Four-gene knockout attenuated salmonella typhimurium as well as construction method and application thereof

The λRed homologous recombination technology knocked out the relA, Asd, manA and sifA genes in Salmonella typhimurium to construct the ΔrelA-ΔAsd-ΔmanA-ΔsifA SM14028 attenuated strain, which solved the problem of insufficient safety and immune efficacy of attenuated vaccines in the prior art, and achieved efficient immune protection effects.

CN120366177APending Publication Date: 2025-07-25CHINA ANIMAL HEALTH & EPIDEMIOLOGY CENT
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510496539.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-21
Publication Date
2025-07-25

AI Technical Summary

Technical Problem

The prior art is difficult to completely remove the virulence factors of Salmonella typhimurium relA, Asd, manA and sifA through precise gene knockout methods, resulting in insufficient safety and immune efficacy of attenuated vaccines.

Method used

Using λRed homologous recombination technology, specific primers were designed to knock out the relA, Asd, manA and sifA genes of Salmonella typhimurium, and construct the attenuated strain ΔrelA-ΔAsd-ΔmanA-ΔsifA SM14028 with four genes, and ensure its safety and effectiveness through safety and immunoefficacy evaluation.

Benefits of technology

It achieves efficient attenuation of Salmonella typhimurium, ensures the safety of the vaccine, and provides effective immune protection, can resist the attack of the parent strain, and is suitable for the application of live vaccines and live vector vaccines.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120366177A_ABST
    Figure CN120366177A_ABST
Patent Text Reader

Abstract

The invention provides four-gene knockout attenuated salmonella typhimurium as well as a construction method and application of the four-gene knockout attenuated salmonella typhimurium, and the provided four-gene knockout attenuated salmonella typhimurium is obtained by knocking out relA, Asd, manA and sifA genes of salmonella typhimurium. According to the invention, the attenuated strain delta relA-delta Asd-delta manA-delta sifA SM14028 of salmonella typhimurium with deletion of four virulence factors is constructed, and the attenuated strain can be stably passaged in vitro. Through safety evaluation test detection, the strain is nontoxic in toxicity and extremely high in safety. In order to further evaluate whether the deltarelA-deltaAsd-deltamanA-deltasifA SM14028 can resist the attack of a parent strain, immune efficacy evaluation is carried out, and the result shows that the deltarelA-deltaAsd-deltamanA-deltasifA SM14028 can provide effective immune protection. Therefore, the deltarelA-deltaAsd-deltamanA-deltasifA SM14028 disclosed by the invention can be used as an effective live vaccine or live vector vaccine, and a foundation is laid for prevention and control of animal epidemic diseases.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of preparation of attenuated vaccine strains, and particularly relates to a quadruple gene knockout attenuated Salmonella typhimurium, a construction method thereof and an application thereof. Background Art

[0002] Salmonella.spp is a common foodborne pathogenic bacterium with high morbidity and fatality rates. Studies have found that Salmonella can infect animals on farms and spread from animal populations to humans. Direct contact with infected animals is an important cause of human Salmonella infection, and consumption of contaminated food and water is another important cause of Salmonella infection.

[0003] Salmonella typhimurium is one of the most common pathogens in the genus Salmonella, and its infection incidence ranks first among the genus Salmonella. At present, cases of diarrhea and even death caused by Salmonella typhimurium still occur frequently. Currently, among the preventive measures against Salmonella infection, antibiotics and inactivated vaccines are widely used. However, live Salmonella vaccines can stimulate the body to produce cellular immunity, humoral immunity and local mucosal immune responses, and have a better protective effect than inactivated vaccines.

[0004] Salmonella itself has pathogenicity, and as a vaccine carrier, it must have good safety. Therefore, the primary condition for being a live vaccine or a vector vaccine is to attenuate Salmonella to lose its pathogenicity. Early attenuation methods mainly included screening natural mutants, mutagenesis with chemical substances or ultraviolet irradiation. With the continuous development of modern molecular biology and the in-depth study of bacterial virulence genes, invasion mechanisms and expression regulation by people, it has become possible to perform multiple, precise and irreversible gene deletion attenuation on bacteria at the genomic level. The gene deletion attenuated Salmonella typhimurium generated by modern genetic engineering technology has a clear genetic background and greatly guaranteed safety, making it a prerequisite for being a vaccine or a carrier of a vaccine.

[0005] Red homologous recombination was initially discovered in λ phage mutants that could not recombine in recA- Escherichia coli hosts. It is a new technology that can achieve gene knockout with only a very short sequence and does not require in vitro digestion and ligation. This technology has promoted the progress of bacterial genomics, metabolic engineering and eukaryotic genetics. The main principle is: homologous arms of about 40-60 bp on both sides of the target gene fragment are introduced into the host cell, and then, by using the functions of three specific proteins in λ-Red homologous recombination and the method of electroporation, the linear DNA fragment of the bacterium is homologously recombined with a specific target sequence, so that the target gene is replaced by a marker gene. Compared with the traditional RecA recombination system, λ-Red homologous recombination is simple to operate and has a high recombination efficiency.

[0006] Red homologous recombination consists of three specific proteins: one is a 5'-3' exonuclease encoded by the exo gene that can bind to the ends of dsDNA, unwind the 5'-3' double strand into a single strand, and generate a single-strand nick at both ends of the exogenous dsDNA; one is the single-strand annealing protein (SSAP) encoded by the beta gene, which can bind to the single-strand nick formed by exo and promote annealing between DNA molecules; and there is another Gam protein encoded by the gam gene that does not participate in recombination, whose main function is to prevent the degradation of single-stranded DNA fragments and improve the stability of single-stranded DNA molecules.

[0007] The Red homologous recombination system involves three key plasmids: plasmid pKD46, pKD3 (or pKD4), and pCP20. Plasmid pKD46 is a temperature-sensitive plasmid that can encode three proteins, Exo, Beta, and Gam, under the induction of L-arabinose. It can normally replicate at 30°C and lose its function due to instability above 37°C; the function of plasmid pKD3 is to provide a template for the chloramphenicol resistance gene, and this plasmid contains an FRT site that can be recognized by the FRT recombinase. When this recombinase is present, the fragment between this site will be spliced, removing the chloramphenicol resistance fragment; plasmid pCP20, like pKD46, is a temperature-sensitive plasmid. pCP20 expresses the FLP recombinase, which can recognize the FRT site on the genome, thereby removing the introduced chloramphenicol resistance fragment. At the same time, an FRT site will remain on the genome. Therefore, when multiple genes are knocked out, multiple FRT sites will be left, affecting the stability of the chromosome and thus making it impossible to achieve continuous gene knockout. Summary of the Invention

[0008] The purpose of the present invention is to provide a four-gene knockout attenuated Salmonella typhimurium and its construction method and application, so as to make up for the deficiencies of the prior art.

[0009] The present invention first provides a four-gene knockout attenuated Salmonella typhimurium, which has knocked out the relA, Asd, manA, and sifA genes of Salmonella typhimurium.

[0010] Among them, the primer pair used to knock out the relA gene has the following sequence information:

[0011] relA-KD-F (SEQ ID NO:1):

[0012] GGAGTGATGCGACATATTATAAAATTAAAACCTATTCGCATTGTTTATGTGTGTAGGCTGGAGCTGCTTC;

[0013] relA-KD-R (SEQ ID NO:2):

[0014] GGCTTTGCTGAACGAGTAGCAAAGCCGCTACATGATTACTGTCTGGGGTTCATATGAATATCCTCCTTAG;

[0015] Among them, the primer pairs for knocking out the Asd gene have the following sequence information:

[0016] Asd-KD-F (SEQ ID NO:3):

[0017] TGGTGAAGGATGCGCCACAGGATACTGGCGCGCATACACAGCACATCTCTTTGGTGTAGGCTGGAGCTGCTTCG;

[0018] Asd-KD-R (SEQ ID NO:4):

[0019] CCTTATCCGGCCTACAGAACCACACGCAGGCCCGATAAGCGCTGCAATAGCCACATATGAATATCCTCCTTAGT;

[0020] Among them, the primer pairs for knocking out the sifA gene have the following sequence information:

[0021] sifA-KD-F (SEQ ID NO:5):

[0022] AAAGGGTCGATTTAATCAATTATGTAGTCATTTTTACTCAGTATAAGTGAGATTAATGTGTAGGCTGGAGCTGCTTC;

[0023] sifA-KD-R (SEQ ID NO:6):

[0024] CTGGCAAGAGTTACTCAGTAGGCAAACAGGAAGTACGTGTAAACCTGAACGTGACGTCCATATGATATCCTCCTTA;

[0025] Among them, the primer pairs for knocking out the manA gene have the following sequence information:

[0026] manA-KD-F (SEQ ID NO:7):

[0027] TTCATGCGGGTTTCTTGGTTTAATACCTCCCATTGATCTCCACATTGAAAGTGTAGGCTGGAGCTGCTTC;

[0028] manA-KD-R(SEQ ID NO:8):

[0029] TTACGTCTGTTATAAGCTTAGCAAGAGTTGTTAAAAAATTCAGTACGTTGCATATGAATATCCTCCTTAG。

[0030] Another aspect of the present invention also provides a use of the attenuated Salmonella typhimurium, which is an application as an antigen for preparing a vaccine.

[0031] Furthermore, the vaccine is a live vaccine.

[0032] The present invention also provides another use of the attenuated Salmonella typhimurium, which is an application as an expression vector.

[0033] The present invention also provides a vaccine using the attenuated Salmonella typhimurium as an antigen.

[0034] The present invention constructed an attenuated strain ΔrelA-ΔAsd-ΔmanA-ΔsifA SM14028 of Salmonella typhimurium lacking four virulence factors, which can be stably passaged in vitro. And through safety evaluation tests, the virulence of this strain is non-toxic and the safety is extremely high. In order to further evaluate whether ΔrelA-ΔAsd-ΔmanA-ΔsifA SM14028 can resist the attack of the parental strain, an immune efficacy evaluation was carried out. The results showed that ΔrelA-ΔAsd-ΔmanA-ΔsifA SM14028 can provide effective immune protection. Therefore, ΔrelA-ΔAsd-ΔmanA-ΔsifA SM14028 of the present invention can be used as an effective live vaccine or live vector vaccine, laying a foundation for the prevention and control of animal diseases. Description of the Drawings

[0035] Figure 1 : PCR amplification of the targeting fragment diagram;

[0036] Figure 2 : PCR identification of plasmid pKD46 diagram; M: DNA marker (DL2000); 1-4: ΔrelA-ΔAsd-ΔmanA-pKD46 PCR detection; 5: positive control;

[0037] Figure 3 : Identification result diagram of virulence factor removal;

[0038] Figure 4 : Growth curve of the quadruple gene deletion strain ΔrelA-ΔAsd-ΔmanA-ΔsifA-SM14028 and SM14028;

[0039] Figure 5 : Phenotypic identification diagram of the strain lacking the Asd gene;

[0040] Figure 6 : Phenotypic identification diagram of the quadruple gene deletion strain ΔrelA-ΔmanA-ΔsifA-SM14028;

[0041] Figure 7 : Genetic stability analysis diagram of the quadruple gene deletion strain;

[0042] Figure 8 : Diagram of the mouse status;

[0043] Figure 9 : Average body weight of mice;

[0044] Figure 10 : Survival curve of mice;

[0045] Figure 11 : Average body weight of mice. Detailed implementation methods

[0046] In the present invention, Salmonella typhimurium was selected as the parental strain, and the λRed homologous recombination technology was used to knock out four virulence factors (relA, Asd, manA, and sifA) of Salmonella typhimurium to obtain the attenuated strain ΔrelA-ΔAsd-ΔmanA-sifA-SM14028. The safety evaluation and immune efficacy detection of ΔrelA-ΔAsd-ΔmanA-sifA-SM14028 were carried out through in vivo experiments in mice, and it was found that ΔrelA-ΔAsd-ΔmanA-sifA-SM14028 had high safety and could effectively protect against the attack of the parental strain, laying an important foundation for the development of live attenuated Salmonella vaccines or live vector vaccines.

[0047] After obtaining the Salmonella attenuated strain, antigens were presented to host cells through oral immunization, thereby inducing an immune response in the body. It was found through safety detection of the ΔrelA-ΔAsd-ΔmanA-ΔsifA constructed in the present invention that the attenuated strain had extremely high safety and could be used as a carrier to transport other pathogenic antigens or drugs to the site of action, thus playing a carrier role.

[0048] The present invention will be described in detail below in combination with examples and drawings.

[0049] Example 1: Design primers related to λRed homologous recombination

[0050] Specific primers were designed based on the relA, Asd, manA, and sifA gene sequences of the Salmonella typhimurium standard strain ATCCSM14028 (GenBank accession number: CP102669.1) published in GenBank and synthesized by Ruiboke Xing. The primer sequences are shown in Table 3 (in the table, KD represents the knockout primer for the target gene; jd-N represents the inner identification primer for the target gene; jd-W represents the outer identification primer for the target gene).

[0051] Deletion primer design: Approximately 50 bp of the upstream and downstream sequences of the relA, Asd, manA, and sifA genes were selected as the homologous fragments of the primers (50 bp upstream and downstream each), and the upstream and downstream primer sequences for amplifying the chloramphenicol resistance gene of plasmid pKD3 were added to the 3' ends of the primers respectively.

[0052] Upstream sequence: GTGTAGGCTGGAGCTGCTTC,

[0053] Downstream sequence: CATATGAATATCCTCCTTAG;

[0054] Deletion inner detection primer design: Primer sequences of about 20 bp upstream and downstream were designed on the sequences of the deleted genes (relA, Asd, manA, and sifA genes).

[0055] Deletion outer detection primer design: Primer sequences of about 20 bp upstream and downstream were respectively selected from 200 - 300 bp upstream and downstream of the deleted genes (relA, Asd, manA, and sifA genes).

[0056] Table 1: Sequence information table of primers

[0057]

[0058]

[0059] 2. Amplification of the targeting fragment

[0060] Using plasmid pKD3 as the template, the targeting fragments were PCR amplified with the specific knockout primers for the relA, Asd, sifA, and manA genes (relA-KD-F, relA-KD-R; Asd-KD-F, Asd-KD-R; manA-KD-F, manA-KD-R; sifA-KD-F, sifA-KD-R, as shown in Table 1). The PCR amplification system and amplification program for the targeting fragments are shown in Tables 2 and 3

[0061] Table 2: PCR amplification system table for the targeting fragments of relA, Asd, and manA genes

[0062]

[0063]

[0064] Table 3: PCR Amplification Program Table for Preparing Targeting Fragments

[0065]

[0066] Using plasmid pKD3 as a template, PCR amplification of targeting fragments was carried out with relA-KD, Asd-KD, manA-KD, and sifA-KD primers respectively. The fragment sizes were: 1072bp, 1053bp, 1035bp, and 1114bp. The obtained PCR products ( Figure 1 ) were sequenced and aligned to confirm that the sequences were consistent with the standard sequences, and then gel extraction was performed for standby.

[0067] 3. Electroporation of plasmid pKD46 into SM14028 Competent Cells and Verification

[0068] Pick a single colony of SM14028 into antibiotic-free LB liquid medium, culture overnight at 37°C with 220 r / min. The next day, transfer the bacterial solution to antibiotic-free LB liquid medium at a ratio of 1:100 to prepare competent cells. After pipetting and mixing evenly with a pre-chilled Pasteur pipette, aliquot the competent cells into 1.5 mL EP tubes, 100 μL per tube.

[0069] Add 10 μL of pKD46 to the aliquoted competent cells, incubate on ice for 30 min; then transfer them to a pre-chilled 1 mm Bio-Rad electroporation cuvette, use a Bio-Rad electroporator for electroporation, and then place them on a shaker at 28°C for 1.5 h. After the culture, centrifuge at 5000 r / min for 5 min, discard the supernatant, leave 100 μL of the bacterial solution, spread it on LB / Amp solid medium, and culture overnight in an incubator at 28°C.

[0070] The next day, perform PCR identification with pKD46 discriminatory primers, using plasmid pKD46 as a positive control. The strain containing plasmid pKD46 with correct identification was named SM14028-pKD46, and it was stored in a -20°C refrigerator with 50% glycerol for standby.

[0071] 4. Electroporation of Targeting Fragments into SM14028-pKD46 Competent Cells and Verification

[0072] Pick a single colony of SM14028-pKD46 into LB / Amp liquid medium to prepare competent cells. Add the prepared relA, Asd, manA, and sifA targeting fragments to the aliquoted SM14028-pKD46 competent cells respectively. Immediately after electroporation, add 900 μL of antibiotic-free LB liquid medium containing 1 mol / L arabinose in a laminar flow hood, and incubate overnight in an incubator at 28°C.

[0073] Pick monoclonal colonies into 1 mL of LB / Cm liquid medium, culture at 28°C and 220 r / min until the bacterial solution becomes turbid. Perform bacterial solution PCR identification using the discrimination primers (relA-jd-N, relA-jd-W; Asd-jd-N, Asd-jd-W; manA-jd-N, manA-jd-W; sifA-jd-N, sifA-jd-W in Table 1), and use the SM14028-pKD46 bacterial solution as a positive control. Screen for recombinant strains, purify the bacterial solution with no band detected inside and the correct band size detected outside, and preserve the strains with correct purification verification results for future use.

[0074] 5. Elimination and verification of plasmid pKD46

[0075] Transfer the strains with correct purification verification results to LB / Cm liquid culture medium, shake culture at 42°C and 220 r / min for 15 h, then pick the bacterial solution and streak it on LB / Cm solid medium, and culture overnight in an incubator at 37°C. Finally, preserve the strains with successfully eliminated plasmid pKD46 for future use.

[0076] 6. Elimination and verification of chloramphenicol resistance gene

[0077] Prepare competent cells from the recombinant strains with eliminated plasmid pKD46, add 10 μL of plasmid pCP20 to this competent cell, and perform electrotransformation. Finally, preserve the bacterial solution with completely eliminated chloramphenicol resistance gene for future use.

[0078] 7. Elimination and verification of plasmid pCP20

[0079] Transfer the strains with correct identification to antibiotic-free LB liquid culture medium, culture at 42°C and 220 r / min for 15 h, then streak on antibiotic-free LB solid medium, and culture overnight in an incubator at 37°C. Pick single colonies and inoculate them on LB / Amp solid medium and antibiotic-free LB solid medium respectively, and culture overnight at 37°C for resistance screening. Finally, preserve the correctly identified deletion strains for future use.

[0080] Example 2: Construction of double-gene deletion strains

[0081] 1. Electroporation of plasmid pKD46 into competent cells of ΔrelA-SM14028 and verification

[0082] Pick a single colony of the single-gene deletion strain (ΔrelA-SM14028) to prepare competent cells. Electroporate 10 μL of plasmid pKD46 into the competent cells of ΔrelA-SM14028. After culturing and identification by colony PCR, the strain containing plasmid pKD46 with correct identification was named

[0083] ΔrelA-SM14028-pKD46 and stored for future use

[0084] 2. Electroporation of the targeting fragment into competent cells of ΔrelA-SM14028-pKD46 and verification

[0085] Prepare competent cells from the single-gene deletion strain (ΔrelA-SM14028-pKD46) carrying plasmid pKD46. Electroporate 10 μL of the manA targeting fragment into

[0086] the competent cells of ΔrelA-SM14028-pKD46. After culturing and identification by colony PCR respectively, purify the strain with correct verification results and store for future use

[0087] 3. Elimination and verification of plasmid pKD46

[0088] Eliminate pKD46 from the strain with correct verification according to the above method, and store the final bacterial solution for future use

[0089] 4. Elimination and verification of the chloramphenicol resistance gene

[0090] Eliminate the chloramphenicol resistance gene from the recombinant strain with plasmid pKD46 eliminated according to the method, and store the final bacterial solution for future use

[0091] 5. Elimination and verification of plasmid pCP20

[0092] Eliminate plasmid pCP20 from the strain with correct identification. Finally, a double-gene deletion strain was screened

[0093] Example 3: Construction of a triple-gene deletion strain

[0094] 1. Electroporation of plasmid pKD46 into competent cells of ΔrelA-ΔAsd-SM14028 and verification

[0095] Single colonies of the obtained double-gene deletion strain ΔrelA-ΔAsd-SM14028 were picked to prepare competent cells, and 10 μL of pKD46 plasmid was electrotransformed into the competent cells of ΔrelA-ΔAsd-SM14028. After culturing and identification by colony PCR, the strain containing plasmid pKD46 with correct identification was named ΔrelA-ΔAsd-SM14028-pKD46 and stored for future use.

[0096] 2. Electrotransformation of the targeting fragment into the competent cells of ΔrelA-ΔAsd-SM14028-pKD4 and verification

[0097] Competent cells of the double-gene deletion strain ΔrelA-ΔAsd-SM14028-pKD46 carrying the pKD46 plasmid were prepared. 10 μL of the sifA targeting fragment was electrotransformed into the competent cells of ΔrelA-ΔAsd-SM14028-pKD46. After culturing, the single colonies that grew were verified by colony PCR, and the strains with correct verification results were purified and stored for future use.

[0098] 3. Elimination and verification of plasmid pKD46

[0099] The correctly verified strain was used to remove pKD46, and the final bacterial solution was stored for future use.

[0100] 4. Elimination and verification of the chloramphenicol resistance gene

[0101] The recombinant strain with plasmid pKD46 eliminated was used to eliminate the chloramphenicol resistance gene, and the final bacterial solution was stored for future use.

[0102] 5. Elimination and verification of plasmid pCP20

[0103] The correctly identified strain was used to remove plasmid pCP20 according to the above method. Finally, Salmonella typhimurium ΔrelA-ΔAsd-ΔmanA-SM14028 was screened out.

[0104] Example 4: Construction of a four-gene deletion strain

[0105] 1. Electrotransformation of plasmid pKD46 into the competent cells of ΔrelA-ΔAsd-ΔmanA-SM14028 and verification

[0106] Single colonies of the obtained triple-gene deletion strain ΔrelA-ΔAsd-ΔmanA-SM14028 were picked to prepare competent cells, and 10 μL of pKD46 plasmid was electrotransformed into the competent cells of ΔrelA-ΔAsd-ΔmanA-SM14028. After culturing and identification by colony PCR, the strain containing plasmid pKD46 with correct identification was named ΔrelA-ΔAsd-ΔmanA-SM14028-pKD46 and stored for future use.

[0107] 2. Electroporation of plasmid pKD46 and verification results

[0108] The obtained triple-gene deletion strain ΔrelA-ΔAsd-ΔmanA-SM14028 was made into competent cells, and plasmid pKD46 was electroporated into them. The bacterial solution pKD46 was identified, and the identification results showed that plasmid pKD46 had been successfully electroporated into the competent cells of the double-gene deletion strain ( Figure 2 ), and this strain was named: ΔrelA-ΔAsd-ΔmanA-SM14028-pKD46, and the bacteria were preserved for future use.

[0109] 3. Electroporation of the targeting fragment into competent cells of ΔrelA-ΔAsd-ΔmanA-SM14028-pKD4 and verification

[0110] Competent cells of the double-gene deletion strain ΔrelA-ΔAsd-ΔmanA-SM14028-pKD46 carrying plasmid pKD46 were prepared. 10 μL of the sifA targeting fragment was electroporated into the competent cells of ΔrelA-ΔAsd-ΔmanA-SM14028-pKD46. After cultivation, the single colonies that grew out were verified by bacterial liquid PCR, and the strains with correct verification results were purified and preserved for future use.

[0111] 4. Elimination and verification of plasmid pKD46

[0112] The strain with correct verification was used to remove pKD46, and the final bacterial solution was preserved for future use.

[0113] 5. Elimination and verification of the chloramphenicol resistance gene

[0114] The recombinant strain with plasmid pKD46 eliminated was used to eliminate the chloramphenicol resistance gene, and the final bacterial solution was preserved for future use.

[0115] 6. Elimination and verification of plasmid pCP20

[0116] The strain with correct identification was used to remove plasmid pCP20 according to the above method. Finally, the quadruple-gene deletion strain of Salmonella typhimurium ΔrelA-ΔAsd-ΔmanA-ΔsifA-SM14028 was screened out.

[0117] The four deleted genes of ΔrelA-ΔAsd-ΔmanA-ΔsifA-SM14028 were verified. As Figure 3 shown, PCR detection and identification were performed on the quadruple-gene deletion strain ΔrelA-ΔAsd-ΔmanA-ΔsifA-SM14028 according to the internal and external detection primers of the four genes. The results showed that the deletion strain had completely removed the 4 virulence genes relA, Asd, manA, and sifA.

[0118] Example 5: Biological Characteristics Analysis of Gene Deletion Strain and Parental Strain

[0119] 1. Growth Characteristics Identification

[0120] Pick single colonies of the four - gene deletion strain ΔrelA - ΔAsd - ΔmanA - ΔsifA - SM14028 and the Salmonella typhimurium parental strain SM14028, and culture them overnight in LB liquid medium. The next day, adjust the OD600 nm to 1.0, then transfer them to new 5 mL LB liquid medium at a ratio of 1:100, with 18 tubes transferred for each strain. Incubate at 37°C, take out 1.5 mL of the bacterial liquid every 1 h, measure the absorbance value of the bacterial liquid at OD600 nm at different times, continuously measure for 18 h, and use Graphpad prism to draw the growth curve.

[0121] The ΔrelA - ΔAsd - ΔmanA - ΔsifA - SM14028 (screening strains 1 and 2) and the SM14028 bacterial liquid obtained above were continuously cultured in a shaker at 37°C for 18 h. Take 1.5 mL of the bacterial liquid every 1 h to measure OD600 nm, and draw the growth curve of the ΔrelA - ΔAsd - ΔmanA - ΔsifA - SM14028 deletion strain and SM14028 ( Figure 4 ). The results show that there is little difference in the growth rates between the two screening strains and SM14028.

[0122] 2. Phenotypic Identification after Deletion of Asd Gene

[0123] Pick the positive bacterial liquid and streak it on LB solid medium without antibiotics and LB solid medium containing DAP (50 μg / mL) respectively, and culture it overnight at 37°C to observe the growth status of the bacteria on the two solid media.

[0124] When the Asd gene is deleted, it will lead to the inability to synthesize the bacterial cell wall, and the bacteria will lyse and die. In this study, exogenous addition of DAP is used to enable the normal growth of the Asd gene deletion strain. Therefore

[0125] The ΔrelA - ΔAsd - ΔmanA - ΔsifA - SM14028 deletion strain can only grow when DAP is added exogenously, which is consistent with the expected results ( Figure 5 ).

[0126] 3. Phenotypic Identification after Deletion of manA Gene

[0127] Run the extracted LPS on an SDS - PAGE protein gel, and then use the Pierce Silver Stain Kit LPS silver staining kit for silver staining. The specific steps are as follows:

[0128] (1) After SDS-PAGE, excise the excess gel, wash it twice in ultrapure water for 5 minutes each time.

[0129] (2) Place the gel in the fixing solution and fix it for 15 minutes first, then fix it for another 15 minutes. Preparation method of the fixing solution: composed of ultrapure water, ethanol and glacial acetic acid in a ratio of 6:3:1.

[0130] (3) Wash the gel twice in 10% ethanol for 5 minutes each time, then wash it twice in ultrapure water for 5 minutes each time.

[0131] (4) Place the gel in the working solution of silver staining sensitizer for 1 minute, and strict timing is required at this time; then wash it twice in ultrapure water for 1 minute each time (working solution of silver staining sensitizer: add 25 μL of sensitizer to 12.5 mL of ultrapure water).

[0132] (5) Incubate the gel in the working solution of developing solution for 30 minutes; quickly wash it twice in ultrapure water for 20 seconds each time (working solution of developing solution: add 0.5 mL of enhancer to 25 mL of staining agent).

[0133] (6) Incubate it in the working solution of developing solution for 2 - 3 minutes, and quickly wash it twice in ultrapure water for 20 seconds each time (working solution of developing solution: add 0.5 mL of enhancer to 25 mL of developer).

[0134] (7) Immediately place it in 5% acetic acid termination solution for 10 minutes until clear bands appear, transfer it to ultrapure water, and observe it by taking pictures with a gel imager.

[0135] When the manA gene is deleted, it will lead to the obstruction of the synthesis of the O-antigen side chain of LPS, and the resulting LPS structure has the characteristics of a smooth type ( Figure 6 ). The silver staining result of LPS shows that compared with the parental strain, the LPS layer of the ΔrelA-ΔmanA-ΔsifA-SM14028 deletion strain is significantly reduced.

[0136] 4. Genetic stability detection of the four-gene deletion strain

[0137] Pick a single colony of the ΔrelA-ΔAsd-ΔmanA-ΔsifA-SM14028 quadruple gene deletion strain and streak it on the corresponding antibiotic-free LB solid medium, and culture it overnight at 37°C. The next day, pick a single colony and streak it on the solid medium. After 15 consecutive passages, pick single colonies from the 2nd, 4th, 6th, 8th, 10th, and 15th passages respectively, and use the identification primers in Table 3: relA-jd-N, relA-jd-W; Asd-jd-N, Asd-jd-W; manA-jd-N, manA-jd-W; sifA-jd-N, sifA-jd-W to perform PCR identification on the bacterial liquid, and detect the genetic stability of the quadruple gene deletion strain according to the band size.

[0138] Pick single colonies of ΔrelA-ΔAsd-ΔmanA-ΔsifA-SM14028 and streak them on the corresponding antibiotic-free LB solid medium, and culture them overnight at 37°C. After 15 consecutive passages, perform bacterial liquid PCR verification. The verification results are as Figure 7 , and the results show that ΔrelA-ΔmanA-ΔsifA-SM14028 can still stably inherit in vitro after 15 consecutive passages.

[0139] 5. Evaluate the safety of attenuated Salmonella

[0140] Randomly divide 150 6- to 8-week-old female Balb / c mice into 15 groups, with 10 mice in each group. Pick a single colony of SM14028 into LB liquid medium and culture it overnight at 37°C. The next day, inoculate the bacterial liquid into LB liquid medium at a ratio of 1:100, and let it grow to the logarithmic growth phase, then centrifuge to collect the bacterial cells. Add an appropriate amount of PBS to resuspend the cells, and perform 10-fold serial dilutions to make the bacterial liquid concentration 10 6 CFU / mL, which is used as the highest bacterial liquid concentration, and the lowest bacterial liquid concentration is 10 1 CFU / mL, and inoculate the bacterial liquid orally. Each mouse in each experimental group is orally administered 100 μL of the bacterial liquid, and each mouse in the control group is orally administered 100 μL of PBS. Continuously record the mortality rate for 15 days, and finally use Reed-Muench to calculate the median lethal dose of the SM14028 strain.

[0141] The LD of the ΔrelA-ΔAsd-ΔmanA-ΔsifA-SM14028 quadruple gene deletion strain 50 The determination method is the same as that of SM14028. The highest bacterial liquid concentration is 10 10 CFU / mL, and the lowest bacterial liquid concentration is 10 1 CFU / mL. The specific experimental protocol is as follows:

[0142] Table 4: Experimental protocol and bacterial challenge situation table

[0143]

[0144]

[0145] According to the plate colony count, the challenge doses of each group were counted, and the LD of the SM14028 strain was calculated based on the number of surviving mice 50 was 9.55×10 1 CFU / mL, and the LD of the ΔrelA-ΔAsdΔmanA-ΔsifA-SM14028 strain 50 could not be measured, indicating that the ΔrelA-ΔmanA-ΔsifA-SM14028 strain had the highest safety. The specific challenge doses and death numbers are shown in Tables 5 and 6

[0146] Table 5: LD of the SM14028 strain 50 Table

[0147]

[0148] Table 6: LD of the ΔrelA-ΔAsd-ΔmanA-SM14028 strain 50 Table

[0149]

[0150]

[0151] Example 6: Observation of clinical symptoms of ΔrelA-ΔAsd-ΔmanA-ΔsifA-SM14028

[0152] On the 2nd day after inoculation, the hair of the mice in cages No. 8 and No. 13 (ΔrelA-ΔAsd-ΔmanA-ΔsifA10 10 , ΔrelA-ΔAsd-ΔmanA-ΔsifA10 8 ) was messy and their spirits were listless; the mice in cage No. 21 (PBS control group) showed no abnormalities. On the 6th day after inoculation, the states of the mice in each group recovered; on the 14th day after inoculation, no abnormalities were observed in each mouse (see Figure 8 ). After inoculation, the average body weights of the mice in each attenuated dose group of ΔrelA-ΔAsd-ΔmanA--ΔsifA did not show regular changes (see Figure 9 ).

[0153] Sixty 7-week-old female Balb / c mice were randomly divided into 6 groups with 10 mice in each group. They were divided into 3 immunization groups and 3 challenge control groups, and the bacterial solution was inoculated orally. The specific grouping is shown in the following table

[0154] Table 7: Test plan and inoculation situation table

[0155]

[0156] On the 2nd day after infection with bacteria, the mice in each group were normal; on the 6th day after infection with bacteria, the immune group was normal, and the mice in the challenged control group with SM14028 at 10000 CFU / mouse showed disheveled hair and listless state; on the 14th day after infection with bacteria, the immune group was normal, and all three challenged control groups (1000 CFU / mouse, 5000 CFU / mouse, and 10000 CFU / mouse) showed

[0157] mice with disheveled hair and listless state.

[0158] Immunization with ΔrelA-ΔAsd-ΔmanA -ΔsifA SM14028 10 5 The protection rates against challenge with SM14028 at 1000 CFU / mouse, 5000 CFU / mouse, and 10000 CFU / mouse were all 100%; the mortality rate of the challenged control group with a challenge dose of 1000 CFU / mouse was 80%, and the mortality rates of the challenged control groups with challenge doses of 5000 CFU / mouse and 10000 CFU / mouse were 100%. The results showed that ΔrelA-ΔmanA-ΔsifA SM14028 could effectively resist the attack of the parental strain and could be used as a candidate vaccine strain or live vaccine vector for Salmonella (see Figure 10 ).

[0159] As Figure 11 shown, the average body weight of the immune group immunized with ΔrelA-ΔmanA-ΔsifA SM14028 was slightly higher than that of the mice in the challenged control group and tended to be stable.

Claims

1. A quadruple gene knockout attenuated Salmonella typhimurium, characterized in that, The attenuated Salmonella typhimurium described above is constructed by knocking out the relA, Asd, manA, and sifA genes of Salmonella typhimurium.

2. The attenuated Salmonella typhimurium according to claim 1, characterized in that, For the relA gene described above, the sequences of the knockout primer pair are SEQ ID NO:1 and SEQ ID NO:

2.

3. The attenuated Salmonella typhimurium according to claim 1, characterized in that, For the Asd gene described above, the sequences of the knockout primer pair are SEQ ID NO:3 and SEQ ID NO:

4.

4. The attenuated Salmonella typhimurium according to claim 1, wherein For the sifA gene described above, the sequences of the knockout primer pair are SEQ ID NO:5 and SEQ ID NO:

6.

5. The attenuated Salmonella typhimurium according to claim 1, characterized in that, For the manA gene described above, the sequences of the knockout primer pair are SEQ ID NO:7 and SEQ ID NO:

8.

6. Use of the attenuated Salmonella typhimurium according to claim 1 in the preparation of a vaccine.

7. The application according to claim 6, characterized in that, The vaccine described above is a live vaccine.

8. Use of the attenuated Salmonella typhimurium according to claim 1 as an expression vector.

9. A vaccine, characterized in that, The vaccine described above is prepared using the attenuated Salmonella typhimurium according to claim 1 as an antigen.