stock. Approximately 80% of the cell culture medium was changed 3 days after EP. Cell counts and viability were monitored over six days.

[0115] The following protocol was used for the harvest of adenoviral vectors. Briefly, transfected or infected cells were collected by centrifugation at 1400 ± 100 rpm for 15 ± 1 minute at ambient temperature. After aspirating the supernatant, the cell pellet was resuspended in one-tenth of the original volume of complete medium. The harvested cells were subjected to 3 freeze-thaw cycles using an -80 °C freezer and a 37 °C water bath. After 3 freeze-thaw cycles, the cell lysate was centrifuged at 5000 ± 100 rpm for 15 ± 1 minute at 4 °C. The supernatant was collected and filtered using a GP0.22 μm filter. The filtered supernatant is the adenoviral vector stock solution, which will be used for further adenoviral vector amplification and adenoviral vector virus titer determination.

[0116] The adenovirus vector titer was determined according to the protocol approved by Altimmune Inc. Briefly, one day before infection, HEK-293 adherent cells were seeded at 45,000 to 50,000 cells / well in a 96-well plate. On the day of infection, a 10-fold dilution series of the virus sample was prepared in fresh RPMI 1640 medium supplemented with 2 mM L-glutamine and 2% fetal bovine serum. Adenovirus empty vector (AdE) was used as an internal positive standard control. The cell culture medium on the 96-well plate was removed and replaced with 100 μl of the virus sample diluent. Each sample was performed in duplicate. Then the plate was incubated in a humidified environment at 37 °C and 5% CO2. Three days after infection, plaques were observed using the Adeno-X rapid titer kit. The infectious forming units (ifu) were determined according to the protocol approved by Altimmune Inc.

[0117] The results of the virus titers generated by electroporation of EP38 and EP39 are listed in Tables 2 and 3, respectively.

[0118] Table 2 on EP38 of Z3634 (Chimeric Intron / BGH PolyA) CAP - TetR Cells

[0119]

[0120]

[0121] Table 3

[0122] Regarding EP39 of Z3635 (chimeric intron / SV40 polyA) and C235 (β-globin intron

[0123] / BGH polyA) CAP-TetR cells

[0124]

[0125] These results indicate that when the promoter of the Ad vector contains the TetO sequence, the Ad vector encoding a toxic transgene can be produced at a high virus titer in CAP-TetR cells, which is contrary to the comparative Ad vector without the TetO sequence (which cannot be rescued or has a low virus titer).

[0126] Example 11: Higher virus production was achieved with the Ad2xTetO-vector after infection of different CAP-TetR cells compared to parental CAP cells

[0127] To compare the virus production capacity of adenovirus vaccine vectors expressing toxic transgenes, the parental CAP (pCAP) cells and CAP-TetR cells were infected with the Ad vector seeds generated above. The AdE vector was used as an infection control.

[0128] The parental CAP (pCAP) cells and CAP-TetR cells were infected according to the protocol approved by Altimmune Inc. Briefly, one day prior to infection, the cells were centrifuged at 1100 ± 100 rpm for 10 minutes at room temperature, and the cell pellet was resuspended in complete medium to achieve a cell concentration of 1x10 6 cells / ml. The cells were cultured in a cell incubator at 37 °C, 5% CO2, and stirred at 120 rpm for approximately 24 hours. An appropriate volume of the adenovirus vector seed was thawed and added to the CAP or CAP-TetR cell culture. The infected cells were then incubated in a cell incubator at 37 °C, 5% CO2, with stirring at 120 rpm for 3 - 5 days, and then harvested and processed to generate a new adenovirus vector bulk stock. Cell counts and viability were monitored during the culture.

[0129] In the first infection experiment, the parental CAP, C235, Z3634, and Z3635 CAP-TetR cells were infected with the Ad vectors Ad2xTetO-tPAWHS and Ad2xTetO-coPerth (generated from EP38 regarding Z3634 CAP-TetR cells) at a multiplicity of infection (MOI) of three (3). After infection, the cell cultures were maintained for three (3) days. The results are summarized in Table 4 (virus titers) and Table 5 (virus yields).

[0130] Table 4 Virus Titers for Parental CAP Cells and CAP-TetR Cells

[0131]

[0132] Table 5 Comparison of Virus Yields between Parental CAP Cells and CAP-TetR Cells

[0133] Viral Vector Z3634 vs pCAP Z3635 vs pCAP C235 vs pCAP Ad2xTetO - tPAWHS 218.7X 156.7X 88.3X Ad2xTetO - coPerth 23.5X 11.8X 16.8X AdE 1.83X 1.64X 1.58X

[0134] In the second infection experiment, the parental CAP, C235, Z3634, and Z3635 CAP-TetR cells were infected with the Ad vectors Ad2xTetO-tPAWHS and Ad2xTetO-coPerth (generated from EP39 regarding Z3635 CAP-TetR cells) at an MOI of two (2). After infection, the cell cultures were maintained for four (4) days. The results are summarized in Table 6 (virus titers) and Table 7 (virus yields).

[0135] Table 6 Virus Titers for Parental CAP Cells and CAP-TetR Cells

[0136]

[0137]

[0138] Table 7 Comparison of viral yields between parental CAP cells and CAP-TetR cells

[0139] Viral Vector Z3634 vs pCAP Z3635 vs pCAP C235 vs pCAP Ad2xTetO - tPAWHS 22.0X 29.2X 28.2X Ad2xTetO - coPerth 10.4X 10.3X 7.84X AdE 0.52X 0.74X 0.61X

[0140] In the third infection experiment, parental CAP (pCAP), C235, Z3634, and Z3635 CAP-TetR cells were infected with the Ad vectors Ad2xTetO-tPAWHS and Ad2xTetO-coPerth (generated from EP39 regarding C235 CAP-TetR cells) at an MOI of 0.05. After infection, the cell cultures were maintained for five (5) days. The results are summarized in Tables 8 and 9.

[0141] Table 8 Viral titers regarding parental CAP cells and CAP-TetR cells

[0142]

[0143] Table 9 Comparison of viral yields between parental CAP cells and CAP-TetR cells

[0144] Viral Vector Z3634 vs pCAP Z3635 vs pCAP C235 vs pCAP Ad2xTetO - tPAWHS 64.8X 200.7X 345.1X Ad2xTetO - coPerth 2.45X 5.74X 15.2X AdE 1.38X 0.92X 1.62X

[0145] The results of these examples show that Ad vectors encoding toxic proteins can be amplified using the reagents and methods disclosed herein.

[0146] Although certain embodiments have been described in accordance with preferred embodiments, it is understood that variations and modifications can be envisioned by those skilled in the art. Accordingly, the appended claims are intended to cover all such equivalent variations within the scope of the following claims.

Claims

1. A recombinant polynucleotide comprising at least one tetracycline operator repressor (TetR) expression cassette (TetR expression cassette), wherein each TetR expression cassette comprises: a CAG promoter / chimeric intron sequence, said CAG promoter / chimeric intron sequence optionally being SEQ ID NO:2; and a poly(A) polynucleotide sequence, said poly(A) polynucleotide sequence optionally being SEQ ID NO:4 or SEQ ID NO:6, which is operably linked to the coding sequence of the TetR coding sequence, said coding sequence optionally being SEQ ID NO:3; optionally, wherein said recombinant polynucleotide comprises a sequence having at least about 90% identity to SEQ ID NO:2, 3, 4, and / or 6.

2. The recombinant polynucleotide according to claim 1, wherein said TetR expression cassette is SEQ ID NO:1 or SEQ ID NO:5, or an expression cassette having at least about 90% identity thereto.

3. A recombinant polynucleotide comprising at least one tetracycline operator repressor (TetR) expression cassette, said expression cassette optionally being SEQ ID NO:7 or an expression cassette having at least about 90% identity thereto; wherein each TetR expression cassette comprises a CMV promoter sequence, said CMV promoter sequence optionally being SEQ ID NO:8 or a sequence having at least about 90% identity thereto; a rabbit β-globin intron sequence, said rabbit β-globin intron sequence optionally being SEQ ID NO:9 or a sequence having at least about 90% identity thereto; and a poly(A) polynucleotide sequence operably linked to the coding sequence of the TetR expression sequence, said coding sequence optionally being SEQ ID NO:3 or a sequence having at least about 90% identity thereto.

4. A cell expressing TetR, which comprises the recombinant polynucleotide according to any of the preceding claims integrated into the CAP cell genome.

5. The cell expressing TetR according to claim 4, wherein said TetR expression cassette is selected from SEQ ID NO:1, SEQ ID NO:5, SEQ ID NO:7, and TetR expression cassettes having at least about 90% identity thereto.

6. The cell expressing TetR according to claim 4 or 5, wherein said cell is a human cell.

7. The cell expressing TetR according to any one of claims 4 - 6, wherein said cell is an immortalized human amniotic fluid cell line.

8. A method for generating an adenoviral vector encoding a transgene, said method comprising: a) Obtain cells expressing the tetracycline operator repressor protein (TetR), said cells comprising in their genome an exogenous polynucleotide comprising at least one tetracycline operator repressor protein (TetR) expression cassette, each TetR expression cassette comprising a CAG promoter / chimeric intron sequence, said CAG promoter / chimeric intron sequence optionally being SEQ ID NO:2, and a poly(A) polynucleotide sequence, said poly(A) polynucleotide sequence optionally being SEQ ID NO:4 or SEQ ID NO:6, said poly(A) polynucleotide sequence being operably linked to the coding sequence of the TetR gene, said coding sequence optionally being SEQ ID NO:3; b) Transfect said TetR-expressing cells with at least one tetracycline operator operator gene (TetO) polynucleotide sequence linked to a promoter in a recombinant Ad genomic plasmid to produce a replication-defective Ad vector comprising at least one TetO polynucleotide sequence and encoding at least one transgene; and c) Isolate Ad vector particles comprising at least one TetO polynucleotide sequence and encoding at least one transgene; Wherein: The polynucleotide of part a) has at least about 90% identity to any one of SEQ ID NO:2, 3, 4 or 6; and The number of Ad vector particles isolated in step c) comprising at least one TetO polynucleotide sequence and encoding at least one transgene is at least about 2, 10, 15, 20, 50, 100, 150, 200, 250 or 300 times the number of Ad vector particles obtained from Ad vector packaging cells lacking the TetR polynucleotide.

9. The method according to claim 8, wherein the TetR expression cassette comprises SEQ ID NO:1 or SEQ ID NO:5, or an expression cassette having at least about 90% identity thereto.

10. The method according to claim 8 or 9, wherein the chimeric intron comprises a chicken β-actin intron sequence and a rabbit β-globin intron sequence.

11. The method according to claim 8, wherein the CAG / chimeric intron sequence is according to SEQ ID NO:2, or an intron sequence having at least about 90% identity thereto.

12. The method according to any one of claims 8-11, wherein the CAG / chimeric intron comprises SEQ ID NO:2 or a sequence having at least about 90% identity thereto, the poly(A) polynucleotide sequence is BGH (SEQ ID NO:4) or a sequence having at least about 90% identity thereto, the transgene comprises a coronavirus spike protein, and the number of Ad vector particles is at least about 20, 60 or 200 times the number of Ad vector particles obtained from Ad vector packaging cells lacking the TetR polynucleotide.

13. The method according to any one of claims 8 - 11, wherein the CAG / chimeric intron comprises SEQ ID NO:2 or a sequence having at least about 90% identity thereto, the poly(A) polynucleotide sequence is the SV40 (SEQ ID NO:6) or a sequence having at least about 90% identity thereto, the transgene comprises a coronavirus spike protein, and the number of Ad vector particles is at least about 30, 150, or 200 times any one of the number of Ad vector particles obtained from Ad vector packaging cells lacking the TetR polynucleotide.

14. The method according to any one of claims 8 - 11, wherein the CAG / chimeric intron comprises SEQ ID NO:2 or a sequence having at least about 90% identity thereto, the poly(A) polynucleotide sequence is the BGH poly(A) polynucleotide sequence (SEQ ID NO:4) or a sequence having at least about 90% identity thereto, the transgene comprises the influenza hemagglutinin (HA) surface protein antigen from A / Perth / 16 / 2009 (H3N2), and the number of Ad vector particles is at least about 2, 10, or 20 times any one of the number of Ad vector particles obtained from Ad vector packaging cells lacking the TetR polynucleotide.

15. The method according to any one of claims 8 - 11, wherein the CAG / chimeric intron comprises SEQ ID NO:2 or a sequence having at least about 90% identity thereto, the poly(A) polynucleotide sequence is the SV40 poly(A) polynucleotide sequence (SEQ ID NO:6) or a sequence having at least about 90% identity thereto, the transgene comprises the influenza hemagglutinin (HA) surface protein antigen from A / Perth / 16 / 2009 (H3N2), and the number of Ad vector particles is at least about 5 or 10 times any one of the number of Ad vector particles obtained from Ad vector packaging cells lacking the TetR polynucleotide.

16. A method for generating an adenovirus vector encoding a transgene, the method comprising: a) obtaining a tetracycline operator repressor (TetR) recombinant cell that contains in its genome an exogenous polynucleotide comprising at least one tetracycline operator repressor (TetR) expression cassette, each TetR expression cassette comprising a CMV promoter sequence (SEQ ID NO:8), a rabbit β - globin intron sequence (SEQ ID NO:9), and a poly(A) polynucleotide sequence (SEQ ID NO:4) operably linked to the coding sequence of the TetR gene (SEQ ID NO:3); b) transfecting the TetR - expressing cells with at least one tetracycline operator (TetO) polynucleotide sequence linked to a promoter in a recombinant Ad genomic plasmid to generate a replication - defective Ad vector comprising at least one TetO polynucleotide sequence and encoding at least one transgene; and c) isolating Ad vector particles comprising at least one TetO polynucleotide sequence and encoding at least one transgene; Wherein: the polynucleotide of part a) has at least about 90% identity to any one of SEQ ID NO: 3, 4, 8 or 9; and the number of Ad vector particles isolated in step c) comprising at least one TetO polynucleotide sequence and encoding at least one transgene is at least about 2, 10, 15, 20, 50, 100, 150, 200, 250 or 300 times the number of Ad vector particles obtained from Ad vector packaging cells lacking the TetR polynucleotide.

17. The method according to claim 16, wherein the TetR expression cassette is the expression cassette according to SEQ ID NO: 7 or having at least about 90% identity thereto.

18. The method according to claim 14, wherein the intron sequence is SEQ ID NO: 9 or having at least about 90% identity thereto.

19. The method according to claim 8 or 16, wherein the poly(A) polynucleotide sequence is a BGH or SV40 poly(A) polynucleotide sequence, optionally SEQ ID NO: 4 or SEQ ID NO: 6 or having at least about 90% identity thereto.

20. The method according to claim 8 or 16, wherein the transgene is a viral or bacterial antigen.

21. The method according to claim 20, wherein the viral antigen is a coronavirus or influenza antigen.

22. The method according to claim 16, wherein the rabbit β-globin intron sequence comprises SEQ ID NO: 9 or having at least about 90% identity thereto, the poly(A) polynucleotide sequence is a BGH poly(A) polynucleotide sequence (SEQ ID NO: 4) or having at least about 90% identity thereto, the transgene comprises a coronavirus spike protein, and the number of Ad vector particles is at least about 30, 85 or 350 times the number of Ad vector particles obtained from Ad vector packaging cells lacking the TetR polynucleotide.

23. The method according to claim 16, wherein the rabbit β-globin intron sequence comprises SEQ ID NO: 9 or having at least about 90% identity thereto, the poly(A) polynucleotide sequence is a BGH poly(A) polynucleotide sequence (SEQ ID NO: 4) or having at least about 90% identity thereto, the transgene comprises the influenza hemagglutinin (HA) surface protein antigen from A / Perth / 16 / 2009 (H3N2), and the number of Ad vector particles is at least about 5 or 15 times the number of Ad vector particles obtained from Ad vector packaging cells lacking the TetR polynucleotide.

24. An adenovirus particle prepared according to any one of claims 8-23.

Citation Information

Patent Citations

  • Microwave plasma processing apparatus

    EP0380119A2

  • Transfer vectors and microorganisms containing human cytomegalovirus immediate-early promoter-regulatory DNA sequence

    US5168062A

  • Transfer vectors and microorganisms containing human cytomegalovirus immediate-early promoter regulatory DNA sequence

    US5385839A