Recombinant oncolytic herpes virus and application thereof

Abstract

The invention belongs to the technical field of biological medicines, and particularly relates to a recombinant oncolytic herpesvirus and application thereof. In order to solve the problems of insufficient replication efficiency, limited immune activation and the like of the existing oncolytic herpesvirus, the invention provides a recombinant oncolytic herpesvirus which contains a coding neurotoxic factor regulated by a tumor specific promoter or a gene related to replication and a gene segment for coding an immunomodulatory factor. Experiments prove that the recombinant oncolytic herpesvirus prepared by the invention has multiple advantages of high replication efficiency, strong tumor targeting, remarkable treatment effect on various tumors, high safety and the like, provides a brand new drug development thought and treatment choice for the field of tumor immunotherapy, and has important clinical application value and market prospect.

Description

Technical Field

[0001] The present invention belongs to the technical field of biomedicine, and particularly relates to a recombinant oncolytic herpesvirus and its application. Background Art

[0002] As an important breakthrough in the field of tumor immunotherapy, oncolytic viruses (OVs) have become a research hotspot in recent years. The anti-tumor effects of oncolytic viruses are divided into direct effects and indirect effects. The direct effect is manifested as the termination of cellular protein synthesis, the cessation of proliferation and division, and the rapid death of cells. The indirect effect is manifested as the lysis of tumor cells after death, releasing tumor-associated antigens, pathogen-associated molecular patterns (PAMPs) of the virus, and cellular danger-associated molecular pattern signals (DAMPs). These antigens and pattern signals induce the body to produce an adaptive immune response against tumors, enabling tumor cells that are not directly infected with the virus to be recognized by anti-tumor immunity, thereby reducing the tumor burden, reconstructing the body's immune surveillance against tumors, and turning "cold" tumors into "hot" tumors. Among them, Herpes simplex virus (HSV) has been widely used in the drug development of recombinant oncolytic viruses due to its broad host range and large genome capacity.

[0003] At present, important breakthroughs have been made in the research and development of oncolytic virus drugs based on HSV. For example, T-VEC (Talimogenelaherparepvec), as the first oncolytic virus therapy approved by the FDA, has an objective response rate (ORR) of 26.4% in the treatment of patients with stage IIIB-IV melanoma, but the complete response rate (CR) is only 10.8%; OH2 (an oncolytic virus with an HSV-2 vector developed by BinHui Bio) has obtained FDA orphan drug designation and has currently entered clinical phase III research; VG161 (an oncolytic virus with an HSV-1 vector developed by Furegene Bio) has shown preliminary efficacy in the treatment of advanced hepatocellular carcinoma. Although oncolytic viruses with HSV vectors have proven clinical feasibility, the existing oncolytic herpesviruses have insufficient replication efficiency and limited immune activation, and the clinical efficacy still needs to be improved. Summary of the Invention

[0004] In order to solve the key problems of insufficient replication efficiency and limited immune activation of existing oncolytic herpesviruses, the present invention provides a recombinant oncolytic herpesvirus and its application.

[0005] To achieve the above application objectives, the technical solutions adopted in this application are as follows:

[0006] In a first aspect, the present invention provides a recombinant oncolytic herpesvirus, and its viral genome includes:

[0007] (a) A gene encoding an immunomodulatory factor: the immunomodulatory factor is selected from at least one of IL-7, IL-12, IL-15 or GM-CSF;

[0008] (b) A gene related to viral toxicity or replication regulated by a tumor-specific promoter: the tumor-specific promoter is selected from at least one of the human survivin promoter, the human telomerase reverse transcriptase promoter (hTERT), the alpha-fetoprotein promoter (AFP), the carcinoembryonic antigen promoter (CEA), and the prostate-specific antigen (PSA) promoter; the gene is selected from at least one of the ICP34.5, ICP6, ICP47 or ICP27 genes.

[0009] Further, the gene related to viral toxicity or replication is the ICP34.5 gene, and its nucleotide sequence is as shown in SEQ ID NO:1 or a nucleotide sequence having more than 90% homology with SEQ ID NO:1 and having the same or similar biological activity.

[0010] Further, the tumor-specific promoter is selected from the Survivin promoter (abbreviated as pSUR), and its nucleotide sequence is as shown in SEQ ID NO:2 or a nucleotide sequence having more than 90% homology with SEQ ID NO:2 and having the same or similar biological activity.

[0011] Further, the immunomodulatory factor is IL-12, and its nucleotide sequence is as shown in SEQ ID NO:3 or SEQ ID NO:4.

[0012] Further, the recombinant oncolytic herpesvirus uses a herpesvirus as a viral vector, and is selected from at least one of herpes simplex virus type I (HSV-1) or herpes simplex virus type II (HSV-2).

[0013] Preferably, the herpes simplex virus is selected from at least one of the F strain, HF strain, KOS strain, 1716 strain, 17 strain, G207 strain, G47 Delta strain, T-VEC strain, YD06 strain, JS-1 strain or HG52 strain.

[0014] More preferably, the herpes simplex virus is the YD06 strain, and the preservation number is: CCTCC NO: V202271.

[0015] Further, the exogenous gene insertion site is the site where the wild-type herpesvirus ICP34.5 gene is deleted.

[0016] Preferably, the ICP34.5 gene locus of herpes simplex virus is replaced by an expression cassette encoding an immunomodulatory factor and an ICP34.5 gene expression cassette driven by a tumor-specific promoter.

[0017] In a second aspect, the present invention provides a method for preparing the above recombinant oncolytic herpesvirus, which comprises the following steps:

[0018] Insert an exogenous target gene into a donor plasmid containing homologous arms of the ICP34.5 gene, and then co-transfect the host cell with the herpesvirus genome for recombination to obtain a recombinant oncolytic herpesvirus, followed by expansion culture and purification.

[0019] Furthermore, the exogenous target gene includes an expression cassette encoding an immunomodulatory factor and an ICP34.5 gene expression cassette driven by a tumor-specific promoter.

[0020] Furthermore, the exogenous target gene is obtained by concatenating an expression cassette encoding immunomodulatory factor IL-12 and an ICP34.5 gene expression cassette driven by a tumor-specific promoter.

[0021] Preferably, the nucleotide sequence of the exogenous target gene is obtained by successively concatenating SEQ ID NO:3 or SEQ ID NO:4, SEQ ID NO:2, and SEQ ID NO:1.

[0022] In a third aspect, the present invention provides a composition containing the above recombinant oncolytic herpesvirus.

[0023] Furthermore, the composition further contains a pharmaceutically acceptable carrier.

[0024] In a fourth aspect, the present invention provides the use of the above recombinant oncolytic herpesvirus or a composition containing the above recombinant oncolytic herpesvirus in the preparation of a drug for treating and / or preventing tumors.

[0025] Furthermore, the tumor is selected from at least one of melanoma, osteosarcoma, colon cancer, rectal cancer, breast cancer, glioma, uveal melanoma, ovarian cancer, liver cancer, bladder cancer, cervical cancer, sarcoma, skin cancer, prostate cancer, pancreatic cancer, nasopharyngeal cancer, lung cancer, gastric cancer, head and neck cancer, hypopharyngeal cancer, kidney cancer, laryngeal cancer, oral cancer, malignant mesothelioma, neuroblastoma, ovarian cancer, papillomatosis, and retinoblastoma.

[0026] Preferably, the tumor has high expression of Survivin.

[0027] Furthermore, the dosage form of the drug is an injection, and the injection method is at least one of intratumoral injection, intramuscular injection, intravenous injection, subcutaneous injection, intradermal injection, intramyocardial injection, or intraperitoneal injection.

[0028] Beneficial effects:

[0029] 1. The present invention uses a highly active tumor-specific promoter to drive the replication of herpes virus, significantly improving the replication efficiency and targeted killing ability of oncolytic herpes virus, effectively solving the technical problem of insufficient activity of existing oncolytic viruses; and through genetic engineering transformation, the virus is made to secrete immune regulatory factors, remodeling the tumor immunosuppressive microenvironment, avoiding the toxic and side effects of systemic administration of immune regulatory factors, enhancing local anti-tumor immune response, and significantly increasing T cell infiltration.

[0030] 2. In the specific experiments of the present invention, the tumor-specific promoter pSUR is combined with the immune regulatory factor IL-12 immunotherapy strategy. The neurotoxic factor ICP34.5 encoded and regulated by pSUR enhances the selective replication and oncolytic activity of the virus in tumors, improving the safety of oncolytic virus; the nucleotide fragment encoding the cytokine IL-12 can increase the anti-tumor immune response, and thus achieve the dual therapeutic effects of direct oncolysis and immune activation of the virus, further enhancing the efficacy of oncolytic virus.

[0031] 3. The recombinant oncolytic herpes virus prepared by the present invention has multiple advantages such as high replication efficiency, strong tumor targeting, significant therapeutic effect, and high safety, providing a new drug development idea and treatment option for the field of tumor immunotherapy, and having important clinical application value and market prospect. Description of the drawings

[0032] Figure 1 Schematic design diagram of the recombinant oncolytic herpes virus SKV-012 for Example 1;

[0033] Figure 2 PCR identification electrophoresis diagram of the foreign gene inserted into the recombinant oncolytic herpes virus SKV-012 for Example 2;

[0034] Figure 3 IL-12 secretion result diagram detected by ELISA for SKV-012 infected VERO cells for Example 2;

[0035] Figure 4 For Example 3 TCID 50 Diagram of the result of detecting the titer of oncolytic virus by the method;

[0036] Figure 5 Diagram of the result of the recombinant oncolytic herpes virus SKV-012 enhancing PBMC-mediated tumor killing for Example 3; After inoculating human primary malignant melanoma cells for 24 hours, infect with SKV-012 or control virus at an MOI = 0.01, add autologous PBMC (effector-to-target ratio 1:1) 24 hours later, and observe the killing effect by microscope after co-culturing for 48 hours;

[0037] Figure 6 Figure showing the evaluation results of the anti-tumor activity of the recombinant oncolytic herpesvirus SKV-012 in an immunocompetent mouse orthotopic tumor transplantation model in Example 4;

[0038] Figure 7 Figure showing the evaluation results of the anti-tumor activity of the recombinant oncolytic herpesvirus SKV-012 in an immunodeficient mouse xenograft tumor transplantation model in Example 4;

[0039] Among them, ns means no significant difference; * means p < 0.05; ** means p < 0.01; *** means p < 0.001; **** means p < 0.0001. Detailed implementation manners

[0040] In order to make the technical problems to be solved, technical solutions and beneficial effects of the present application clearer and more understandable, the present application will be further described in detail below in combination with the implementation manners.

[0041] Unless otherwise defined, all technical terms used herein have the same meaning as understood by those of ordinary skill in the art.

[0042] The term "Oncolytic Virus (OV)" refers to a recombinant virus whose genes have been manipulated to specifically replicate in tumor cells so that the virus can destroy tumor cells. The oncolytic virus can be derived from adenovirus, herpes simplex virus, measles virus, lentivirus, retrovirus, cytomegalovirus, baculovirus, reovirus, adeno-associated virus, myxoma virus, vesicular stomatitis virus, poliovirus, Newcastle disease virus, parvovirus, coxsackievirus, Seneca virus, vaccinia virus or poxvirus. According to the different genetic materials of the virus, oncolytic viruses can be divided into DNA oncolytic viruses and RNA oncolytic viruses. For example, DNA oncolytic viruses can include but are not limited to oncolytic adenovirus, vaccinia virus, parvovirus, herpes simplex virus, etc. RNA oncolytic viruses can include but are not limited to reovirus, poliovirus, Seneca virus, etc.

[0043] The term "herpes simplex virus (HSV)" is an enveloped, neurotropic double-stranded DNA oncolytic virus. This type of virus is divided into herpes simplex virus type 1 (HSV-1) and herpes simplex virus type 2 (HSV-2).

[0044] The term "oncolytic herpesvirus" refers to a herpesvirus that can specifically replicate in tumor cells and kill tumor cells.

[0045] The term "Recombinant Oncolytic Herpes Simplex Virus (oHSV)" refers to a herpes simplex virus (HSV-1 or HSV-2) modified by genetic engineering, which is designed to selectively target and kill cancer cells while activating an anti-tumor immune response.

[0046] The term "ICP34.5 (Infected Cell Protein 34.5)" is a key factor mediating neurotoxicity encoded by herpes simplex virus type 1 (HSV-1), which confers the ability of HSV-1 to replicate in the central nervous system.

[0047] The term "Tumor-Specific Promoter (TSP)" is a class of gene promoters that are specifically activated in tumor cells while being silent or expressed at low levels in normal cells. It can drive the efficient and specific expression of the target gene in tumor cells.

[0048] The term "Interleukin-12 (IL-12)" is a pro-inflammatory cytokine mainly produced by antigen-presenting cells (APCs) such as dendritic cells, macrophages, and B cells after infection or immune stimulation.

[0049] In some embodiments of the present invention, HSV is used as an oncolytic virus, and the HSV can be strain F, strain HF, strain KOS, strain 1716, strain 17, strain G207, strain G47 Delta, strain T-VEC, YD06 (deposit number: CCTCC NO: V202271), strain JS-1, and strain HG52. Preferably, the HSV is strain YD06 (HSV-1, deposit number: CCTCC NO: V202271).

[0050] In some embodiments of the present invention, the wild HSV virus genome is modified for the development of a safe oncolytic virus vector. For example, the neurotoxic gene ICP34.5 (also known as γ34.5) of HSV is deleted to prepare a non-toxic / non-neurotoxic oncolytic virus; the ICP47 gene is deleted to restore the antigen presentation function mediated by MHC class I molecules; the ICP6 gene is deleted to inhibit the synthesis of viral late proteins and further enhance the safety of the virus in gliomas.

[0051] In some embodiments of the present invention, in order to improve the ability of oncolytic virus to target and infect cancer cells and / or its oncolytic ability, the specific functions of the ICP34.5 and ICP6 genes of HSV can be restored. For example, codon-optimized ICP34.5 is used, and its nucleotide sequence is as shown in SEQ ID NO:1. Or a nucleotide sequence having more than 90% homology with SEQ ID NO:1 and having the same or similar biological activity is used.

[0052] In some embodiments of the present invention, codon-optimized ICP34.5 can be driven by a tumor-specific promoter, and the promoters include but are not limited to the human survivin promoter, the human telomerase reverse transcriptase promoter (hTERT), the alpha-fetoprotein promoter (AFP), the carcinoembryonic antigen promoter (CEA), the prostate-specific antigen (PSA) promoter, and other suitable tumor-specific promoters that are specific for a single tumor type and are known in the art.

[0053] For example, pSUR is used as the tumor-specific promoter, and its nucleotide sequence is as shown in SEQ ID NO:2. Or a nucleotide sequence having more than 90% homology with SEQ ID NO:2 and having the same or similar biological activity is used.

[0054] In some embodiments of the present invention, a recombinant oncolytic herpes virus is designed to express one or more exogenous genes, including but not limited to nucleic acid fragments encoding cytokines, nucleic acid fragments encoding molecules that facilitate the targeting and infection of cancer cells by oncolytic viruses, nucleic acid fragments encoding co-stimulatory molecules, nucleic acid fragments encoding immune checkpoint inhibitors, nucleic acid fragments encoding antibodies against effector cell surface antigens, nucleic acid fragments encoding molecules that facilitate the escape or resistance of oncolytic viruses from host immune responses, nucleic acid fragments encoding chemokines, nucleic acid fragments encoding antigenic epitopes, or combinations thereof.

[0055] In some embodiments of the present invention, a recombinant oncolytic herpes virus is designed to release cytokines to recruit endogenous immune cells to kill tumor cells, thereby achieving the purpose of treating tumors, and further enhancing the adaptive immune response and inducing the formation of immune memory T cells, thereby obtaining a specific long-term anti-tumor mechanism. The cytokines are selected from one or more of IL-7, IL-12, IL-15, and GM-CSF.

[0056] Interleukin-12 (IL-12) is a pro-inflammatory cytokine derived from antigen-presenting cells, which can promote the proliferation and activation of NK cells and T cells, reshape the immunosuppressive tumor microenvironment, induce T cells and NK cells to secrete interferon γ (IFN-γ), and produce long-term anti-tumor immune memory function. It has shown significant anti-tumor effects in the preclinical stage, but its further development is limited by severe dose-limiting toxicity after systemic administration. Although systemic administration of IL-12 has high toxicity, local secretion of IL-12 by oncolytic viruses can avoid systemic toxicity. The applicant found in the study that intratumoral injection of IL-12 combined with oncolytic viruses can induce significant tumor regression and increase tumor-infiltrating lymphocytes. Therefore, in some embodiments of the present invention, an exogenous gene, such as the gene encoding human IL-12 shown in SEQ ID NO:3 or the gene encoding murine IL-12 shown in SEQ ID NO.4, is introduced to design a recombinant oncolytic herpesvirus that expresses IL-12, so as to both enhance the anti-tumor immune response and avoid the systemic toxicity caused by systemic administration of IL-12.

[0057] In some embodiments of the present invention, each exogenous gene nucleic acid fragment can be inserted into the genome of the oncolytic virus by one or more common methods in the art to obtain a recombinant oncolytic herpesvirus, and this application does not limit this. For example, ligases, fusion PCR techniques, etc. or combinations thereof can be used to insert one or more exogenous gene nucleic acid fragments into the vector. It should be noted that this application does not limit the order of each nucleic acid fragment in the recombinant nucleic acid.

[0058] In some embodiments, the exogenous nucleic acid fragments can be inserted into different sites of the oncolytic virus nucleic acid respectively.

[0059] In some embodiments, the exogenous nucleic acid fragments can be inserted into the same site of the oncolytic virus.

[0060] In some embodiments, the insertion site of the exogenous nucleic acid fragment can be any suitable site in the coding region of the oncolytic virus nucleic acid. For example, the insertion site of the nucleic acid fragment can be the position where one or more coding genes (such as ICP34.5 or ICP6) are deleted in the HSV-1 virus.

[0061] In some embodiments, the exogenous nucleic acid fragments can be inserted into the same site or different sites of the oncolytic virus nucleic acid in sequence. The order of the exogenous nucleic acid fragments in the recombinant nucleic acid can be arbitrary.

[0062] In a specific preferred embodiment of the present invention, in order to retain the tumor cell-specific replication function of ICP34.5 while eliminating its toxicity to normal cells, codon optimization was performed on it, and its nucleotide sequence is shown in SEQ ID NO:1; at the same time, the Survivin promoter pSUR (shown in SEQ ID NO:2), which is highly expressed in various malignant tumors such as melanoma, glioma, osteosarcoma, colorectal cancer, breast cancer, and ovarian cancer and hardly expressed in normal tissues, was used as a tumor-specific transcriptional regulatory element to ensure the specific and efficient replication of the oncolytic virus in tumor tissues; finally, the gene sequence encoding IL-12 (SEQ ID NO:3 or SEQ ID NO:4) was integrated into the viral genome. As an immunomodulatory factor, IL-12 has multiple anti-tumor functions: (a) significantly promoting the proliferation and activation of NK cells and T cells; (b) effectively remodeling the immunosuppressive tumor microenvironment; (c) inducing the generation of long-term anti-tumor immune memory. These improvements enable the oncolytic virus not only to replicate efficiently but also to have precise targeting and strong immune activation capabilities.

[0063] In some embodiments of the present invention, there is provided the use of the recombinant oncolytic herpesvirus prepared by the present invention or a composition containing the recombinant oncolytic herpesvirus in the preparation of a drug for treating and / or preventing tumors.

[0064] The tumors include but are not limited to melanoma, osteosarcoma, colon cancer, rectal cancer, breast cancer, glioma, uveal melanoma, ovarian cancer, liver cancer, bladder cancer, cervical cancer, sarcoma, skin cancer, prostate cancer, pancreatic cancer, nasopharyngeal cancer, lung cancer, gastric cancer, head and neck cancer, hypopharyngeal cancer, kidney cancer, laryngeal cancer, oral cancer, malignant mesothelioma, neuroblastoma, ovarian cancer, papillomatosis, retinoblastoma.

[0065] In some embodiments of the present invention, when the prepared recombinant oncolytic herpesvirus or composition is used in the preparation of a drug for treating and / or preventing tumors, the drug can be prepared into an injection preparation, which can be administered by injection at the site within or near the tumor. The injection routes of the injection preparation are intratumoral injection, intramuscular injection, intravenous injection, subcutaneous injection, intradermal injection, intramyocardial injection, or intraperitoneal injection.

[0066] In some embodiments of the present invention, the prepared recombinant oncolytic herpesvirus or composition can also be combined with other tumor treatment methods or drugs. For example, chemotherapy drugs such as paclitaxel, etoposide, and cisplatin; targeted therapy drugs such as EGFR inhibitors (e.g., gefitinib, osimertinib), ALK / ROS1 inhibitors (e.g., crizotinib, alectinib), BRAF inhibitors (e.g., vemurafenib), anti-HER2 antibodies, anti-VEGF antibodies, anti-PD-1 / PD-L1 antibodies. Or immunotherapy drugs or methods, such as immune checkpoint inhibitors, CAR-T cell therapy, cancer vaccines.

[0067] Codon-optimized ICP34.5 sequence:

[0068] SEQ ID NO:1

[0069] ATGGCTAGAAGAAGAAGACACAGGGGCCCCAGAAGGCCCAGACCTCCTGGACCTACAGGCGCTGTTCCTACAGCCCAGTCCCAGGTTACCAGCACACCCAACAGCGAGCCTGCCGTTAGGTCCGCTCCAGCTGCTGCTCCTCCTCCTCCTCCCGCTGGAGGACCTCCTCCTTCTTGTTCCCTGCTGCTGAGGCAGTGGCTGCACGTTCCTGAGAGCGCTTCCGATGATGACGACGACGATGACTGGCCCGACTCCCCTCCTCCTGAACCTGCTCCTGAGGCTAGGCCAACCGCTGCTGCTCCCAGACCTAGACCACCACCACCAGGAGTGGGCCCTGGAGGAGGAGCTGATCCTTCTCACCCCCCATCCAGGCCATTTCGGCTGCCTCCTAGACTGGCCCTGAGACTGAGGGTGACCGCTGAACACCTGGCCAGACTGAGGCTGAGGAGGGCTGGAGGAGAGGGAGCCCCTGAACCTCCTGCTACACCTGCTACCCCTGCCACACCAGCTACCCCTGCTACACCAGCTAGAGTGAGATTTTCCCCTCACGTGAGGGTGAGACACCTGGTGGTGTGGGCTTCCGCTGCTAGACTGGCTAGGAGAGGCAGCTGGGCTAGAGAGAGGGCTGACAGAGCCAGGTTTAGAAGAAGGGTGGCCGAGGCCGAGGCCGTTATTGGACCTTGTCTGGGCCCTGAGGCCAGAGCTAGAGCTTTGGCTAGAGGCGCCGGCCCTGCTAATTCCGTTTGA.

[0070] Tumor-specific promoter sequence (pSUR):

[0071] SEQ ID NO:2

[0072] TAGGTGTGGGCAGGGACGAGCTGGCGCGGCGTCGCTGGGTGCACCGCGACCACGGGCAGAGCCACGCGGCGGGAGGACTACAACTCCCGGCACACCCCGCGCCGCCCCGCCTCTACTCCCAGAAGGCCGCGGGGGGTGGACCGCCTAAGAGGGCGTGCGCTCCCGACATGCCCCGCGGCGCGCCATTAACCGCCAGATTTGAATCGCGGGACCCGTTGGCAGAGGTGGCGGCGGCGGC.

[0073] Nucleotide sequence of human IL-12 (hIL-12)

[0074] SEQ ID NO:3

[0075]

[0076] Nucleotide sequence of murine IL-12 (mIL-12)

[0077] SEQ ID NO:4

[0078]

[0079] Specific embodiments will be enumerated below to explain the solution of the present invention. Those skilled in the art will understand that the following embodiments are only used to illustrate the present invention and should not be construed as limiting the scope of the present invention. For those not specified in the embodiments regarding specific technologies or conditions, they shall be carried out according to the technologies or conditions described in the literature in the art or according to the product specifications. For reagents or instruments not specified by the manufacturer, they are all conventional products that can be obtained through commercial purchase.

[0080] Example 1 Construction of recombinant oncolytic herpesvirus SKV-012

[0081] Since the natural ICP34.5 gene has a very high GC content, the present invention obtained the optimized ICP34.5 gene nucleotide sequence through codon optimization, as shown in SEQ ID NO:1. The expression cassette of human IL-12 (hIL-12, SEQ ID NO:3) or murine IL-12 (mIL-12, SEQ ID NO:4) driven by the CMV promoter was concatenated with the expression cassette of codon-optimized ICP34.5 (SEQ ID NO:1) controlled by the tumor-specific promoter (pSUR, SEQ ID NO:2), and was submitted to GenScript for gene synthesis.

[0082] The above-synthesized foreign gene fragment was constructed into a donor plasmid containing ICP34.5 homologous arms through homologous recombination, and co-transfected into 293T cells with the viral genome. The above donor plasmid was recombined into the ICP34.5 position in the HSV-1 genome to construct a novel recombinant oncolytic herpesvirus (human or murine IL-12), named SKV-012 (hIL-12) or SKV-012 (mIL-12), and the structural schematic is as Figure 1 shown. The specific technical route: plating 293T cells - screening for stable transfected strains targeting sgRNA - transfecting donor plasmid - infecting YD06 - dICP34.5 - dICP47 strain - collecting virus - picking monoclonal virus - PCR identification - amplifying positive recombinant clones - titer detection - obtaining recombinant oncolytic virus.

[0083] Among them, the YD06 - dICP34.5 - dICP47 strain has deleted the ICP34.5 and ICP47 genes in the YD06 strain, and is named oHSV in this patent for easy understanding. The YD06 - dICP34.5 - dICP47 strain and the screening for stable transfected strains targeting sgRNA are prior arts, referring to Patent CN117660367A.

[0084] The detailed steps for virus construction are as follows:

[0085] (a) 293T cells were seeded at 1×106 Seed the cells in the multi-well plate at a density of [X] cells per well and incubate overnight.

[0086] (b) Take a sterilized 1.5 ml EP tube, add 200 μl of Opti-MEM medium, add 2 μg of the donor plasmid, vortex thoroughly, then add PEI and vortex again. Let it stand for about 20 min and then add it to the 293T cells.

[0087] (c) Dilute the oHSV virus solution with known titer using 2% FBS DMEM medium. Discard the supernatant of the 293T cells 12 hours after infecting with the donor plasmid, and add 100 μl of the virus dilution to infect. After 3 hours, replace the virus solution with 2 ml of 2% FBS DMEM medium and culture in a 37°C, 5% CO₂ incubator.

[0088] (d) When most of the 293T cells become round and floating, collect the cell suspension, freeze-thaw it three times at -80°C and 37°C, filter it through a 0.45 μM filter, and store it in a -80°C refrigerator.

[0089] (e) Seed VERO cells in a 96-well plate at a density of 2×10 4 cells per well. Gradient dilute the virus stock solution obtained in step (d) with a gradient set from 10 -2 to 10 -10 . Add it to the 96-well plate and culture in a 37°C incubator for 72 hours. Select the wells with plaques formed by single viruses, and take the supernatant for ELISA detection.

[0090] (f) Select the wells with positive ELISA results, take the virus solution for PCR verification, and finally obtain the SKV-012 virus solution.

[0091] Example 2 Identification of Recombinant Oncolytic Herpes Simplex Virus SKV-012

[0092] Perform PCR identification and sequencing analysis on the foreign genes inserted into the recombinant oncolytic herpes simplex virus SKV-012 (hIL-12) or SKV-012 (mIL-12) prepared in Example 1 to confirm that they are correctly inserted into the ICP34.5 gene deletion position in the HSV genome. The specific operations are as follows:

[0093] Take 200 μL of the SKV-012 virus solution prepared in Example 1 and extract the herpes virus genome using a virus genomic DNA / RNA extraction kit. The identification primers used are as follows:

[0094] SEQ ID NO:5: ICP34.5-HDR-F: TGTCAAACTCTACCACCCCGGCACGCTCTC

[0095] Note: The value of [X] in step (a) and the specific dilution factor in step (e) are not provided in the original text, so they are left as placeholders in the translation. Also, the specific content of SEQ ID NO:5 should be adjusted according to the actual sequence information.SEQ ID NO:6: hIL-12-R: CCTCACTGCTCTGGTCCAAGGTCCAGGTGAT

[0096] SEQ ID NO:7: mIL-12-R: GGTTCACTGTTTCTCCAGGGGCATCGGGAG

[0097] SEQ ID NO:8: pSUR-F: CCACGCGGCGGGAGGACTACAACTC

[0098] SEQ ID NO:9: ICP34.5-R: TCTCCTCCAGCCCTCCTCAGCCTCAGTCTG

[0099] PCR conditions:

[0100] 98°C for 2 min

[0101]

[0102] 4°C ∞

[0103] The PCR products were subjected to agarose gel electrophoresis. The results showed that a single target band could be amplified for each, and the fragment sizes were correct, indicating that each foreign gene fragment had been inserted into the oncolytic virus strain. The specific electrophoresis results are as Figure 2 shown.

[0104] The amplified fragments were subjected to Sanger sequencing and sequence alignment using Snapgene biological software. The alignment result was 100%. Thus, it was verified that the DNA fragments amplified by PCR were the target gene sequences and there were no mutations.

[0105] To confirm that the recombinant oncolytic herpes simplex virus SKV-012 could secrete the cytokine IL-12 normally, oHSV (only lacking the ICP34.5 and ICP47 genes and without inserting any foreign genes) was used as a control. VERO cells were seeded at 3×10 5 cells per well in a 24-well plate. After overnight incubation, they were infected with SKV-012 at an MOI of 0.01. The concentration of IL-12 in the supernatant was detected by ELISA 72 hours later. The results are as Figure 3 shown. The prepared recombinant oncolytic herpes simplex virus SKV-012 could secrete the cytokine IL-12 normally, and the secretion amount was higher compared with the control group.

[0106] Example 3 Evaluation of the in vitro oncolytic activity of recombinant oncolytic herpes simplex virus SKV-012

[0107] To further confirm that the recombinant oncolytic herpes simplex virus SKV-012 has enhanced replication ability in tumor cells, the expression of Survivin in different cell lines was detected by flow cytometry. The specific method is as follows: Take 1×10 6 cells, after blocking with 2% BSA for 30 min, wash twice with PBS, fix with 4% paraformaldehyde (PFA) at room temperature for 15 minutes, wash twice with PBS, permeabilize with 0.1% Triton X-100 for 30 minutes, wash twice with PBS, add anti-Survivin primary antibody (dilution ratio 1:500), incubate at room temperature for 30 minutes, wash twice with PBS, add Alexa Fluor 488-labeled goat anti-rabbit IgG, 1:500, incubate in the dark for 30 minutes, wash twice with PBS, and detect by flow cytometry. Use Alexa Fluor 488-labeled goat anti-rabbit IgG as an isotype control to analyze the proportion of positive cells. The flow cytometry results are shown in Table 1.

[0108] Table 1 Expression of Survivin detected by flow cytometry

[0109]

[0110]

[0111] Human melanoma cell lines A375 and UACC62 with high Survivin expression and human osteosarcoma cell line 143B were selected to further evaluate the effect of the Survivin promoter pSUR on the virus replication ability. Take 3×10 5 cells in the logarithmic growth phase of the above-mentioned tumor cells and inoculate them into 24-well plates. After culturing for 12 hours, infect with SKV-012 at 10 3 PFU (for human cells, use the virus carrying human IL-12, and for murine cells, use the virus carrying murine IL-12), and set the single oncolytic virus group oHSV (only lacking the ICP34.5 and ICP47 genes and not inserting any foreign genes) as a control. Harvest the virus after 72 hours and detect the virus titer by the TCID 50 method. The results show that the recombinant oncolytic herpes simplex virus SKV-012 (hIL-12) has a higher virus titer in tumor cells with high Survivin expression, which is about 3-4 times higher than the virus titer of the control group virus oHSV. The specific results are as Figure 4 shown.

[0112] The above results demonstrated that the inserted exogenous nucleic acid fragment of ICP34.5 regulated by a tumor-specific promoter enhanced the replication of oncolytic virus in tumors, and the virus titer of SKV-012 was higher than that of the control virus without this exogenous fragment. Therefore, to further investigate the immunomodulatory effect of the exogenous gene IL-12 carried by the virus, primary tumor cells of human malignant melanoma and their peripheral blood mononuclear cells (PBMC) were isolated. Ten 4 primary tumor cells of human malignant melanoma were inoculated into 96-well plates. After culturing the cells for 24 hours, the oncolytic virus was infected at an MOI of 0.01. After 24 hours, autologous PBMC were added at an effector-to-target ratio of 1:1, and the killing effect was observed under a microscope after co-culturing for 48 hours. As Figure 5 shown, the proliferation of PBMC and tumor killing induced by the recombinant oncolytic herpesvirus SKV-012 (hIL-12) group were significantly better than those of the control virus group; while in the control group without adding virus, almost no tumor killing effect was observed. The above results indicated that the inserted exogenous IL-12 in the oncolytic virus enhanced the anti-tumor immune response.

[0113] Example 4 Anti-tumor study of recombinant oncolytic herpesvirus SKV-012 in vivo

[0114] (1) Anti-tumor activity study of recombinant oncolytic herpesvirus SKV-012 in immunocompetent tumor-bearing mice

[0115] To evaluate the in vivo anti-tumor activity of SKV-012, B16H and CT26 were respectively inoculated subcutaneously into immunocompetent mice derived from C57BL / 6 and Balb / c. When the tumor volume grew to approximately 100 mm 3 ³, the mice were randomly divided into three groups, namely the control group Control, injected with 100 μL of PBS buffer; the control virus group oHSV, and the experimental group SKV-012 (mIL-12). The control virus group and the experimental group were injected with 100 μL of the same dose of 10 6 PFU virus, and injected once every 2 days for 3 consecutive times. The physical condition of the mice was observed every day, and the body weight of the mice was monitored every two days. The tumor diameter was monitored using vernier calipers and the tumor volume was calculated. When the tumor volume of the mice exceeded 2000 mm 3 ³, the mice were euthanized. The results were as Figure 6As shown, in a murine melanoma model, the oncolytic virus SKV-012 demonstrated a significant anti-tumor effect, with its efficacy being significantly superior to that of the control virus oHSV (P<0.01). Compared with the PBS control group, the tumor volume in the SKV-012 treatment group decreased by approximately 80% (P<0.0001), and compared with the oHSV treatment group, the tumor volume decreased by approximately 60% (P<0.01). In a murine colon cancer model, compared with the control group and the oHSV treatment group, the tumor volume decreased by approximately 70% and 60% respectively. These data fully demonstrated the potent anti-tumor activity of SKV-012.

[0116] (2) Study on the anti-tumor activity of recombinant oncolytic herpes simplex virus SKV-012 in immunodeficient tumor-bearing mice

[0117] To further evaluate the oncolytic activity of the virus, human melanoma cells A375 and human osteosarcoma cells 143B were respectively inoculated subcutaneously in immunodeficient nude mice. When the tumor volume grew to approximately 100 mm 3 3, the mice were randomly divided into three groups: the control group Control, injected with 100 μL of PBS buffer; the control virus group oHSV, and the experimental group SKV-012 (mIL-12). The control virus group and the experimental group were injected with 100 μL of the same dose of 10 6 PFU virus, injected once every two days for 3 consecutive times. The physical condition of the mice was observed daily, and the body weight of the mice was monitored every two days. The tumor diameter was monitored using vernier calipers and the tumor volume was calculated. When the tumor volume of the mice exceeded 2000 mm 3 , the mice were euthanized. The results are as Figure 7 shown. In a human melanoma xenograft model, SKV-012 inhibited tumor growth by approximately 75% and 59% respectively compared with the control group and the oHSV group. In a human osteosarcoma xenograft model, compared with the control group, both the SKV-012 treatment group and the oHSV treatment group induced significant regression of the tumors.

[0118] The above data demonstrated that the recombinant oncolytic herpes simplex virus SKV-012 based on the combination of tumor-specific promoter regulation and immunomodulatory factors could exert a synergistic anti-tumor effect, with excellent results, far superior to the control oncolytic virus.

Claims

1. Recombinant oncolytic herpesvirus, characterized in that: The viral genome includes: (a) Genes encoding immunomodulatory factors: The immunomodulatory factors are selected from at least one of IL-7, IL-12, IL-15, or GM-CSF; (b) Genes related to viral virulence or replication regulated by a tumor-specific promoter: The tumor-specific promoter is selected from at least one of the Survivin, hTERT, AFP, CEA, or PSA promoters; The genes are selected from at least one of the ICP34.5, ICP6, ICP47, or ICP27 genes.

2. The recombinant oncolytic herpesvirus according to claim 1, wherein: The gene related to viral virulence or replication is the ICP34.5 gene, and its nucleotide sequence is as shown in SEQ ID NO:1 or a nucleotide sequence having more than 90% homology with SEQ ID NO:1 and having the same or similar biological activity.

3. The recombinant oncolytic herpesvirus according to claim 1 or 2, characterized in that: The tumor-specific promoter is selected from the Survivin promoter, and its nucleotide sequence is as shown in SEQ ID NO:2 or a nucleotide sequence having more than 90% homology with SEQ ID NO:2 and having the same or similar biological activity.

4. The recombinant oncolytic herpes simplex virus according to any one of claims 1 to 3, characterized in that: The immunomodulatory factor is IL-12, and its nucleotide sequence is as shown in SEQ ID NO:3 or SEQ ID NO:

4.

5. The recombinant oncolytic herpesvirus according to any one of claims 1 to 4, characterized in that: The recombinant oncolytic herpesvirus uses herpes simplex virus as a viral vector, and is selected from at least one of the F strain, HF strain, KOS strain, 1716 strain, 17 strain, G207 strain, G47 Delta strain, T-VEC strain, YD06 strain, JS-1 strain, or HG52 strain; Preferably, the herpes simplex virus is the YD06 strain, and the deposit number is: CCTCC NO: V202271.

6. The recombinant oncolytic herpesvirus according to any one of claims 1 to 5, characterized in that: The exogenous gene insertion site is the site where the wild-type herpesvirus ICP34.5 gene is deleted.

7. A composition, characterized in that: Containing the recombinant oncolytic herpesvirus according to any one of claims 1 to 6.

8. Use of the recombinant oncolytic herpesvirus according to any one of claims 1 to 6 or the composition according to claim 7 in the preparation of a drug for treating and / or preventing tumors.

9. The application according to claim 8, wherein: The tumors are selected from at least one of melanoma, osteosarcoma, colon cancer, rectal cancer, breast cancer, glioma, uveal melanoma, ovarian cancer, liver cancer, bladder cancer, cervical cancer, sarcoma, skin cancer, prostate cancer, pancreatic cancer, nasopharyngeal cancer, lung cancer, gastric cancer, head and neck cancer, hypopharyngeal cancer, kidney cancer, laryngeal cancer, oral cancer, malignant mesothelioma, neuroblastoma, ovarian cancer, papillomatosis, retinoblastoma.

10. The application according to claim 8, wherein: The dosage form of the drug is an injection, and the injection method is at least one of intratumoral injection, intramuscular injection, intravenous injection, subcutaneous injection, intradermal injection, intramyocardial injection, or intraperitoneal injection.

Images