Genetically engineered bacterium, preparation method thereof and application of genetically engineered bacterium in synthesis of bacterial cellulose / hyaluronic acid composite membrane

Abstract

The invention belongs to the technical field of bioengineering, and discloses a genetically engineered bacterium capable of simultaneously synthesizing bacterial cellulose (BC) and hyaluronic acid (HA), a preparation method of the genetically engineered bacterium and application of the genetically engineered bacterium in one-step fermentation preparation of a BC / HA composite membrane. According to the genetically engineered bacterium, gluconacetobacter xylinus CGMCC (China General Microbiological Culture Collection Center) 2955 is taken as a host, and a codon-optimized hyaluronic acid synthase gene (kxpmha) from pasteurella multocida and a UDP-glucose dehydrogenase gene (kxrkpk) from Chinese melilotus are introduced, so that the genetically engineered bacterium has the capability of synthesizing BC and HA at the same time. The BC / HA composite membrane can be prepared in one step by using the strain through standing fermentation, HA does not need to be externally added, a BC three-dimensional structure is effectively reserved, a traditional composite process is remarkably simplified, and the production cost is reduced. The obtained composite membrane has the high mechanical strength and biocompatibility of BC and the light transmission and wound healing promoting function of HA, and can be widely applied to the field of medical materials such as artificial corneas and wound dressings. The invention provides an efficient and low-cost technical scheme for development of green biological materials.

Description

1.1 Technical Field This research relates to the field of bioengineering technology, and specifically relates to a genetically engineered bacterium capable of simultaneously synthesizing bacterial cellulose (BC) and hyaluronic acid (HA), a preparation method thereof, and an application of this strain in the one-step fermentation preparation of BC / HA composite films. 1.2 Background Art Gluconacetobacter xylinus ( Komagataeibacter xylinus ) is the main strain for BC production. As a nanofiber material, BC has high water retention, excellent tensile resistance, and good biocompatibility, and can be widely used in fields such as wound dressings and artificial blood vessel scaffolds. However, the functionality of a single BC material is limited by the requirements of specific application scenarios. As a natural polysaccharide, HA has functions such as promoting wound healing and enhancing light transmittance, but the composite process with BC still poses challenges. After BC and HA are combined, they can have functions such as promoting wound healing and antibacterial. Although BC has excellent biocompatibility and structural characteristics, different application scenarios require BC to have corresponding functions. After HA is combined with BC, it can enhance the light transmittance of BC and its ability to promote wound healing, enabling BC to be applied to artificial corneas and wound dressings.

[0003] The combination of HA and BC mainly has two methods: non-in-situ combination and in-situ combination. Among them, non-in-situ combination is to crosslink BC and HA together by chemical methods, and this process will destroy the three-dimensional structure of BC. In-situ combination is to add HA to the culture medium during the fermentation process, so that HA is crosslinked with BC through hydrogen bonds during the synthesis process of BC. This method can not only retain the three-dimensional structure of BC but also endow BC with new functions. Compared with the method of in-situ fermentation to prepare BC / HA composite materials by adding HA to the culture medium, the genetically engineered strain constructed in the present invention can prepare BC / HA composite materials by one-step fermentation. In the process of preparing BC / HA composite materials using this method, it is no longer necessary to separately add HA to the culture medium. This can reduce the cost of the BC / HA composite material preparation process and maintain the three-dimensional structure of BC. This invention can provide more choices of green biological materials for society. 1.3 Summary of the Invention The present invention aims to solve the problem in the prior art that K. xylinus CGMCC 2955 cannot simultaneously synthesize BC and HA, and the specific technical solutions are as follows: To achieve the above object, according to the first aspect of the present invention, a genetically engineered bacterium is provided, and the above genetically engineered bacterium contains the gene of hyaluronan synthase and the gene of UDP-glucose dehydrogenase for synthesizing UDP-GlcA.

[0005] Furthermore, the gene of the hyaluronan synthase and the gene of the UDP-glucose dehydrogenase for synthesizing UDP-GlcA are based on K. xylinus the host CGMCC 2955 pmhas and rkpk the genes obtained by codon optimization of the initial gene sequences kxpmhas and kxrkpk .

[0006] Furthermore, the gene of the hyaluronan synthase (HAS) ( pmhas ) (SEQ ID NO.1) is derived from Pasteurella multocida ( Pasteurella multocida ); the gene of the UDP-glucose dehydrogenase ( rkpk ) (SEQ ID NO.2) is derived from the genome of Sinorhizobium meliloti ( Sinorhizobium meliloti ).

[0007] Furthermore, based on the genetic characteristics of the BC production strain host, the pmhas and rkpk gene sequences are codon-optimized, and the pmhas optimized kxpmhas gene sequence is as shown in SEQ ID NO.3, and the rkpk optimized kxrkpk gene sequence is as shown in SEQ ID NO.4.

[0008] Furthermore, the starting strain of the genetically engineered bacterium is K. xylinus CGMCC 2955 and its related gene-edited strains.

[0009] To achieve the above object, according to the second aspect of the present invention, a method for preparing a genetically engineered bacterium is provided. The above preparation method includes: transferring a plasmid carrying the hyaluronan synthase gene and the UDP-glucose dehydrogenase gene into a BC production strain to obtain the above engineered bacterium; Furthermore, using the pSEVA331 plasmid as the vector backbone, expressing the pmhas and rkpk genes with the lactose operon, and constructing a plasmid (pSEVA331-HA) for expressing the genes related to the synthesis of hyaluronic acid in E. coli DH5α. The sequence of pSEVA331-HA is as shown in SEQ ID NO.5.

[0010] Furthermore, the starting strain of the genetically engineered bacterium is K. xylinus CGMCC 2955 and its related gene-edited strains.

[0011] Furthermore, the pSEVA331-HA plasmid was introduced into the starting strain by electroporation to construct a genetically engineered bacterium capable of simultaneously synthesizing HA and BC.

[0012] To achieve the above object, according to the third aspect of the present invention, there is provided a method for preparing a BC / HA composite membrane using the corresponding genetically engineered bacterium, the method comprising: fermenting and synthesizing the BC / HA composite membrane in a fermentation medium using the above-mentioned genetically engineered bacterium or the genetically engineered bacterium prepared by the above-mentioned preparation method; Furthermore, the preparation of the BC / HA composite membrane is achieved by static fermentation in a shake flask or a tray.

[0013] Furthermore, the above shake flask fermentation includes: streaking the strain preserved at -80 °C on an HS solid medium containing chloramphenicol resistance in three zones; after culturing for four days, inoculating into a liquid medium for seed expansion culture, and collecting the cells after culturing until OD600 reaches 0.8 - 1.0; washing twice with HEPES buffer to remove cellulase in the medium, and inoculating at an initial OD600 of 0.05; after static fermentation culture for 7 days, taking out the biofilm from the fermentation medium, washing away the cells and medium residues in the biofilm with 0.1 mol / L NaOH, and washing away the NaOH in the BC / HA composite membrane with deionized water.

[0014] Furthermore, the above HS medium is: 25 g / L glucose, 10 g / L Na2HPO4, 7.5 g / L yeast powder, 10 g / L peptone, and when needed, 340 μg / L chloramphenicol is added to the medium; the fermentation conditions for the above seed culture are 180 rpm and 30 °C, and 4‰ volume of cellulase is added during the fermentation process; the centrifugation conditions for collecting the cells and washing the cells are: 4 °C, 5000 rpm, and the concentration of HEPES is 10 mM; the static fermentation conditions are: 30 °C, constant temperature culture for 7 days.

[0015] Furthermore, the specific process of washing away the cells and medium residues in the biofilm with NaOH is to soak the biofilm in the NaOH solution and change the solution every 12 h until the biofilm becomes milky white, at which time the cells and medium in the biofilm are completely removed; the specific process of washing away the NaOH in the BC / HA composite membrane with deionized water is to soak the BC / HA composite membrane in deionized water and change the deionized water every 12 h until the solution pH is around 7 - 8, at which time the NaOH in the BC / HA composite membrane is completely removed.

[0016] Applying the technical solution of the present invention, the genetically engineered bacterium of the present invention contains an exogenously introduced, codon-optimized hyaluronic acid synthase gene kxpmhas and UDP-glucose dehydrogenase genekxrkpk , wherein kxpmhas has the nucleotide sequence shown in SEQ ID NO.3, kxrkpk has the nucleotide sequence shown in SEQ ID NO.4. Such genetically engineered bacteria can express hyaluronan synthase and UDP-glucose dehydrogenase in vivo, so that the engineered bacteria can have the ability to synthesize BC while having the ability to synthesize HA, and then can obtain BC / HA composite membranes by static fermentation in one step. Compared with the traditional process of synthesizing BC / HA composite membranes by physical and chemical methods, using the genetically engineered bacteria of the present invention only needs to obtain BC / HA composite membranes by one-step static fermentation, greatly simplifying the synthesis process and reducing the synthesis cost of BC / HA composite membranes. 1.4 Description of the Drawings Figure 1 Codon optimization of hyaluronan synthase gene and UDP-glucose dehydrogenase gene; Figure 2 Plasmid map of pSEVA331-HA; Figure 3 pH, growth curve; (a) Growth curve without adding IPTG (b) Growth curve with adding IPTG (c) pH change curve without adding IPTG (d) pH change curve with adding IPTG Figure 4 HA production after 7 days of shaking flask fermentation; Figure 5 TEM characterization of the structures of BC and HA 1.5 Specific Embodiments The present invention will be further described below in conjunction with specific embodiments. It should be understood that these embodiments are only used to illustrate the present invention and not to limit the scope of the present invention. In addition, it should be understood that after reading the content taught by the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined by the appended claims of this application.

[0018] 1.6 1. Preparation of competent cells of Gluconacetobacter xylinus (1) Take the preserved strain at -80°C. After the preserved bacterial liquid is melted under ice bath conditions, streak it in three zones on the agar plate of HS medium and culture it in an incubator at 30°C for 24 - 48 h.

[0019] (2) After the colonies grow out, pick a single colony, inoculate it into liquid HS medium, and add 1‰ (v / v) cellulase, and culture it on a shaker at 30°C and 180 rpm for 24 - 48 h.

[0020] (3) Inoculate at an inoculum size of 1% (v / v) and add 1‰ (v / v) cellulase. Transfer the fermentation broth to 200 mL of fresh HS medium and culture it on a shaker at 30°C and 180 rpm for 10 - 18 h.

[0021] (4) When the OD600 of the fermentation broth is 0.5 - 0.8, carry out an ice bath for 20 min (all subsequent operations are carried out under ice bath conditions).

[0022] (5) Transfer the fermentation broth to a 50 mL centrifuge tube, centrifuge (4000 rpm, 4°C, 5 min) to collect the cells, and discard the supernatant.

[0023] (6) Resuspend the cells with 30 mL of HEPES (10 mM) buffer, centrifuge (4000 rpm, 4°C, 5 min) to collect the cells, and discard the supernatant (repeat 2 times).

[0024] (7) Resuspend the cells with 1 mL of 15% glycerol and aliquot into 1.5 mL EP tubes (100 μL / tube), and store at -80°C.

[0025] 1.72. E. coli Preparation of DH5α chemically competent cells (1) Take the strain stored at -80°C. After the stored bacterial solution melts under ice bath conditions, streak it in three zones on an agar plate of LB medium and culture it in an incubator at 37°C for 12 - 18 h.

[0026] (2) After the colonies grow, pick a single colony and inoculate it into liquid LB medium, culture it on a shaker at 37°C and 220 rpm for 8 - 12 h.

[0027] (3) Inoculate at an inoculum size of 1% (v / v). Transfer the fermentation broth to 200 mL of fresh LB medium and culture it on a shaker at 37°C and 220 rpm for 1.5 h.

[0028] (4) When the OD of the cells is 0.4, place the fermentation broth under ice bath conditions and carry out an ice bath for 20 min (all subsequent operations are carried out under ice bath conditions).

[0029] (5) Transfer the fermentation broth to a 50 mL centrifuge tube, centrifuge at 4000 rpm, 4°C, for 5 min to collect the cells, and discard the supernatant.

[0030] (6) Resuspend the cells with 30 mL of 0.1 mol / L CaCl2 solution, let it stand for 20 min, centrifuge at 4000 rpm, 4°C, for 5 min to collect the cells, and discard the supernatant.

[0031] (7) Resuspend the cells with 4 mL of CaCl2 solution and add 1 mL of 80% glycerol. Gently mix and aliquot into 1.5 mL EP tubes (100 μL / tube), and store at -80°C.

[0032] 1.84. Electrotransformation experiment of Gluconacetobacter xylinus (1) Take out the competent cells from the -80°C refrigerator and immediately place them under ice bath conditions.

[0033] (2) After the competent cells are melted, add 3 - 4 μL of plasmid or DNA fragment (total mass of DNA is about 0.8 - 1 μg) to it, and gently mix.

[0034] (3) Transfer the mixture of DNA and competent cells to a sterile electroporation cuvette and let it stand for 20 min under ice bath conditions.

[0035] (4) Take out the electroporation cuvette from the ice box, dry the water on the surface, and put the electroporation cuvette into the electroporator with a voltage of 2.5 kV and a pulse time of 5 ms.

[0036] (5) Take out the electroporation cuvette, resuspend the cells from the electroporation cuvette with the corresponding strain recovery solution, and transfer it to a 1.5 mL sterile EP tube.

[0037] (6) Resuscitate and culture the cells ( K. xylinus Culture at 30°C in a shaker at 180 rpm for 4 h; Culture E. coli at 37°C in a shaker at 220 rpm for 1 h).

[0038] (7) Centrifuge (8,000 rpm, 2 min) to collect the cells, discard the supernatant (retain 100 μL of the supernatant), and plate the resuspended cell suspension on an agar plate with the corresponding resistance and medium ( K. xylinus and E. coli Culture in an incubator at 30°C and 37°C respectively).

[0039] (8) After the colonies grow, pick single colonies and perform colony PCR to screen for positive clones.

[0040] 1.95. Chemical transformation experiment of Escherichia coli (1) Take the competent cells stored at -80°C and melt them under ice bath conditions.

[0041] (2) After the competent cells are melted, add 1 μg of plasmid (volume less than 10 μL) to the competent cells, gently pipette and mix, and let it stand for 20 min.

[0042] (3) Heat shock at 42°C for 60 s and let it stand in an ice bath for 2 min.

[0043] (4) Add 900 μL of recovery medium to the competent cells.

[0044] (5) Incubate at 37°C in a shaker at 220 rpm for 1 h.

[0045] (6) Centrifuge at 8,000 rpm for 2 min, discard the supernatant (retain 100 μL of the liquid), and resuspend the cells.

[0046] (7) Pipette the cell suspension, transfer it to an LB plate containing the corresponding antibiotic, spread it evenly, and incubate at 37°C for 12 – 16 h.

[0047] (8) After colonies grow, pick single colonies for colony PCR to screen for positive clones.

[0048] 1.106. Fermentation of Gluconacetobacter xylinus (1) Take out the control strain K. xylinus / pSEVA331 and the experimental strain K. xylinus / pSEVA331-HA from the -80°C refrigerator, streak three zones on HS agar medium containing 340 μg / L chloramphenicol, and incubate in a 30°C incubator until single colonies grow.

[0049] (2) Pick K. xylinus / pSEVA331 and K. xylinus single colonies of / pSEVA331-HA, inoculate them into 75 ml of HS seed medium containing 0.2% cellulase (v / v) and 340 μg / L chloramphenicol, and ferment in a shaker at 30°C and 180 rpm for 72 h.

[0050] (3) Centrifuge to collect the cells, wash them twice with 10 mM HEPES buffer, resuspend the cells, and inoculate them into the fermentation medium at an initial OD = 0.05. For static fermentation, ferment in a 30°C incubator for 7 days, and the fermentation medium is 75 ml of HS medium containing 340 μg / L chloramphenicol. For dynamic fermentation, ferment in a shaker at 30°C and 180 rpm for 7 days, and the fermentation medium is 75 ml of HS medium containing 0.2% cellulase (v / v) and 340 μg / L chloramphenicol. Inoculate three fermentation flasks with each strain as parallel experiments.

[0051] 1.117. Purification and recovery of cellulose membranes: (1) Take out the cellulose fermented statically for 7 days, soak it in 0.1 mol / L NaOH solution, change the NaOH solution every 24 h to remove the cells and medium in the cellulose membrane until the cellulose membrane becomes completely milky white.

[0052] (2) To remove the residual NaOH in the cellulose membrane, the cellulose membrane was soaked in deionized water and changed every 24 h until the pH of the water reached between 7 and 8 after soaking the cellulose membrane for 24 h.

[0053] 1.128. Determination of HA concentration: (1) Take the HA standard and prepare HA solutions with concentrations of 0, 20, 40, 60, 80, 120, and 160 mg / L as the standard solutions for determining the standard curve.

[0054] (2) Add 500 μL of CTAB solution (2.5%) to 500 μL of the HA solution and the standard solutions respectively. After mixing, add 200 μL to each well, and add three parallels of each sample to a 96-well plate. Measure the absorbance of the samples at a wavelength of 400 nm using a microplate reader. Draw the standard curve based on the absorbance of the standard solutions and calculate the concentration of the HA solution according to the standard curve.

[0055] 1.13 The sources of the biological materials used in each example are as follows: (1) pSEVA331 plasmid (preserved in the laboratory) (2) pSEVA331- lacI -P trc - lacO - rbs (purchased from Genewiz Biotechnology Co., Ltd., fully gene synthesized) (3) pUC57-T2-P trc - lacO - rbs - kxrkpk plasmid (purchased from Genewiz Biotechnology Co., Ltd., fully gene synthesized) (4) pUC57- kxpmhas plasmid (purchased from Genewiz Biotechnology Co., Ltd., fully gene synthesized) 1.14 Example 1: pmhas and rkpk Codon optimization of genes To enable the exogenous genes in the HA synthesis pathway to be better expressed in the K. xylinus host, first, the gene sequences of P. multocida from pmhas (SEQ ID NO.1) and S. meliloti from rkpk (SEQ ID NO.2) were codon-optimized based on the K. xylinus genetic characteristics of CGMCC 2955, and the optimization results are shown in the appendix Figure 1 .

[0056] Among them pmhasAfter codon optimization of the gene, the Codon Adaptation Index (CAI) increased from 0.38 to 0.82, and the GC content increased from 33.78% to 52.64%. The sequence is shown in SEQ ID NO.3. rkpk After codon optimization of the gene, the CAI increased from 0.73 to 0.79, and the GC content increased from 62.25% to 63.16%. The sequence is shown in SEQ ID NO.4.

[0057] 1.15 Example 2: Construction of pSEVA331-HA plasmid The composition of the pSEVA331-HA plasmid is as shown in the appendix Figure 2 shown, and its sequence is SEQ ID NO.5. The construction steps are as follows: (1) Using the pSEVA331- lacI -P trc - lacO - rbs plasmid (the sequence is shown in SEQ ID NO.6) as the PCR template, through PCR amplification, the backbone of the pSEVA331 plasmid and the lactose operon were obtained. The primer sequences used were: F1: tactagtagcggccgctgcagc (SEQ ID NO.9) R1: atctagtatttctcctctttctctagtctctagatgtg (SEQ ID NO.12) (2) Using the pUC57- kxpmhas plasmid (the sequence is shown in SEQ ID NO.7) as the PCR template, through PCR amplification, the kxpmhas gene fragment was obtained. The primer sequences used were: F2: aaagaggagaaatactagatatgaacacgctgtcccaggccattaag (SEQ ID NO.10) R2: ttacagcgtgatgctgttgatgatgaacttgttaacg (SEQ ID NO.13) (3) Using the pUC57-T2-P trc - lacO - rbs - kxrkpk plasmid (the sequence is shown in SEQ ID NO.8) as the PCR template, through PCR amplification, the T2-P trc - lacO - rbs - kxrkpk gene fragment was obtained. The primer sequences used were: F3: tcaacagcatcacgctgtaaagaaggccatcctgacggatggc (SEQ ID NO.11) R3: ttagtccgggcgaccgatgctg (SEQ ID NO.14) Using the Gibson assembly method, linearized plasmid pSEVA331- lacI -P trc - lacO - rbs and gene fragment, as well as T2-P kxpmhas -gene fragment were ligated. Then, they were introduced into trc - lacO - rbs - kxrkpk DH5α by chemical transformation. After picking positive clones and verifying by sequencing, plasmid pSEVA331-HA (the sequence is shown in SEQ NO.5) was obtained. E. coli

[0058]

[0058] 1.16 Example 3: Construction of a genetic engineering strain for synthesizing BC / HA composite membrane Prepare K. xylinus competent cells of CGMCC 2955. Then, plasmid pSEVA331-HA was introduced into K. xylinus CGMCC 2955 by electroporation. After single colonies grew out, positive clones were selected by colony PCR, and a genetic engineering strain K. xylinus / overexpressing plasmid pSEVA331-HA was obtained.

[0059] Plasmid pSEVA331 was introduced into K. xylinus CGMCC 2955 by electroporation. After single colonies grew out, positive clones were selected by colony PCR, and a genetic engineering strain K. xylinus / overexpressing plasmid pSEVA331 was obtained.

[0060] Furthermore, to verify the growth characteristics of the genetic engineering strain, using the K. xylinus / pSEVA331 expressing the empty plasmid as a control strain, the effects of the expression of kxpmhas and kxrkpk genes on the K. xylinus growth and pH change curves were tested ( Figure 3 ). It can be seen from the growth curve that the overexpression of kxpmhas and kxrkpk genes on K. xylinusThe growth was weakened to a certain extent, resulting in a lower bacterial density in the later stage of fermentation than that of the control strain, which may have caused a decrease in the ability to utilize gluconic acid in the fermentation broth, further making the pH of the later fermentation broth lower.

[0061] 1.17 Example 4: Characterization of the ability of the strain to synthesize HA To characterize the ability of the strain to synthesize HA, HA in the fermentation broth after 7 days of fermentation was extracted according to the following steps: (1) After 7 days of fermentation, the fermentation broth was centrifuged to collect the supernatant.

[0062] (2) An equal volume of 25% (v / v) CTAB solution was added to 5 ml of the supernatant, and the mixture was incubated in a shaker at 37°C and 180 rpm for 48 h to form a complex of polysaccharide in the supernatant and CTAB.

[0063] (3) The incubated solution was frozen and thawed at -20°C once. Centrifugation conditions were set as 12,000 rpm and 16°C for 30 min to remove the supernatant and collect the precipitate.

[0064] (4) The precipitate was resuspended with 5 ml of NaCl solution (1 mol / L NaOH) and incubated at 37°C for 48 h. During this process, acidic polysaccharide (HA) was dissolved and neutral polysaccharide precipitated, thereby separating HA and undegraded bacterial cellulose. The supernatant was collected by centrifugation.

[0065] (5) Two volumes of absolute ethanol were added to the supernatant, and alcohol precipitation was carried out at -20°C for 24 h to collect the precipitate.

[0066] (6) The precipitate was dissolved with 1 ml of deionized water, two volumes of absolute ethanol were added, and alcohol precipitation was carried out at -20°C for 24 h to collect the precipitate. This was repeated once to completely remove CTAB and inorganic salts in the solution.

[0067] (7) The precipitate was dissolved with 1 ml of deionized water to obtain an HA solution.

[0068] 500 μL of CTAB solution (2.5%) was added to 500 μL of the HA solution. After mixing, 200 μL was added to each well, and three parallels of each sample were added to a 96-well plate. The absorbance of the sample at a wavelength of 400 nm was measured with an enzyme-linked immunosorbent assay (ELISA) reader. The concentration of the HA solution was calculated according to the standard curve ( Figure 4 )).

[0069] 1.18 Example 5: Elemental analysis of BC / HA composite membrane To further prove HA in the cellulose membrane synthesized by the strain, in a tray containing 5 L of fermentation broth K. xylinusStatic fermentation was carried out with / pSEVA331-HA. After seven days of fermentation, the cellulose membrane was purified and recovered.

[0070] After homogenizing the cellulose membrane with a homogenizer, 0.2% (v / v) cellulase was added thereto and stirred until the cellulose was completely degraded.

[0071] HA in the solution was extracted according to the steps in Example 4 and freeze-dried to obtain HA.

[0072] The HA and BC samples were respectively dissolved in absolute ethanol, and the carbon film was used as a support to observe the samples under a transmission microscope, and the proportions of carbon, hydrogen, oxygen, and nitrogen in the samples were detected by energy spectrum. The detection results are as Figure 5 shown. It can be seen from the detection results that the proportions of nitrogen and oxygen elements in the HA sample purified from the composite membrane are higher than those of the BC sample, while the carbon element is lower than that of the BC sample. This is consistent with the fact that the structural unit of HA contains glucosamine. Therefore, it can be further determined from another aspect that there are amino groups in the fermentatively synthesized BC / HA composite membrane.

Claims

1. A genetically engineered strain of Gluconacetobacter xylinus capable of synthesizing a composite film of bacterial cellulose and hyaluronic acid, characterized in that It includes a recombinant plasmid (plasmid 1) expressing genes of the hyaluronic acid synthesis pathway. The name of plasmid 1 is pSEVA331-HA (the sequence is as shown in SEQ ID.5).

2. Application of the plasmid according to claim 1 in an engineered strain modified with Gluconacetobacter xylinus as the chassis strain.

3. The engineered strain obtained by genetically modifying Gluconacetobacter xylinus as the starting strain according to claim 2, wherein, An engineered strain obtained by performing gene editing and overexpressing a plasmid using Gluconacetobacter xylinus as the starting strain.

4. The application according to claim 2, characterized in that, Using the engineered strain expressing plasmid 1 to ferment and synthesize a composite material of bacterial cellulose and hyaluronic acid.

Images