Hybrid snakehead spleen cell line as well as establishment method and application thereof

By establishing the hybrid vegetative spleen cell line CAMSp, the problem of lack of HSHRV-sensitive cells in the prior art was solved, and efficient research and prevention and control of the virus was achieved, which was suitable for gene function research.

CN120366209APending Publication Date: 2025-07-25PEARL RIVER FISHERY RES INST CHINESE ACAD OF FISHERY SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510714173.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-30
Publication Date
2025-07-25

AI Technical Summary

Technical Problem

Currently, there is a lack of effective hybrid vein rhizovirus (HSHRV) sensitive cell lines, which has affected the research and prevention and control of the virus. There are few researches on existing fish cell lines and are not suitable for hybrid vein.

Method used

A hybrid vein spleen cell line (CAMSp) was established, and the optimal culture conditions were determined through trypsin digestion and L-15 medium culture culture, and the sensitivity of cells to HSHRV was detected. Gene function was studied using liposome transfection technology.

Benefits of technology

CAMSp cells are highly sensitive to HSHRV and can be used to study their pathogenic mechanisms, detection methods, vaccine preparation and disease prevention and control, and are not contaminated by Mycoplasma, which is suitable for genetic function research.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120366209A_ABST
    Figure CN120366209A_ABST
Patent Text Reader

Abstract

The invention discloses a hybrid snakehead spleen cell line as well as an establishment method and application thereof, and belongs to the technical field of fish cell culture. The hybrid snakehead spleen cell line provided by the invention is named as CAMSp and is preserved in the China Center for Type Culture Collection (CCTCC), and the preservation number is CCTCC NO: C202598. According to the application, the spleen tissue from the hybrid snakehead is subjected to cell culture, the culture conditions of the cells are preliminarily determined, the sensitivity of the cells to the hybrid snakehead rhabdovirus (HSHRV) is detected, and a material basis is provided for researching the pathogenesis of the HSHRV, a detection method, vaccine preparation, interaction with host cells, disease prevention and control and the like.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application belongs to the technical field of fish cell culture, and particularly relates to a hybrid snakehead spleen cell line, a method for establishing the same, and an application thereof. Background Art

[0002] Hybrid snakehead is hybridized from Channa maculate as the female parent and Channa argus as the male parent (Channa Maculate♀×Channa Argus♂). Hybrid snakehead combines the advantages of its parents, has high stress resistance, fast growth rate, excellent traits and broad aquaculture prospects. However, the disease problem of current hybrid snakehead is becoming increasingly prominent. The main pathogens affecting hybrid snakehead are snakehead vesicular virus, Nocardia, Aeromonas schubertii and rhabdovirus. Among them, rhabdovirus infection is the most serious viral disease problem faced by the hybrid snakehead aquaculture industry. This virus has strong pathogenicity and high morbidity, and mainly harms the seedlings of hybrid snakehead. Therefore, the research and prevention and control work on hybrid snakehead rhabdovirus are particularly important. Establishing a virus in vitro culture system based on a stable passaged cell line is a necessary technical means for isolating, identifying and studying hybrid snakehead rhabdovirus.

[0003] As an important experimental material, fish cell lines have significant advantages such as low cost, high repeatability, strong controllability, convenience for observation, and ease of performing a large number of sample analyses. They are widely used in research fields such as aquatic virology, genetics, immunology and toxicology. At present, a large number of cell lines have been established, and the tissues include heart, liver, spleen, kidney, brain, gonad, gill, embryo, muscle, swim bladder, etc. The spleen, as the hematopoietic tissue of fish, is an important peripheral immune organ, plays a great role in specific and non-specific immunity, is also the main lymph organ participating in the immune response of pathogens, and at the same time the spleen is also the target organ of many viruses. Many researchers have established cell lines using the spleen tissue of fish, such as the Japanese flounder spleen cell line, the yellowfin sea bream spleen cell line, the orange-spotted grouper spleen cells, the rainbow trout spleen cell line, etc. However, there are not many studies on sensitive cell lines of hybrid snakehead rhabdovirus (HSHRV) at present. Summary of the Invention

[0004] To overcome the above-mentioned defects existing in the prior art, this application provides a hybrid snakehead spleen cell line, a method for establishing the same, and an application thereof. Cell culture is carried out on the spleen tissue derived from hybrid snakehead, the cell culture conditions are initially determined, and the sensitivity of the cells to hybrid snakehead rhabdovirus (HSHRV) is detected, providing a material basis for studying the pathogenic mechanism, detection method, vaccine preparation, interaction with host cells and disease prevention and control of HSHRV.

[0005] To achieve the above-mentioned invention purpose, this application provides the following technical solutions: On the one hand, the present application provides a hybrid snakehead spleen cell line named CAMSp, which is preserved in the China Center for Type Culture Collection with the preservation number of CCTCC NO: C202598.

[0006] On the second hand, the present application provides a method for establishing the above-mentioned hybrid snakehead spleen cell line, which includes the following steps: (1) Pretreat and digest the hybrid snakehead spleen tissue with trypsin in sequence to obtain hybrid snakehead spleen cells; (2) Conduct primary culture on the hybrid snakehead spleen cells with L-15 cell culture medium; (3) When the cells grow into a monolayer, remove the old culture medium, digest the cells with trypsin-EDTA until the cells become round, then inoculate them into a culture flask at a ratio of 1:2 every 3 - 4 days, and conduct subculture on the cells with L-15 cell culture medium. After 30 passages, conduct subculture at a ratio of 1:3 to obtain the hybrid snakehead spleen cell line.

[0007] Optionally, the pretreatment includes rinsing with HBSS for 1 - 3 times, placing it in a sterile penicillin bottle, adding 0.4 - 0.6 mL of HBSS, cutting it into pieces of 0.8 - 1.2 mm 3 , adding HBSS for centrifugation to remove the supernatant, and repeating 1 - 2 times.

[0008] Preferably, the pretreatment includes rinsing with HBSS for 2 times, placing it in a sterile penicillin bottle, adding 0.5 mL of HBSS, cutting it into pieces of 1 mm 3 , adding HBSS for centrifugation to remove the supernatant, and repeating 1 time.

[0009] Optionally, the rotation speed of the centrifugation is 800 - 1200 r / min, and the centrifugation time is 5 - 15 min.

[0010] Preferably, the rotation speed of the centrifugation is 1000 r / min, and the centrifugation time is 10 min.

[0011] Optionally, in step (1), the concentration of the trypsin is 0.2 - 0.3%, the volume ratio of the trypsin to the hybrid snakehead spleen tissue is 8 - 12:1, the digestion temperature of the trypsin is 25 - 30 °C, and the digestion time of the trypsin is 20 - 30 min.

[0012] Preferably, in step (1), the concentration of the trypsin is 0.25%, the volume ratio of the trypsin to the hybrid snakehead spleen tissue is 10:1, the digestion temperature of the trypsin is 28 °C, and the digestion time of the trypsin is 25 min.

[0013] Optionally, in steps (2) and (3), the L-15 cell culture medium contains 5-20% fetal bovine serum and 1.5-2.5% penicillin-streptomycin-amphotericin B.

[0014] Optionally, in step (3), when the number of cell passages ≤ 10, the L-15 cell culture medium contains 20% fetal bovine serum and 2% penicillin-streptomycin-amphotericin B; when the number of cell passages > 10, the L-15 cell culture medium contains 10% fetal bovine serum and 2% penicillin-streptomycin-amphotericin B.

[0015] In this application, experimental verification shows that the L-15 medium is more suitable for culturing hybrid snakehead spleen cells than DMEM, M199, and MEM. It is speculated that the possible reason is that the nutrient components in the L-15 medium are more suitable for the nutrients required by the cells and are more conducive to cell growth. For the serum concentration, 20% fetal bovine serum is used within 10 passages, and 10% fetal bovine serum is the optimal growth concentration for spleen cells after 10 passages. Too low a serum concentration will lead to insufficient cell nutrients, poor cell state, and even cell death, while too high a serum concentration may lead to problems such as too fast cell growth and premature differentiation. Regarding the addition of antibiotics, this application selects penicillin-streptomycin-amphotericin B. The combination of these three drugs can not only inhibit the growth of Gram-positive bacteria but also inhibit the growth of Gram-negative bacteria, and at the same time has an inhibitory effect on molds, and has a relatively small toxic effect on hybrid snakehead spleen cells. For the selection of antibiotic concentration, too high an antibiotic concentration can not only inhibit the growth of bacteria but also inhibit the growth of cells.

[0016] Optionally, in step (2), the temperature of the primary culture is 15-32°C.

[0017] Optionally, in step (3), the trypsin-EDTA contains 0.913 mM EDTA, 10 mg / L phenol red, 2.5 g / L trypsin, and 1×HBSS. The dosage of 1×HBSS is 1 L. There are no calcium and magnesium ions in 1×HBSS, and the pH value of the trypsin-EDTA is 7.1-8.0.

[0018] Optionally, in step (3), the temperature of the subculture is 15-32°C.

[0019] Optionally, in step (3), the temperature of the subculture independently selects any value or the range value between any two of 15°C, 22°C, 28°C, and 32°C.

[0020] Preferably, in step (3), when the cells grow into a monolayer, the old culture medium is removed, and the cells are digested with trypsin-EDTA until the cells become round. Then, the cells are inoculated into a culture flask at a ratio of 1:2 every 3 days, and the cells are subcultured with L-15 cell culture medium. After 30 passages, the cells are subcultured at a ratio of 1:3, and the hybrid snakehead spleen cell line is obtained.

[0021] Optionally, it further includes step (4) cryopreservation and resuscitation of cells: The cells are resuspended with cryopreservation solution, placed at -80 °C overnight, and then transferred to liquid nitrogen for cryopreservation; when the cells are resuscitated, the cells cryopreserved in liquid nitrogen are taken out, thawed in a 37 °C water bath, centrifuged at 800-1200 r / min for 4-6 min, the supernatant is removed, and the cells are resuspended with L-15 medium containing 10% FBS. The cells are transferred to a 25 cm 2 culture flask, the medium is supplemented to 5-6 mL, the cells are blown evenly, and the cells are cultured at 15-32 °C. After 24 h, the cell state is observed under an optical microscope and the medium is changed.

[0022] Optionally, the formula of the cryopreservation solution is 70% L-15 medium, 20% FBS, and 10% DMSO.

[0023] In the third aspect, the present application provides the use of the above-mentioned hybrid snakehead spleen cell line as a sensitive cell line for hybrid snakehead rhabdovirus HSHRV.

[0024] In the fourth aspect, the present application provides the use of the above-mentioned hybrid snakehead spleen cell line as a transfected cell.

[0025] Compared with the prior art, the present application includes the following beneficial effects: (1) In the present application, the hybrid snakehead spleen tissue is used as the culture material, and the method of digesting the tissue with trypsin is adopted to establish a hybrid snakehead spleen cell line, named CAMSp. Since the primary cell culture was initiated, the cells have been passaged more than 80 times, and the cells are fibroblast-like. CAMSp can proliferate rapidly in Leibovitz’s 15 (L-15) medium under the culture condition of 28 °C.

[0026] (2) In the present application, karyotype analysis is performed on the 60th generation of CAMSp cells. The chromosome modal number is 2n = 42, while the chromosome numbers of hybrid snakehead somatic cells are mostly 44, 45 or 46, indicating that the CAMSp cells have mutated; by comparing the 16S rRNA sequences of CAMSp cells and hybrid snakehead, it is proved that this cell line is derived from hybrid snakehead and is not contaminated by mycoplasma.

[0027] (3) The present application studies and finds that the infection of CAMSp cells with the HSHRV-GZ22 strain can cause typical cytopathic effects (CPE) in the cells, and the virus titer is as high as 10 8.33 TCID50 / mL, higher than that of CAMK cells (viral titer is 10 7.33 TCID50 / mL), indicating that this cell is very sensitive to HSHRV-GZ22. Through electron microscopy observation, a large number of bullet-shaped virus particles can be seen. Indirect immunofluorescence experiments show that the CAMSp cells established in this application are sensitive to HSHRV and can be applied to research on the pathogenic mechanism, detection method, vaccine preparation, interaction with host cells, and disease prevention and control of HSHRV.

[0028] (4) In this application, the liposome transfection technology was used to successfully introduce the pEGFP-N1 plasmid carrying the green fluorescent protein gene into CAMSp cells, indicating that this cell can be used for research related to gene functions. Description of the Drawings

[0029] In order to more clearly illustrate the technical solutions of the embodiments of this application, the drawings required for use in the embodiments will be briefly introduced below. It should be understood that the following drawings only show some embodiments of this application and should not be regarded as limiting the scope. For those of ordinary skill in the art, other related drawings can also be obtained based on these drawings without creative efforts.

[0030] Figure 1 Microscopic pictures of the spleen cell line of hybrid snakehead fish in this application at different passages (Note: A represents primary cells; B represents CAMSp cells at passage 5; C represents CAMSp cells at passage 30; D represents CAMSP cells at passage 50); Figure 2 Comparison diagram of the states of cell cryopreservation and resuscitation in this application (Note: A represents normal passaged CAMSp cells; B represents cells observed under the microscope 24 hours after resuscitation); Figure 3 Growth curves of cells in this application under different culture conditions (Note: A represents different culture media; B represents different serum concentrations; C represents different culture temperatures); Figure 4 Chromosome and karyotype analysis of CAMSp in this application (Note: A represents the Giemsa staining picture of CAMSp chromosomes; B represents the statistical count of the number of chromosomes in each chromosome set; C represents the chromosome composition); Figure 5 Fluorescence microscopy photographs of CAMSp and FHM cells transfected with pEGFP-N1 in this application (Note: A represents CAMSp; B represents FHM); Figure 6 Mycoplasma detection results of CAMSp cells and control group EPC cells in this application (Note: A represents CAMSp; B represents EPC); Figure 7Alignment result of the 16S rRNA sequence of CAMSp of this application and the 16S rRNA gene of hybrid snakehead (Note: A represents the PCR electrophoresis result of the 16S rRNA gene; B represents the sequence alignment result of the 16S rRNA gene); Figure 8 Pathological changes of CAMSp of this application infected with HSHRV at different times (Note: A represents the negative control; B represents the 3rd day after infection; C represents the 5th day after infection; D represents the 7th day after infection); Figure 9 Change of virus titer for 7 consecutive days after CAMSp of this application is infected with HSHRV; Figure 10 Indirect immunofluorescence analysis of CAMSp cells infected with HSHRV of this application (Note: A represents that the cell nucleus is stained blue; B represents that the presence of virus particles is proved by green immunofluorescence; C represents the combination of Figure A and B); Figure 11 Virus particles in cells after HSHRV infects CAMSp under transmission electron microscope of this application (Note: A represents the observation of HSHRV virus particles under transmission electron microscope (magnification 5000 times); B represents the observation of HSHRV virus particles under transmission electron microscope (magnification 20000 times)).

[0031] Deposition description The hybrid snakehead spleen cell line CAMSp, the depository is the China Center for Type Culture Collection, the address is Wuhan University, Wuhan, China, the deposition date is April 9, 2025, and the deposition number is CCTCC NO: C202598. Detailed implementation manners

[0032] The following further elaborates this application in combination with specific embodiments. The following descriptions are only several embodiments of this application and do not impose any form of limitation on this application. Although this application is disclosed by preferred embodiments, it is not used to limit this application. Any person skilled in the relevant art, without departing from the scope of the technical solution of this application, makes some changes or modifications using the disclosed technical content above, which are equivalent to equivalent implementation cases and all belong to the scope of the technical solution.

[0033] Unless otherwise specified, the raw materials in the embodiments of this application are purchased through commercial channels and used directly without any special treatment.

[0034] Unless otherwise specified, the analysis methods in the embodiments adopt the conventional settings and conventional analysis methods of the instruments or equipment.

[0035] Example 1 1. Experimental fish and virus Hybrid snakehead fish (10±2.5) cm were provided by the Aquatic Germplasm Resources and Genetic Breeding Laboratory, Pearl River Fisheries Research Institute, Chinese Academy of Fishery Sciences. They were temporarily cultured in an 80 cm×60 cm×60 cm glass tank for 2 weeks at a water temperature of 25°C, with a water quality pH of 7.2±0.2, and fed with formulated feed for hybrid snakehead fish. After random inspection by qPCR, they were healthy and disease-free. The rhabdovirus HSHRV-GZ22 strain of hybrid snakehead fish was isolated, identified and preserved by this laboratory.

[0036] 2. Primary culture and subculture Healthy hybrid snakehead fish were immersed in 75% alcohol (Shandong Lilkon Medical Technology Co., Ltd., China) for 1 min, and the spleen tissue was aseptically removed, rinsed twice with HBSS (Gibco, USA), placed in a sterile penicillin vial, 0.5 mL of HBSS was added, and it was cut into pieces about 1 mm3 with surgical scissors and transferred to a 15 mL centrifuge tube (Kejin Co., China). HBSS was added and centrifuged at 1000 r / min for 10 min to remove the supernatant. This was repeated once. 0.25% trypsin (Gibco, USA) at 10 times the tissue volume was added, and digestion was carried out at 28°C for 25 min. Culture medium was added to terminate digestion, and the cells were filtered through a 200-mesh sieve. The supernatant was discarded by centrifugation at 1000 rpm for 5 min, and the cells were suspended with L-15 (Gibco, USA) cell culture medium containing 20% FBS (Opsai, China) and 2% triple antibody (Gibco, USA), and inoculated into a 25 cm 2 culture flask and cultured in an incubator at 28°C. Observed under a microscope, the medium was changed when about 50% of the cells adhered to the wall.

[0037] When the cells grew to cover the bottom of the culture flask, the old culture medium was removed with a pipette, and the cells were washed twice with HBSS. When the cells were digested to become round with 0.25% trypsin-EDTA (Gibco, USA), the trypsin was aspirated, and fresh complete culture medium was added to terminate digestion. The suspended cells were collected and inoculated into a 25 cm2 culture flask (Corning, USA) at a ratio of 1:2, and L-15 cell culture medium containing 20% FBS and 2% triple antibody was added to 5 mL / bottle and cultured at 28°C. When the cells grew into a monolayer, subculture was carried out by the above method, and information such as passage number and passage time was marked on the cell flask. This cell line was named the hybrid snakehead fish spleen cell line (CAMSp). When the cells were passaged 10 times, the serum concentration of the culture medium was reduced from 20% to 10%.

[0038] After the primary culture was started, cell adhesion could be observed in 2 to 3 days, and after 6 days, monolayer cells could cover about 80% of the bottom of the culture flask. The primary cells were irregular polygons (see Figure 1In A), the cytoplasm is transparent and the cell boundaries are distinct. After 10 days, the growing cells converge and cover the bottom wall. Contact inhibition occurs in cell growth, some cells die, and some become fibrous. The primary cells grow for 10 days until the 25 cm 2 cell culture flask is confluent. Subculture is carried out at a ratio of 1:2, and it can be confluent in 3 - 4 days. After 30 passages, the cell growth rate increases. Subculture at a ratio of 1:3 can achieve confluence of a monolayer in about 24 h.

[0039] 3. Cell cryopreservation and recovery Passage the CAMSp cells into a 75 cm2 culture flask (Corning, USA). When the cell attachment rate reaches about 95%, discard the original culture medium, rinse twice with HBSS, digest with 0.25% trypsin - EDTA (1:1) (Gibco, USA). Observe under a microscope (Nikon, Japan). When the cells shrink and become round, add 10 mL of L - 15 (Gibco, USA) medium containing 20% FBS (Opsai, China) and 2% triple - antibody (Gibco, USA) to resuspend the cells and transfer them to a 15 mL centrifuge tube (Kejin, China). Centrifuge at 1200 rpm for 5 min, discard the supernatant, add 4.5 mL of cryopreservation solution to resuspend the cells, and then aliquot the cells into cryovials (thermo scientific, USA) at 1.5 mL per tube. Label the cell name, cell passage number, and cryopreservation time, place them in a programmable cryo - box at - 80°C overnight, and then transfer them to liquid nitrogen for long - term storage. The formula of the cryopreservation protective solution is 70% L - 15 medium, 20% FBS, and 10% DMSO (Sigma, USA).

[0040] When recovering the cells, take out the cells cryopreserved in liquid nitrogen, quickly thaw them in a 37°C water bath, centrifuge at 1000 rpm / min for 5 min, discard the supernatant, add L - 15 (Gibco, USA) medium containing 10% FBS to resuspend the cells, transfer the cells to a 25 cm2 culture flask (Corning, USA), supplement the medium to 5 - 6 mL, blow the cells evenly, and culture them in a 28°C incubator. Observe the cell status under an optical microscope 24 h later and change the culture medium.

[0041] Effective preservation of cells can avoid risks of force majeure for subsequent experiments. Recover the CAMSp cells cryopreserved in the liquid nitrogen tank for 3 - 6 months. The survival rate of the recovered cells can reach 80 - 90%, and the next subculture can be carried out 2 days later. The status and growth rate of the recovered cells are not significantly different from those before cryopreservation (see Figure 2 ).

[0042] 4. Selection of culture medium The CAMsp at passage 20 was screened for the optimal culture medium using DMEM medium (Gibco, USA) supplemented with 10% FBS, M199 medium (Gibco, USA), RPMI1640 medium (Gibco, USA), and L-15 medium (Gibco, USA). The cell concentration of CAMSp cells was adjusted to 2×10 5 cells / mL using different culture media. The cells were inoculated into 7 cell culture flasks (Corning, USA) with a volume of 12.5 cm 2 and cultured at 28°C for 7 days. Every day, one flask of cells was randomly selected from each group of cells, and three cell counts were performed using an automatic cell counter (Countstar, China), and the average value was taken. A total of 7 days of cell counting was performed to plot the cell growth curve ( Figure 3 A in). The optimal culture medium was determined.

[0043] At 28°C, with 10% FBS added, CAMSp cells were cultured under the conditions of four different culture media: RPMI1640, L-15, M199, and DMEM. The results showed that the growth rate of CAMSP in L-15 medium far exceeded that of the other three media. Followed by M199, in the culture conditions of DMEM and RPMI-1640, the cell growth rate was limited.

[0044] 5. Selection of serum concentration The optimal culture medium containing FBS concentrations of 5%, 10%, 15%, and 20% was used. The cell concentration of 20th passage CAMSp cells was adjusted to 2×10 5 cells / mL using L-15 medium (Gibco, USA) with different serum concentrations. The cells were inoculated into 7 cell culture flasks (Corning, USA) with a volume of 12.5 cm 2 and cultured at 28°C for 7 days. Every day, one flask of cells was randomly selected from each group of cells, and three cell counts were performed using an automatic cell counter (Countstar, China), and the average value was taken. A total of 7 days of cell counting was performed to plot the cell growth curve ( Figure 3 B in). The optimal serum concentration was determined.

[0045] The results of cell statistical counting showed that: under the culture condition of 5% serum concentration, the cell growth was slow, and the highest cell number reached 3.72×10 5 cells / mL; under the culture condition of 10% serum concentration, the cells could proliferate rapidly, with a fast growth rate, high growth efficiency. As the culture time extended, the cell number reached the peak on the fourth day, and then began to decline on the fifth day and gradually stabilized. The highest cell number reached 9.5×10 5cells / mL; Under the culture condition of 15% serum concentration, the cells grow and proliferate rapidly, and the cell monolayer is stable. Similar to the 10% serum concentration, on the fifth day, the number of apoptotic cells begins to decline slowly, and the highest number of cells reaches 9.8×10 5 cells / mL; Under the culture condition of 20% serum, the cells grow rapidly, but apoptosis begins on the fourth day, the number of cells starts to decline, and gradually stabilizes. The highest number of cells reaches 6.7×10 5 cells / mL. 10% FBS is the optimal serum concentration for CAMSp.

[0046] 6. Selection of culture temperature Select four different culture temperatures of 15ºC, 22ºC, 28ºC, and 32ºC. Use L-15 medium (Gibco, USA) supplemented with 10% FBS (OpcelBiotechnology, Hohhot, China). Adjust the cell concentration of passage 20 CAMSp cells to 2×10 5 cells / mL and inoculate them into 12.5 cm 2 cell culture flasks (Corning, USA). Culture the cells at different temperatures for 7 days. Randomly select one flask of cells in each group every day and perform cell counting three times using an automatic cell counter (Countstar, China). Take the average value and count for 7 days to draw the cell growth curve ( Figure 3 C in). Determine the optimal culture temperature.

[0047] The results of cell statistical counting show that under the culture condition of 15ºC, the cells can adhere to the wall normally, but the growth rate is slow; under the culture condition of 22ºC, the cells can proliferate stably, form a monolayer, and the growth rate is slightly higher than that under 15℃; under the culture condition of 28ºC, the cells grow and proliferate rapidly, the cell monolayer is stable, and the highest number of cells reaches 9.9×10 5 cells / mL; under the culture condition of 32ºC, the cells grow rapidly, but the cell monolayer is unstable. Shedding or dead cells appear after 4 days of culture, the number of cells decreases, and the highest number of cells reaches 9.7×10 5 cells / mL. 28℃ is the optimal culture temperature for CAMSp.

[0048] 7. Chromosome karyotype analysis When the cells were passaged to the 50th generation, the CAMSp medium in the logarithmic growth phase was replaced with L-15 medium (Gibco, USA) containing 20 μg / mL colchicine (Sigma, USA) and 10% FBS, and incubated at 28 °C for 12 h to 16 h. The cell status was observed under a microscope, and the incubation was stopped when about 50% of the cells swelled and became round. The cells were washed twice with HBSS, digested, and the reaction was terminated by adding L-15 medium containing 10% FBS. The cells were collected by centrifugation at 1000 rpm / min for 5 min. The supernatant was discarded, and the collected cells were hypotonic in 0.075 M KCl hypotonic solution for 60 min, and then 5 mL of freshly prepared Carnoy's solution (formaldehyde: glacial acetic acid volume ratio = 3:1) pre-cooled at -20 °C was added for fixation for 15 min. The cells were collected by centrifugation and repeated twice. The cells were dropped onto the slide by the cold dropping method and air-dried and fixed automatically. After staining with 5% Giemsa stain for 30 min, microscopic examination was performed, and 100 metaphase cells were selected for karyotype analysis and chromosome number statistics.

[0049] Among the 100 metaphase cells counted, the chromosome number of the spleen cells of the 60th generation hybrid snakehead was between 23 and 48, and the modal number was 42 ( Figure 4 ), and there were abnormalities in chromosome number and karyotype in the cells, indicating that mutations occurred in the cell chromosomes. The karyotype of CAMSP cells was 2n = 2m + 4sm + 18st + 18t.

[0050] 8. Stable transfection of pEGFP-N1 plasmid into cells The plasmid used for transfection was the pEGFP-N1 plasmid (YEASEN, China) carrying the green fluorescent protein (GFP). The 65th generation cells were evenly inoculated into a 12-well plate (Corning, USA) at an inoculation density of 1×10 5 cells / mL. After the cells adhered and grew to the logarithmic phase, they were rinsed 3 times with PBS, and transfected according to the instructions of the transfection kit (YEASEN, China), and at the same time, FHM cells with higher transfection efficiency were used as positive controls. After 24 h of transfection, observation and photography were performed using an inverted fluorescence microscope (Zeiss, Germany). The results showed that many green fluorescences could be observed in CAMSP and FHM cells under the fluorescence microscope ( Figure 5 ). This indicates that CAMSP cells can be transfected and related analyses of gene functions can be carried out.

[0051] 9. Mycoplasma detection According to the instructions of the mycoplasma detection kit (Solarbio, China), mycoplasma detection was performed on CAMSp cells. The CAMSp cells were transferred into a 6-well cell culture plate (Corning, USA) for culture. At the same time, mycoplasma-free cells preserved in the laboratory were used as negative controls and inoculated into another 6-well cell culture plate. After two days of culture, the cell culture medium was removed, and 1 mL of frozen methanol (Sinopharm Chemical Reagent Co., Ltd., China) was added to each well for fixation for 20 min; the fixing solution was removed, and the cells were washed twice with PBS for 5 min each time; 1 mL of Hoechst 33258 working solution was added to each well and incubated at room temperature for 30 min. Subsequently, the cells were washed twice with PBS buffer, and after drying, 0.5 mL of fluorescence blocking solution was added. Finally, an inverted fluorescence microscope (Zeiss, Germany) was used to observe the cells and take pictures. The results showed that only the cell nuclei emitted fluorescence in both groups of cells, and no blue bead-like fluorescence dots representing mycoplasma were observed around the cytoplasm ( Figure 6 ), indicating that CAMSp was not contaminated with mycoplasma.

[0052] 10. Identification of cell line origin The CAMSp cells were scraped off with a cell scraper, the supernatant was removed by centrifugation, and the cell DNA was extracted using the Tiangen DNA extraction kit (Tiangen Biotech Co., Ltd., China). According to the primer sequences: forward primer (16S-F): GCCGAACAGCTAGCCCCACCCCA (SEQ ID NO.1), reverse primer (16S-R): AAGCCATTATATTTGGCGGG (SEQ ID NO.2), the 16S rRNA sequence of CAMSp was amplified. The amplification product was electrophoresed on a 1% agarose gel, and the size of the band was observed using ultraviolet light. The gel with the target band was cut off, and the PCR product was recovered using an agarose gel recovery kit (Bioer, Hangzhou). It was sent to Sangon for sequencing. The sequencing results were compared using the online sequence alignment tool BLAST, and a sequence alignment map was drawn using ClustalW. The results showed that the amplification product was 1604 bp, which was consistent with the expected target band. The sequencing results were analyzed by BLAST alignment in NCBI, showing that the 16S rRNA sequence of CAMSp was highly similar to the 16S rRNA gene sequence of hybrid snakehead, with a similarity of 99%, confirming that CAMSp cells were derived from hybrid snakehead ( Figure 7

[0053] 11. CPE Observation and Titer Determination Sensitivity of CAMSp Cells to Hybrid Snakehead Rhabdovirus (HSHRV): When the cell monolayer in a 25 cm 2 culture flask reached 80%-90%, the cells were washed twice with PBS, 1 mL of hybrid snakehead rhabdovirus (HSHRV) suspension was added, and the mixture was allowed to stand for 1 h for adsorption. The virus suspension was then aspirated, and the cell surface was washed twice with serum-free medium. Medium containing 3% FBS was added. A flask of cells with only the maintenance medium replaced was used as a negative control. Cell changes were observed under an inverted microscope and photographed. The appearance of CPE (cytopathic effect) was used as an indicator of virus sensitivity, indicating that the cells were sensitive to the virus.

[0054] Determination of TCID50 of HSHRV Inoculated into CAMSp Cells: Well-grown CAMSp cells were digested, sampled, and counted. The cells were diluted with L-15 to a concentration of 5×10 4 cells / mL and inoculated into a 96-well plate at an initial volume of 100 μL / well for 24 h to allow the cells to adhere well. The next day, the cell plate was taken out, and the growth medium was discarded. 100 μL of L-15 maintenance medium containing 3% FBS was added to each well. Then, the virus samples to be tested were added to wells 1-10 of the 96-well plate in ascending order of dilution factor at 100 μL / well, and 100 μL of L-15 maintenance medium containing 3% FBS was added to wells 11-12 as a negative control. This experiment was set up with 3 replicates. The cell plate was cultured in an incubator at 28 °C and 5% CO2 for 96 h, after which the cytopathic effect (CPE) was observed and the end point was recorded. The virus titer was calculated by the Reed-Muench method.

[0055] Results and Analysis: When CAMSp confluent monolayer cells were infected with HSHRV-GZ22, on the 3rd day after infection, the cells shrank and became round, with an increased refractive index, and the cell monolayer shrank. On the 5th day after infection, there were more cell debris, the cells detached, and the monolayer was in a broken fishing net shape, showing a typical cytopathic effect (CPE). On the 7th day after infection, about 70%-80% of the cells detached, while the control group was normal ( Figure 8 ). After the virus solution was serially diluted and inoculated into a 96-well cell culture plate with approximately 90% CAMSp monolayer cells, 7 days later, the virus titer of HSHRV-GZ22 infecting CAMSp was calculated to be approximately 10 8.33 TCID50 / mL ( Figure 9 ).

[0056] 12. Indirect Immunofluorescence Inoculate CAMSp cells with a density of 2×10 5 cells / mL into a 48-well plate. When the cells grow to 90%, add 100 μL of HSHRV virus solution at 10 5 copies / mL to each well, incubate in a 28 °C incubator for 1 h, aspirate the virus solution, add medium containing 3% FBS, and culture in a 28 °C incubator until typical CPE appears; remove the culture medium, add a pre-cooled (-20 °C) methanol:acetone (1:1) mixture, fix at room temperature for 10 min, and wash 3 times with PBS; add 0.5% Triton for permeabilization treatment for 10 min, and wash 3 times with PBS; add 5% non-fat milk powder and block at 37 °C for 1 h, and wash 3 times with PBS; add 200 μL of 1:200 diluted HSHRV mouse monoclonal antibody (kindly provided by Dr. Zeng Weiwei of Foshan University) to each well, incubate in the dark at 37 °C for 1.5 h, and wash 3 times with PBS; add fluorescein isothiocyanate (FITC)-labeled goat anti-mouse secondary antibody (1:5000), incubate at 37 °C for 1 h, and wash 3 times with PBS; add 100 μL of 1:100 diluted Hoechst 33342 live cell staining solution to each well, and observe under an inverted fluorescence microscope. A small amount of HBSS can be added to prevent the well plate from drying out too much and affecting fluorescence observation. The results show that green fluorescence can be clearly seen in CAMSp cells infected with HSHRV, indicating antigen positivity. The cell nuclei show blue fluorescence after uniform staining with Hoechst 33342 live cell staining solution, proving that a large amount of HSHRV virus proliferates in CAMSp cells. No specific fluorescence is produced in the blank control cells ( Figure 10 ).

[0057] 13. Electron microscopy observation Take CAMSP cells in good growth condition, inoculate with the virus and observe the cytopathic effect for about 50%. Discard the original culture medium, wash with HBSS, add 1 mL of 2.5% (v / v) glutaraldehyde, fix at room temperature for 3 min, scrape the cells with a cell scraper, aspirate the cell mass into a centrifuge tube, centrifuge at 2000 rpm for 3 min, discard the supernatant, fix with glutaraldehyde. After fixation, rinse 3 times with 0.1 M phosphate buffer, fix with 1% osmium tetroxide at room temperature for 2 h, and then rinse 3 times with 0.1 M phosphate buffer. Add ethanol with different concentrations for dehydration (30%, 50%, 70%, 80%, 100%), 20 min each time, dehydrate with 100% propanol twice, 15 min each time. Immerse in a mixture of acetone:Embed 812 resin = 1:1 at 37°C for 2 h, and then infiltrate overnight at 37°C in a mixture of acetone:Embed 812 resin = 1:2. Embed with pure Embed 812 resin in a 37°C environment for 5 - 8 h, then pour into an embedding mold and bake overnight at 37°C. After embedding, polymerize in a 60°C environment for 48 h. Then cut the resin block into ultra-thin sections of 60 - 80 nm and pick up the sections. Place the sections in a saturated ethanol solution of 2% uranyl acetate and stain for 8 min in the dark, wash 3 times with 70% ethanol and ultrapure water respectively. Then stain with 2.6% lead citrate solution for 8 min, wash 3 times with ultrapure water, and blot dry with filter paper. Dry the sections at room temperature overnight. Observe under a transmission electron microscope (Hitachi, HT-7560, Japan), collect images for analysis. The results show that a large number of bullet-shaped virus particles with a diameter of about 50 nm - 60 nm and a length of about 150 nm can be observed under the transmission electron microscope ( Figure 11 ), which indicates that HSHRV can proliferate in CAMSP cells.

[0058] In summary, in this application, the hybrid snakehead spleen cell line (CAMSp) was established using the spleen tissue of hybrid snakehead as the material. The CAMSp cells were infected with the HSHRV-GZ22 strain, which could cause typical cytopathic effects (CPE) in the cells, and the virus titer was as high as 10 8.33 TCID50 / mL, higher than that of CAMK cells, indicating that the cells are very sensitive to HSHRV-GZ22. Through electron microscopy observation, a large number of bullet-shaped virus particles can be seen. Indirect immunofluorescence experiments showed that the CAMSp cells established in this application are sensitive to HSHRV and can be applied to various aspects of research on the pathogenic mechanism, detection method, vaccine preparation, interaction with host cells, and disease prevention and control of HSHRV.

[0059] As described above, these are only several embodiments of the present application and do not impose any form of limitation on the present application. Although the present application is disclosed above with preferred embodiments, it is not intended to limit the present application. Any person skilled in the art, without departing from the scope of the technical solution of the present application, making some changes or modifications using the disclosed technical content is equivalent to equivalent implementation cases and all fall within the scope of the technical solution.

Claims

1. A hybrid snakehead spleen cell line, characterized in that, The spleen cell line of hybrid snakehead is named CAMSp and is deposited in the China Center for Type Culture Collection with the deposit number of CCTCC NO: C202598.

2. The method for establishing the spleen cell line of hybrid snakehead fish according to claim 1, characterized in that, It includes the following steps: (1) Pretreat and digest the spleen tissue of hybrid snakehead with trypsin successively to obtain spleen cells of hybrid snakehead; (2) Primarily culture the spleen cells of hybrid snakehead with L-15 cell culture medium; (3) When the cells grow into a monolayer, remove the old culture medium, digest the cells with trypsin-EDTA until the cells become round, then inoculate them into a culture flask at a ratio of 1:2 every 3 - 4 days, and conduct subculture of the cells with L-15 cell culture medium. After 30 passages, conduct subculture at a ratio of 1:3 to obtain the spleen cell line of hybrid snakehead.

3. The establishment method according to claim 2, characterized in that, In step (1), the pretreatment includes rinsing 1 to 3 times with HBSS, placing it in a sterile penicillin bottle, adding 0.4 to 0.6 mL of HBSS, cutting it into pieces of 0.8 to 1.2 mm 3 , adding HBSS, centrifuging to remove the supernatant, and repeating 1 to 2 times; The rotation speed of the centrifugation is 800 - 1200 r / min, and the time of the centrifugation is 5 - 15 min.

4. The establishment method according to claim 2, characterized in that, In step (1), the concentration of the trypsin is 0.2 - 0.3%, the volume ratio of the trypsin to the spleen tissue of hybrid snakehead is 8 - 12:1, the temperature of the trypsin digestion is 25 - 30 °C, and the time of the trypsin digestion is 20 - 30 min.

5. The establishment method according to claim 2, characterized in that In steps (2) and (3), the L-15 cell culture medium contains 5 - 20% fetal bovine serum and 1.5 - 2.5% penicillin-streptomycin-amphotericin B; In step (3), when the passage number of the cells ≤ 10, the L-15 cell culture medium contains 20% fetal bovine serum and 2% penicillin-streptomycin-amphotericin B. When the passage number of the cells > 10, the L-15 cell culture medium contains 10% fetal bovine serum and 2% penicillin-streptomycin-amphotericin B; In step (2), the temperature of the primary culture is 15 - 32 °C.

6. The establishment method according to claim 2, characterized in that In step (3), in the trypsin-EDTA, it contains 0.913 mM EDTA, 10 mg / L phenol red, 2.5 g / L trypsin, 1×HBSS. The dosage of the 1×HBSS is 1 L. There are no calcium and magnesium ions in the 1×HBSS, and the pH value of the trypsin-EDTA is 7.1 - 8.0; In step (3), the temperature of the subculture is 15 - 32 °C.

7. The establishment method according to claim 2, characterized in that It also includes step (4) cryopreservation and resuscitation of cells: Resuspend the cells with cryopreservation medium, place them at -80°C overnight, and then transfer them to liquid nitrogen for cryopreservation; when resuscitating the cells, take out the cells cryopreserved in liquid nitrogen, thaw them in a 37°C water bath, centrifuge them at 800 - 1200 r / min for 4 - 6 min, discard the supernatant, add L-15 medium containing 10% FBS to resuspend the cells, transfer the cells to a 25 cm 2 culture flask, supplement the medium to 5 - 6 mL, blow the cells evenly, culture them at 15 - 32°C, observe the cell state under an optical microscope 24 h later and change the medium; The formula of the cryopreservation solution is 70% L-15 medium, 20% FBS, and 10% DMSO.

8. Application of the spleen cell line of hybrid snakehead described in claim 1 as a sensitive cell line to the rhabdovirus of hybrid snakehead HSHRV.

9. Application of the spleen cell line of hybrid snakehead described in claim 1 as a transfected cell.