Variant microorganism having improved L-citrulline or L-arginine production capacity, and method for producing L-citrulline or L-arginine using same

Abstract

The present invention relates to a variant microorganism having improved L-citrulline or L-arginine production capacity and a method for producing L-citrulline or L-arginine using the same, the variant microorganism being obtained by weakening or inactivating the activity of a protein encoded with the NCgl2653 gene, and having improved L-citrulline or L-arginine production capacity, and to a method for producing L-citrulline or L-arginine production using the variant microorganism. Therefore, compared with the prior art, the production yield of L-citrulline or L-arginine can be improved.

Description

Technical Field

[0001] The present invention relates to a mutant microorganism with improved L-citrulline or L-arginine production ability and a method for producing L-citrulline or L-arginine using the same. Background Art

[0002] Citrulline is one of the non-essential amino acids and has the following beneficial effects: promoting ammonia metabolism in the body, improving blood flow through vasodilation, lowering blood pressure, neurotransmission, enhancing immunity, scavenging reactive oxygen species, etc. In the kidneys, citrulline is metabolized into arginine, thereby producing NO (nitric oxide). That is, although citrulline is not an amino acid that constitutes proteins in living organisms, it is one of the intermediates of the urea cycle, produced from arginine together with NO, which is known as a substance having a vasodilatory effect, and is regenerated into arginine by condensation with aspartic acid.

[0003] Arginine, although belonging to the non-essential amino acids, is a semi-essential amino acid that must be provided in children during the growth period and in special states such as stress, trauma, and cancer, and is widely used as a component of amino acid enhancers, drugs, foods, etc. As a drug, it is used for liver function promoters, brain function promoters, male infertility treatment agents, comprehensive amino acid preparations, etc., and as a food, it is used as an additive for fish cakes, an additive for health drinks, and a salt substitute for hypertensive patients.

[0004] In the production of citrulline or arginine using microorganisms, L-citrulline or L-arginine can be produced using naturally occurring wild-type strains or variant strains modified from wild-type strains to have improved arginine or citrulline productivity. In recent years, in order to improve the production efficiency of L-citrulline or L-arginine, genetic recombination techniques have been applied to microorganisms such as Escherichia coli and Corynebacterium, which are widely used in the production of L-amino acids and other useful substances, and thus various recombinant strains or variant strains with excellent L-citrulline or L-arginine production ability and production methods of L-citrulline or L-arginine using the same have been developed. In microorganisms, L-glutamate is synthesized from 2-oxoglutarate, which is an intermediate of the citric acid cycle, and used as a starting material, and L-citrulline and L-arginine are synthesized through N-acetylglutamate, N-acetylglutamyl-P, N-acetylglutamate 5-semialdehyde, N-acetylornithine, and L-ornithine. In the biosynthetic process of L-citrulline or L-arginine in microorganisms, various proteins such as enzymes, transcription factors, and transport proteins are involved step by step. Therefore, by inducing mutations in the genes encoding such proteins or the promoters regulating their expression, the production amount of L-citrulline or L-arginine can be increased.

[0005] In Korean Patent Publication No. 10-2007-0053321, a technique is disclosed for effectively producing L-glutamic acid while maintaining the growth rate of a strain by inducing a mutation in 2-oxoglutarate dehydrogenase (odhA) of a 2-oxoglutarate dehydrogenase complex (ODHC) involved in the production of (succinyl)-CoA by removing a carboxyl group from 2-oxoglutaric acid in the citric acid cycle, thereby reducing the activity of 2-oxoglutarate dehydrogenase. In Korean Patent Publication No. 10-2008-0052593, a method for producing L-amino acids by a microorganism in which the activity of ODHC is reduced according to a transporter is disclosed. The above transporter, as an oxoglutarate dehydrogenase inhibitor OdhI, reduces the activity of ODHC under non-phosphorylated conditions, and the phosphorylation of OdhI is inhibited by inactivating serine / threonine-protein kinase PknG. Therefore, it was confirmed that the activity of ODHC can be effectively reduced by the deletion of PknG or OdhI to produce glutamic acid. However, the deletion of PknG is very likely to change the intracellular phosphate pool, and there are unpredictable problems, and the effects of the weakening of the activity of ODHC on the productivity of L-citrulline and L-arginine are not disclosed in these prior literatures.

[0006] Therefore, in fact, in order to increase the productivity of L-citrulline and L-arginine by regulating the activities of various proteins directly or indirectly involved in the production of L-citrulline and L-arginine, a large amount of research still needs to be conducted.

[0007] Prior art documents

[0008] Patent documents

[0009] Korean Patent No. 10-2007-0053321

[0010] Korean Patent No. 10-2008-0052593 Summary of the Invention

[0011] An object of the present invention is to provide a mutant microorganism with improved L-citrulline or L-arginine production ability.

[0012] In addition, an object of the present invention is to provide a method for producing L-citrulline or L-arginine using the above mutant microorganism.

[0013] One embodiment of the present invention provides a mutant microorganism with weakened activity of the protein encoded by the NCgl2653 gene and improved L-citrulline or L-arginine production ability.

[0014] The "NCgl2653 gene" used in the present invention encodes a transmembrane protein that penetrates the intracellular bilayer lipid layer and mainly functions as a channel for substance transport. The protein encoded by the NCgl2653 gene is GlnX, which uses extracellular L-glutamate or L-aspartate as a medium to activate the GlnH-GlnX-PknG-OdhI-OdhA signal transduction cascade (Lea Sundermeyer et al., Microbiology Spectrum. 2022 Dec 21;10(6):e0267722.).

[0015] According to a specific example of the present invention, the above NCgl2653 gene and the protein encoded by it can be included in a Corynebacterium strain.

[0016] Specifically, the above-mentioned Corynebacterium genus can be Corynebacterium glutamicum, Corynebacterium crudilactis, Corynebacterium deserti, Corynebacterium callunae, Corynebacterium suranareeae, Corynebacterium lubricantis, Corynebacterium doosanense, Corynebacterium efficiens, Corynebacterium uterequi, Corynebacterium stationis, Corynebacterium pacaense, Corynebacterium singulare, Corynebacterium humireducens, Corynebacterium marinum, Corynebacterium halotolerans, Corynebacterium spheniscorum, Corynebacterium freiburgense, Corynebacterium striatum, Corynebacterium canis, Corynebacterium ammoniagenes, Corynebacterium renale, Corynebacterium pollutisoli, Corynebacterium imitans, Corynebacterium caspium, Corynebacterium testudinoris, Corynebacaterium pseudopelargi, Corynebacterium flavescens, etc., but is not limited thereto.

[0017] According to a specific example of the present invention, the above-mentioned NCgl2653 gene may include the nucleotide sequence of SEQ ID NO:1, and the protein encoded by the above-mentioned NCgl2653 gene may be composed of the amino acid sequence of SEQ ID NO:2.

[0018] In the present invention, the use of "attenuated activity" or "activity attenuation" means that the activity of the polypeptide or protein as the target is reduced or has no such activity compared with the intrinsic activity, and can be used interchangeably with terms such as inactivation, deletion, reduction, decrease, etc. Specifically, activity attenuation may include: the case where the activity of the polypeptide itself is reduced or removed compared with the activity of the polypeptide possessed by the original microorganism, that is, the wild-type or pre-modified microorganism, due to nucleotide modification of the gene encoding the polypeptide; the case where the overall activity level (expression level) of the polypeptide is reduced compared with the original microorganism due to modification of the regulatory region of the gene encoding the polypeptide, expression obstacle or translation obstacle of the target gene, etc.; the case where the polypeptide has no activity even if the gene encoding the polypeptide is expressed; and combinations thereof, but is not limited thereto.

[0019] The above-mentioned nucleotide modification means that the polynucleotide sequence of the gene encoding the polypeptide is different from the original polynucleotide sequence due to overall or partial deletion, substitution, addition, or a combination thereof. The above-mentioned regulatory region modification means that in the polynucleotide sequence of the elements constituting the regulatory region such as a promoter or an enhancer, it is different from the original polynucleotide sequence due to overall or partial deletion, substitution, addition, or a combination thereof. For example, in order to reduce or inhibit the expression of a gene, a weak promoter can be substituted. Here, substitution means that a base, nucleotide, polynucleotide, or nucleic acid is changed to another base, nucleotide, polynucleotide, or nucleic acid. Insertion means a change in which other bases, nucleotides, polynucleotides, or nucleic acids are added. Deletion means a change in which a base, nucleotide, polynucleotide, or nucleic acid is removed.

[0020] According to a specific example of the present invention, the attenuation of the activity of the protein encoded by the above-mentioned NCgl2653 gene may be composed of nucleotide modification, regulatory region modification, or a combination thereof of the NCgl2653 gene.

[0021] As an example, the attenuation of the activity of the protein encoded by the above-mentioned NCgl2653 gene may be achieved by deletion of one or more bases in a part of the base sequence of the NCgl2653 gene, but is not limited thereto.

[0022] The base sequence of the NCgl2653 gene according to the present invention or the amino sequence of the protein encoded by the NCgl2653 gene is formed by or must contain a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% homology or identity compared to the base sequence of SEQ ID NO:1 or the amino sequence of SEQ ID NO:2, and can have the original function. Here, "homology" or "identity" refers to the coincidence rate (%) between two sequences when the reference base sequence or amino acid sequence is aligned with any other base sequence or amino acid sequence in the most corresponding manner for analysis.

[0023] "Improved productivity" as used in the present invention means that the productivity of L-citrulline or L-arginine is increased compared to the mutant target (parent strain). The above-mentioned parent strain refers to the wild type or mutant strain that becomes the object of mutation, including the object directly mutated or the object transformed by a recombinant vector, etc. In the present invention, the parent strain may be a microorganism or strain of the genus Corynebacterium that has no L-citrulline or L-arginine production ability or has L-citrulline or L-arginine production ability and may be a wild type or a mutant of the wild type.

[0024] According to a specific example of the present invention, the mutant microorganism may be a strain of the genus Corynebacterium.

[0025] As an example, the mutant microorganism may be Corynebacterium glutamicum, but is not limited thereto.

[0026] According to the mutant microorganism of the present invention, the activity of the protein encoded by the NCgl2653 gene is weakened or inactivated, so that the productivity of L-citrulline or L-arginine can be improved.

[0027] Specifically, the mutant microorganism with improved L-citrulline or L-arginine production capacity shows an increased L-citrulline or L-arginine production capacity compared to the parental strain. In particular, the production amount of L-citrulline or L-arginine can be increased by at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 100% compared to the parental strain, or can be increased by 1.1 times, 1.5 times, 2 times, 2.5 times, 3 times, 3.5 times, 4 times, 4.5 times, 5 times, 5.5 times, 6 times, 6.5 times, 7 times, 7.5 times, 8 times, 8.5 times, 9 times, 9.5 times or 10 times, but is not limited thereto. As an example, the mutant microorganism in which the activity of the protein encoded by the above NCgl2653 gene is weakened or inactivated can increase the production amount of L-citrulline or L-arginine by more than 5% compared to the parental strain. Specifically, it can be increased by 5 to 40% (preferably 7 to 30%).

[0028] The composition comprising the mutant microorganism according to the present invention can be used as a composition for producing L-citrulline or L-arginine.

[0029] The mutant microorganism according to a specific example of the present invention can be achieved by a recombinant vector that deletes all or part of the gene encoding the protein encoded by the NCgl2653 gene in the parental strain.

[0030] The "vector" used in the present invention refers to all types of nucleic acid sequence transport structures used as a means for transferring and expressing a target gene to a mutant object (host cell). Unless otherwise specified, the above vector can be such that the loaded nucleic acid sequence is inserted into the host cell gene for expression and / or independently expressed. Such a vector includes essential regulatory elements operably linked for expressing the gene insert. "Operably linked" means that the target gene and its regulatory sequences are functionally bound to each other and linked in a manner capable of gene expression. The "regulatory elements" include a promoter for carrying out transcription, any operator sequence for regulating transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence for regulating the termination of transcription and translation.

[0031] The vector used in the present invention is not particularly limited as long as it can replicate in a host cell, and any vector known in the art can be used. As an example of the above vector, plasmids, cosmids, viruses, and bacteriophages in their natural or recombinant states can be mentioned. For example, as phage vectors or cosmid vectors, there are pWE15, M13, λMBL3, λMBL4, λIXII, λASHII, λAPII, λt10, λt11, Charon4A, Charon21A, etc., and as plasmid vectors, there are pBR series, pUC series, pBluescriptII series, pGEM series, pTZ series, pCL series, and pET series, etc., but are not limited thereto.

[0032] The above vector can typically be constructed as a vector for cloning or a vector for expression. As a vector for expression, a conventional vector used in the art for expressing foreign genes or proteins in plants, animals, or microorganisms can be used, and it can be constructed by various methods well-known in the art.

[0033] The "recombinant vector" used in the present invention can be constructed using prokaryotic cells or eukaryotic cells as hosts, can replicate independently of the host cell genome, or can be integrated into the genome itself. The above host cells can replicate the vector and can include an origin of replication that is a specific base sequence for starting replication. For example, when the vector used is an expression vector and the host is a prokaryotic cell, it usually includes a strong promoter that can initiate transcription (for example, pLλ promoter, CMV promoter, trp promoter, lac promoter, tac promoter, T7 promoter), a ribosome binding site for starting translation, and a transcription / translation termination sequence. When the host is a eukaryotic cell, the origin of replication that initiates in the eukaryotic cell contained in the vector includes f1 origin of replication, SV40 origin of replication, pMB1 origin of replication, adenovirus origin of replication, AAV origin of replication, and BBV origin of replication, etc., but are not limited thereto. In addition, a promoter derived from the genome of mammalian cells (for example, metallothionein promoter) or a promoter derived from mammalian viruses (for example, adenovirus late promoter, vaccinia virus 7.5K promoter, SV40 promoter, cytomegalovirus promoter, tk promoter of HSV) can be used, and usually has a polyadenylation sequence as a transcription termination sequence.

[0034] The above recombinant vector can include a selection marker, which is used to screen for transformants (host cells) transformed with the vector. Only cells expressing the selection marker can survive in the medium treated with the above selection marker, so transformed cells can be screened. As representative examples, the above selection markers include ampicillin, kanamycin, streptomycin, chloramphenicol, etc., but are not limited thereto.

[0035] By inserting the above recombinant vector into a host cell, a transformant can be produced, and the above transformant can be obtained by introducing the recombinant vector into a suitable host cell. A host cell is a cell that can stably and continuously clone or express the above expression vector, and any host cell well-known in the art can also be used.

[0036] When transforming a prokaryotic cell to produce a recombinant microorganism, as the host cell, Escherichia coli such as E. coli JM109, E. coli BL21, E. coli RR1, E. coli LE392, E. coli B, E. coli X 1776, E. coli W3110, E. coli XL1-Blue can be used; Bacillus genera such as Corynebacterium, Bacillus subtilis, Bacillus thuringiensis; various enteric bacteria and strains such as Salmonella typhimurium, Serratia marcescens, and Pseudomonas genus, etc., but not limited thereto.

[0037] When transforming a eukaryotic cell to produce a recombinant microorganism, as the host cell, yeast (for example, Saccharomyces cerevisiae), insect cells, plant cells, and animal cells such as Sp2 / 0, CHO K1, CHO DG44, PER.C6, W138, BHK, COS7, 293, HepG2, Huh7, 3T3, RIN, MDCK cell lines, etc., can be used, but not limited thereto.

[0038] "Transformation" used in the present invention refers to the phenomenon of artificially causing hereditary changes by introducing foreign DNA into a host cell, and "transformant" refers to a host cell into which foreign DNA has been introduced and stably maintains the expression of the target gene.

[0039] In the above transformation, an appropriate vector introduction technique is selected according to the host cell, so that the target gene or the recombinant vector containing it can be expressed in the host cell. For example, vector introduction can be carried out by electroporation, heat-shock, calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl2) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE-dextran method, cationic liposome method, lithium acetate-DMSO method, or a combination thereof, but is not limited thereto. As long as the transformed gene can be expressed in the host cell, it can be included, and it is not limited to inserting it into the chromosome of the host cell or being located outside the chromosome.

[0040] The above transformants include cells transfected, transformed or infected with the recombinant vector according to the present invention in vivo or in vitro, and can be used interchangeably with recombinant host cells, recombinant cells or recombinant microorganisms.

[0041] The gene inserted into the recombinant vector for transformation of the present invention can be replaced into a host cell such as a Corynebacterium microorganism due to homologous recombination crossover.

[0042] According to a specific example of the present invention, the above host cell can be a Corynebacterium microorganism. For example, the Corynebacterium microorganism can be Corynebacterium glutamicum.

[0043] According to another embodiment of the present invention, a method for producing L-citrulline or L-arginine is provided, including the following steps: culturing the above mutant microorganism in a medium; and recovering L-citrulline or L-arginine from the above mutant microorganism or the medium for culturing the mutant microorganism.

[0044] The above culture can be carried out according to appropriate media and culture conditions known in the art, and those skilled in the art can easily adjust the media and culture conditions for use. Specifically, the above medium can be a liquid medium, but is not limited thereto. The culture method can include, for example, batch culture, continuous culture, fed-batch culture or a combined culture thereof, but is not limited thereto.

[0045] According to a specific example of the present invention, the above-mentioned culture medium must meet the requirements of a specific strain in a suitable manner and can be appropriately changed by those skilled in the art. Regarding the culture medium for Corynebacterium strains, reference can be made to well-known literature (Manual of Methods for General Bacteriology. American Society for Bacteriology. Washington D.C., USA, 1981), but it is not limited thereto.

[0046] According to a specific example of the present invention, the culture medium may contain various carbon sources, nitrogen sources, and trace element components. As carbon sources that can be used, it includes sugars and carbohydrates such as glucose, sucrose, lactose, fructose, maltose, starch, and cellulose; oils and fats such as soybean oil, sunflower oil, castor oil, and coconut oil; fatty acids such as palmitic acid, stearic acid, and linoleic acid; alcohols such as glycerol and ethanol; and organic acids such as acetic acid. These substances can be used alone or in the form of a mixture, but it is not limited thereto. As nitrogen sources that can be used, it can include peptone, yeast extract, broth, malt extract, corn steep liquor, soybean meal, and urea or inorganic compounds, for example, ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate, and ammonium nitrate. The nitrogen source can also be used alone or in the form of a mixture, but it is not limited thereto. As a source of phosphorus that can be used, it can include potassium dihydrogen phosphate or dipotassium hydrogen phosphate or the corresponding sodium-containing salts, but it is not limited thereto. In addition, the culture medium may contain metal salts such as magnesium sulfate or ferrous sulfate required for growth, but it is not limited thereto. In addition to this, essential growth substances such as amino acids and vitamins can be included. In addition, precursors suitable for the culture medium can be used. The above-mentioned culture medium or individual components can be added to the culture broth batchwise or continuously in a suitable manner during the culture process, but it is not limited thereto.

[0047] According to a specific example of the present invention, during the culture process, compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, and sulfuric acid can be added to the microbial culture broth in a suitable manner to adjust the pH of the culture broth. In addition, during the culture process, an antifoaming agent such as fatty acid polyethylene glycol ester can be used to inhibit the generation of bubbles. Further, in order to maintain an aerobic state of the culture broth, oxygen or an oxygen-containing gas (such as air) can be injected into the culture broth. The temperature of the culture broth can generally be 20°C to 45°C, for example, it can be 25°C to 40°C. The culture time can continue until the desired production amount of the useful substance is obtained, for example, it can be 10 to 160 hours.

[0048] According to a specific example of the present invention, in the step of recovering L-citrulline or L-arginine from the cultured transformant or the culture medium of the cultured transformant, the produced L-citrulline or L-arginine can be collected or recovered from the culture medium according to the culture method and by using suitable methods well-known in the art. For example, methods such as centrifugation, filtration, extraction, spraying, drying, evaporation, precipitation, crystallization, electrophoresis, fractional dissolution (e.g., ammonium sulfate precipitation), chromatography (e.g., ion exchange, affinity, hydrophobicity, and size exclusion) can be used, but are not limited thereto.

[0049] According to a specific example of the present invention, in the step of recovering L-citrulline or L-arginine, the culture medium can be centrifuged at a low speed to remove biomass, and the obtained supernatant can be separated by ion exchange chromatography.

[0050] According to a specific example of the present invention, in the step of recovering L-citrulline or L-arginine, a step of purifying L-citrulline or L-arginine can be included.

[0051] In the mutant microorganism according to the present invention, the activity of the protein encoded by the NCgl2653 gene is weakened or inactivated, so that the production yield of L-citrulline or L-arginine can be increased compared with that before the mutation. Detailed Description of the Invention

[0052] Hereinafter, the present invention will be described in more detail. However, such description is only exemplarily provided to help understand the present invention, and the scope of the present invention is not limited to such exemplary description.

[0053] Example 1. Preparation of NCgl2653 Deletion Strain

[0054] The NCgl2653 gene encoding GlnX in Corynebacterium glutamicum was removed to prepare a mutant strain.

[0055] 1-1. Vector for NCgl2653 Deletion

[0056] Using the chromosomal DNA of Corynebacterium glutamicum ATCC13032 as a template, PCR amplifications were performed using the combinations of primer 1 and primer 2 and the combination of primer 3 and primer 4, respectively. After the PCR products obtained thereby were amplified by crossover PCR using the combination of primer 1 and primer 4, the PCR products were inserted into the restriction enzyme HindIII and XbaI sites of the pK19mobSacB vector (Gene, 145: 69-73, 1994) using Gibson Assembly MasterMix (NEB, USA) and restriction enzymes HindIII and XbaI (NEB, USA). The constructed vector was named pK19ms-△NCgl2653.

[0057] To isolate chromosomal DNA from Corynebacterium glutamicum ATCC13032, Wizard Genomic DNA Purification Kit (Promega, USA) was used.

[0058] For PCR, KOD-Plus-Neo High fidelity DNA Polymerase (Toyobo, Japan) was used. In a reaction solution supplemented with 200 μM of each deoxynucleotide triphosphate (dATP, dCTP, dGTP, dTTP), 0.2 μM of oligonucleotide and 20 ng of the chromosomal DNA of Corynebacterium glutamicum ATCC13032 were used as a template, and 30 cycles were carried out in the presence of 1 unit of KOD-Plus-Neo DNA polymerase mixture. PCR was carried out under the conditions of i) pre-denaturation step: at 94 °C for 2 minutes, ii) denaturation step: at 94 °C for 10 seconds, iii) annealing step: at 56 °C for 30 seconds, and iv) extension step: at 68 °C for 1 - 3 minutes (30 seconds of polymerization time was given per 1 kb).

[0059] The primers used here are shown in Table 1 below.

[0060]

Table 1

[0061] Primer Name Primer Sequence (5'→3') SEQ ID NO Primer 1 tgattacgccaagctcgcaccagtgtcgcataaacc 3 Primer 2 gcgtcgaaaagcgtgcatctctgaatgctccccatttcC 4 Primer 3 ggaaatggggagcattcagagatgcacgcttttcgacgc 5 Primer 4 ccggggatcctctagagccatcggtgacacaaatgg 6

[0062] 1-2. NCgl2653-deleted Corynebacterium glutamicum mutant strain

[0063] In Corynebacterium glutamicum CT19b3 (accession number KCCM13451P), which is a L-citrulline producing strain, the pK19ms-△NCgl2653 vector was introduced to delete the NCgl2653 gene.

[0064] The above-mentioned Corynebacterium glutamicum CT19b3 was prepared by culturing in RG medium (40 g / L Brain Heart Infusion, 10 g / L Beef extract, and 30 g / L Sorbitol) at a temperature of 30 °C.

[0065] After the prepared pK19ms-△NCgl2653 vector was introduced into Corynebacterium glutamicum CT19b3 made into competent cells by electroporation, it was spread on CIT active KM agar medium and cultured in a 30 °C medium for 2 days to obtain colonies. Four colonies induced for homologous recombination once were patched onto 2YT sucrose agar medium and CIT active KM agar medium and cultured in a 30 °C incubator for 1 day to obtain single colonies. The colonies that were confirmed to grow poorly on 2YT sucrose agar medium and grow well on CIT active KM agar medium were inoculated into 2YT liquid medium and cultured for 12 hours. The culture solution was spread on 2YT sucrose agar medium to remove the antibiotic marker (kanamycin) through secondary homologous recombination. The selected colonies were finally confirmed by PCR and sequence analysis to have the NCgl2653 gene deleted as expected. The NCgl2653 gene deletion strain prepared through the above process was named CT20i.

[0066] The CIT active KM agar medium used herein contains 10.5 g / L of Glucose, 10 g / L of Beef extract, 10 g / L of Yeast extract, 10 g / L of Polypeptone, 2.5 g / L of NaCl, 100 mg / L of Arginine, 2% of Agar, and 30 μg / mL of Kanamycin. The 2YT sucrose agar medium contains 2YT Agar and 150 g / L of Sucrose. The above 2YT Agar medium contains 16 g / L of Tryptone, 10 g / L of Yeast extract, 5 g / L of NaCl, and 2% of agar.

[0067] Comparative Example 1. Preparation of PknG deletion strain

[0068] The gene encoding PknG was deleted in Corynebacterium glutamicum CT19b3.

[0069] Using the primers shown in Table 2 below, except for this, a PknG deletion strain was prepared by the same method as in Example 1 and named CT20i2.

[0070]

Table 2

[0071] Primer Name Primer Sequence (5'→3') SEQ ID NO Primer 1 gaccatgattacgccaagctacgatcaccgacgaacgc 7 Primer 2 aaatagccccaagtcaaaacagaatcttcattatccttcatcgttttctg 8 Primer 3 cagaaaacgatgaaggataatgaagattctgttttgacttggggctattt 9 Primer 4 ggtacccggggatcctctaggttgcgtcggagtttgacg 10

[0072] Experimental Example 1. Evaluation of the enzyme activity of ODHC

[0073] The intracellular ODHC activity of the NCgl2653 deletion strain prepared in Example 1 was evaluated by comparison with the parental strain Corynebacterium glutamicum CT19b3.

[0074] Each strain was inoculated into its respective RG medium (40 g / L Brain Heart Infusion, 10 g / L Beef extract, and 30 g / L Sorbitol). After culturing at 30 °C for 24 hours, cells equivalent to 8 mg (dry cell weight, DCW) were harvested. Then, a crude extract was obtained using a cell disruptor (GeneReady Ultracool), and the enzyme activity was measured using an ODHC enzyme assay kit (Elabscience). The results are shown in Table 3 below.

[0075] [Table 3]

[0076] Strain ODHC Activity (U / L) Parental Strain_CT19b3 8.79 CT20i 3.29

[0077] As shown in Table 3 above, in the NCgl2653 deletion strain CT20i of Example 1, in the GlnH-GlnX-PknG-OdhI-OdhA signal transduction cascade, by deleting the NCgl2653 gene encoding GlnX, which is an upstream protein of OdhI, the activated form of OdhI increased. As a result, the activity of ODHC was inhibited, and it was confirmed that the ODHC activity was weakened by approximately 2.7-fold compared to the parental strain.

[0078] Experimental Example 2. Evaluation of L-citrulline production ability

[0079] The L-citrulline productivity of the NCgl2653 deletion strain prepared in Example 1 was evaluated by comparing it with the parental strain Corynebacterium glutamicum CT19b3 and the PknG deletion strain of Comparative Example 1.

[0080] After inoculating each strain on a CIT active agar plate in a 2x2 cm square shape, it was activated at 30 °C for 24 hours. Then, 3 / 4 of the activated strain was taken with a loop and inoculated into a citrulline titer medium (5% Glucose, 1 g / L MgSO4, 4 g / L YSP, 0.8 g / L KH2PO4, 1.2 g / L Na2HPO4, 30 g / L (NH4)2SO4, 20 mg / L FeSO4, 20 mg / L MnSO4, 10 mg / L ZnSO4, 100 mg / L Arginine, 100 g / L Biotin, and 200 μg / L Thiamine), and then cultured with shaking at 32 °C and 190 rpm for 30 hours. After the culture was completed, in order to analyze the contents of L-citrulline, L-glutamate, and L-ornithine in the culture solution, the culture solution was diluted 50 times with distilled water, filtered through 0.45 μm, and the above amino acids were detected and quantified using a high-performance liquid chromatography (HPLC) equipped with a column ( Apollo C18, HPLC column (Columns)) and an ultraviolet detector (338 nm). The results are shown in Table 5 below.

[0081]

Table 5

[0082]

[0083] As shown in Table 5 above, compared with the parental strain, the cell mass of CT20i and CT20i2 increased, and at the same time, the production of L-glutamate and L-ornithine decreased and the production of L-citrulline increased. It is considered that due to the deletion of PknG or NCgl2653, in the citric acid cycle, the decomposition of aspartate and the removal of fumarate were not smooth, so the cell mass increased through compensatory action, and the carbon flow of the citrulline biosynthesis pathway was strengthened. In particular, in CT20i, the production of L-glutamate and L-ornithine decreased significantly compared with CT20i2. Such results indicate that the deletion of the NCgl2653 gene encoding GlnX reduces the activity of ODHC, thereby increasing the L-citrulline productivity.

[0084] Example 2. Preparation of NCgl2653 deletion strain

[0085] The pK19ms-△NCgl2653 vector prepared in Example 1 was introduced into Corynebacterium glutamicum 14GR (Accession No. KCCM13219P), which is an L-arginine-producing strain, to delete the NCgl2653 gene encoding GlnX.

[0086] The above-mentioned Corynebacterium glutamicum 14GR was prepared by culturing in RG medium (40 g / L Brain Heart Infusion, 10 g / L Beef extract, and 30 g / L Sorbitol) at a temperature of 30 °C.

[0087] After the prepared pK19ms-△NCgl2653 vector was introduced into Corynebacterium glutamicum 14GR made into competent cells by electroporation, it was spread on ARG active KM agar medium and cultured in a 30 °C medium for 2 days to obtain colonies. Four colonies in which homologous recombination was induced once were patched onto 2YT sucrose agar medium and ARG active KM agar medium and cultured in a 30 °C incubator for 1 day to obtain single colonies. The colonies that were confirmed to grow poorly on 2YT sucrose agar medium and grow well on ARG active KM agar medium were inoculated into 2YT liquid medium and cultured for 12 hours. The culture solution was spread on 2YT sucrose agar, and the antibiotic marker (kanamycin) was removed by secondary homologous recombination. The selected colonies were finally confirmed by PCR and sequence analysis to have the NCgl2653 gene deleted as expected. The NCgl2653 gene deletion strain prepared through the above process was named ARX1.

[0088] The ARG active KM agar medium used here contains 10.2 g / L of glucose, 10 g / L of beef extract, 10 g / L of yeast extract, 10 g / L of polypeptone, 2.5 g / L of NaCl, 3 g / L of urea, 2 g / L of (NH4)2SO4, 100 μg / L of biotin, 2% of agar, and 30 μg / mL of kanamycin. The 2YT sucrose agar medium contains 2YT agar and 150 g / L of sucrose. The above 2YT agar medium contains 16 g / L of tryptone, 10 g / L of yeast extract, 5 g / L of NaCl, and 2% of agar.

[0089] Experimental Example 3. Evaluation of L-arginine production ability

[0090] Compared with the parental strain Corynebacterium glutamicum 14GR, the L-arginine productivity of the NCgl2653 deletion strain prepared in Example 2 was evaluated.

[0091] After inoculating each strain on the ARG active plate in a 2 x 2 cm square shape, it was activated at 30 °C for 24 hours. Then, 3 / 4 of the activated strain was taken with a loop and inoculated into the arginine titer medium (8% glucose, 1 g / L of MgSO4, 4 g / L of YSP, 2 g / L of KH2PO4, 2 g / L of urea, 40 g / L of (NH4)2SO4, 20 mg / L of FeSO4, 20 mg / L of MnSO4, 100 g / L of biotin, and 200 μg / L of thiamine), and then cultured with shaking at 32 °C and 190 rpm for 30 hours. After the culture was completed, in order to analyze the contents of L-arginine, L-citrulline, L-glutamic acid, and L-ornithine in the culture broth, the culture broth was diluted 50 times with distilled water, filtered through 0.45 μm, and then detected and quantified for the above amino acids using a high-performance liquid chromatograph (HPLC) equipped with a column ( Apollo C18, HPLC chromatographic column) and an ultraviolet detector (338 nm). The results are shown in Table 6 below.

[0092]

Table 6

[0093]

[0094] As described in Table 6 above, compared with the parental strain, the cell mass of ARX1 decreased, and at the same time, the production of L-glutamic acid decreased while the production of L-ornithine, L-citrulline, and L-arginine increased. It is considered that this is due to the deletion of NCgl2653, which solved the bottleneck phenomenon of the citric acid cycle. When the cell mass decreased, the carbon flow in the arginine biosynthesis pathway was strengthened. Such a result is due to the deletion of the NCgl2653 gene encoding GlnX, which reduced the activity of ODHC, thereby increasing the L-arginine productivity.

[0095] So far, the present invention has been studied around its preferred embodiments. Those skilled in the art to which the present invention pertains can understand that the present invention can be implemented in a modified form without departing from the essential characteristics of the present invention. Therefore, the disclosed embodiments should be considered from an illustrative rather than a restrictive perspective. The scope of the present invention is shown in the claims rather than the above description, and should be interpreted to include all differences within the scope equivalent thereto in the present invention.

[0096]

Deposit Information

[0097] Name of depositary institution: Korean Collection for Type Cultures (KCCM)

[0098] Deposit number: KCCM13451P

[0099] Date of deposit: January 4, 2024

[0100] Taxonomic name of the biological material: Corynebacterium glutamicum

[0101] Name of depositary institution: Korean Collection for Type Cultures (KCCM)

[0102] Deposit number: KCCM13219P

[0103] Date of deposit: June 29, 2022

[0104] Taxonomic name of the biological material: Corynebacterium glutamicum.

Claims

1. A mutant microorganism with improved L-citrulline or L-arginine production ability, in which the activity of the protein encoded by the NCgl2653 gene is attenuated.

2. The mutant microorganism according to claim 1, wherein the protein encoded by the NCgl2653 gene consists of the amino acid sequence of SEQ ID NO:

2.

3. The mutant microorganism according to claim 1, wherein the attenuation of the activity of the protein encoded by the NCgl2653 gene is achieved by nucleotide modification of the NCgl2653 gene, regulatory region modification, or a combination thereof.

4. The mutant microorganism according to claim 1, wherein, The mutant microorganism is a strain of the genus Corynebacterium.

5. A method for producing L-citrulline or L-arginine, comprising the following steps: culturing the mutant microorganism according to claim 1 in a medium; and recovering L-citrulline or L-arginine from the mutant microorganism or the medium in which the mutant microorganism is cultured.

Images