Reductive aminase and application thereof in synthesis of emamectin benzoate intermediate emamectin benzoate
Through the transformation and optimization of the reducing amination enzyme, combined with promoters and terminators, the complex process of methyldichloride salt synthesis and environmental pollution are solved, and efficient and low-cost methylamino avermectin synthesis is achieved.
Patent Information
- Application Number
- CN202510438560.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-09
- Publication Date
- 2025-07-25
AI Technical Summary
In the prior art, the synthesis process of A-diminectin salt is complex, the production cost is high, and accompanied by a large amount of by-product emissions, resulting in environmental pollution and it is difficult to efficiently synthesize methylamino avermectin intermediates.
By rationally modifying the reducing amination enzyme from Aspergillus oryzae, designing mutants, and combining optimized promoters and terminators, recombinant vectors and genetically engineered bacteria were constructed, and methylaminoavermectin was directly prepared using C4"carbonyl-C5" hydroxy-avermectin as substrate.
It improves the conversion rate of reducing amination enzyme, simplifies the synthesis process, reduces the catalyst cost, and achieves efficient and environmentally friendly methane avermectin production.
Smart Images

Figure CN120366247A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of synthetic biomanufacturing, and particularly relates to a reductive amination enzyme and its application in synthesizing emamectin benzoate intermediate methylamino abamectin. Background Art
[0002] Emamectin benzoate is a derivative of abamectin. Compared with its parent compound, it has significantly improved biological activity, with the activity increased by 1 to 3 orders of magnitude. As a biogenic pesticide, emamectin benzoate is not only easily degradable and has less residue, but also has extremely little environmental pollution, meeting the green environmental protection pesticide standards. Its broad insecticidal spectrum, especially excellent control effects on Lepidoptera pests such as cotton bollworms and beet armyworms, has enabled it to occupy a dominant position in the domestic pesticide market and become a leading product.
[0003] Although abamectin has been widely used globally due to its broad-spectrum, high-efficiency, and low-toxicity in pest control, it also faces problems such as the increasing insect resistance year by year, relatively weak pesticide leaching degree, and easy adsorption on the soil surface. These problems not only exacerbate pesticide pollution but also promote the research boom of abamectin derivatives. As an excellent abamectin derivative, emamectin benzoate has stronger insecticidal activity and less environmental pollution, so it has a broader development prospect in the pesticide market.
[0004] In recent years, the market of biological pesticides has been continuously growing. Data shows that from 70,800 tons in 2015 to 83,500 tons in 2020, the average annual growth rate has reached 18%. Especially biogenic pesticides represented by abamectin and emamectin benzoate are gradually occupying a larger market share due to their green environmental protection and high efficiency. With more farmers recognizing the advantages of emamectin benzoate, its market potential will be further expanded in the future.
[0005] The synthesis method of emamectin benzoate is relatively complex and is obtained by reacting methylamino abamectin with benzoic acid to form a salt. The synthesis process of methylamino abamectin requires multiple steps of modification, including protection, oxidation, amination, reduction, deprotection, and salting. Moreover, the more reactive C5-OH position in abamectin also needs special treatment, which greatly increases the production cost and often results in the emission of a large amount of by-products, bringing environmental pollution. In contrast, using biocatalytic technology for the reductive amination of C4"-carbonyl-C5"-hydroxy-abamectin can greatly simplify the synthesis process, improve efficiency and reduce environmental pollution, which helps to promote the application and popularization of emamectin benzoate. Summary of the Invention
[0006] In view of the demand for biocatalytic synthesis of methylamino abamectin, an intermediate of emamectin benzoate, in the prior art, the present invention provides a reductive amination enzyme and its application in synthesizing methylamino abamectin, an intermediate of emamectin benzoate. The specific technical solutions are as follows:
[0007] In a first aspect, the present invention provides a reductive amination enzyme mutant, which is obtained by single-point or multi-point mutations at the 177th and 225th positions of the sequence shown in SEQ ID NO.1.
[0008] Further, the reductive amination enzyme mutant is obtained by mutating the amino acid sequence shown in SEQ ID NO.1 according to one of the following mutation forms:
[0009] (1) Tyrosine at the 177th position is mutated to alanine or phenylalanine;
[0010] (2) Isoleucine at the 225th position is mutated to alanine, proline or tryptophan;
[0011] (3) Tyrosine at the 177th position is mutated to phenylalanine, and isoleucine at the 225th position is mutated to proline, tryptophan or glycine.
[0012] In a second aspect, the present invention provides a coding gene for the above-mentioned reductive amination enzyme mutant.
[0013] In a third aspect, the present invention provides a gene combination, which includes the above-mentioned coding gene and the promoter and terminator of the coding gene; the nucleotide sequence of the promoter is as shown in SEQ ID NO.45, and the nucleotide sequence of the terminator is as shown in SEQ ID NO.46.
[0014] In a fourth aspect, the present invention provides a recombinant vector, which contains the above-mentioned coding gene or the above-mentioned gene combination.
[0015] In a fifth aspect, the present invention provides a genetically engineered bacterium, which contains the above-mentioned coding gene or the above-mentioned gene combination.
[0016] In a sixth aspect, the present invention provides the application of the above-mentioned reductive amination enzyme mutant, or the above-mentioned coding gene, or the above-mentioned gene combination, or the above-mentioned recombinant vector, or the above-mentioned genetically engineered bacterium in catalyzing the synthesis of emamectin benzoate intermediate methylamino abamectin from C4" carbonyl-C5" hydroxy-abamectin.
[0017] In a seventh aspect, the present invention provides a method for producing methylamino abamectin. Using C4" carbonyl-C5" hydroxy-abamectin as a substrate and the above-mentioned reductive amination enzyme mutant as a catalyst to form a reaction system for synthesizing methylamino abamectin.
[0018] In an eighth aspect, the present invention provides a method for preparing a genetically engineered bacterium with high expression of reductive amination enzyme, including the following steps:
[0019] (1) Fusing the promoter and terminator with the gene of reductive amination enzyme or its mutant;
[0020] (2) Construct an expression vector containing the fusion gene obtained in step (1);
[0021] (3) Transform the constructed expression vector into a host cell;
[0022] The amino acid sequence of the said reductive amination enzyme is shown as SEQ ID NO.1, and the said mutant is the reductive amination enzyme mutant as described in Claim 1 or Claim 2.
[0023] Furthermore, the said expression vector is pET-28a(+).
[0024] Furthermore, the said host cell is Escherichia coli.
[0025] Even further, the said host cell is E. coli BL21(DE3).
[0026] Compared with the prior art, the present invention has the following beneficial effects:
[0027] The present invention rationally modifies the key points of the reductive amination enzyme from Aspergillus oryzae, and the conversion rate of the screened mutant to C4″-carbonyl-C5″-hydroxy-avermectin is further improved. Using the reductive amination enzyme mutant provided by the present invention, C4″-carbonyl-C5″-hydroxy-avermectin can be used as a substrate to directly prepare emamectin benzoate in the presence of methylamine, glucose dehydrogenase, glucose and cofactors. This method has mild reaction conditions and low catalyst cost, and is an ideal scheme for preparing emamectin benzoate. And the present invention also provides a combination of promoter and terminator that can promote the improvement of the expression level of the coding gene of the reductive amination enzyme mutant in the host cell, making the reductive amination enzyme mutant provided in this application have better industrial application prospects. Description of the Drawings
[0028] Figure 1 It is a schematic reaction formula diagram for preparing emamectin benzoate from C4″-carbonyl-C5″-hydroxy-avermectin. Detailed Embodiments
[0029] In order to enable those skilled in the art to better understand the solution of the present invention, the technical solution of the present invention will be clearly and completely described below in conjunction with specific embodiments. It should be noted that the following detailed description is exemplary and only a part of the embodiments of the present invention, rather than all of the embodiments.
[0030] Based on the embodiments in the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts shall fall within the protection scope of the present invention.
[0031] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the technical field to which this application belongs. The experimental materials used in the embodiments of the present invention are all conventional experimental materials in this field and can be obtained through commercial channels. The experimental methods without specified detailed conditions are carried out according to conventional experimental methods or according to the operation manuals recommended by the suppliers.
[0032] The culture media, required antibiotics, inducers, etc. configured in the embodiments of the present invention are as follows:
[0033] LB liquid medium: 5 g·L -1 yeast powder, 10 g·L -1 peptone, 10 g·L -1 sodium chloride.
[0034] LB solid medium: 5 g·L -1 yeast powder, 10 g·L -1 peptone, 10 g·L -1 sodium chloride, 3 g·L -1 agar powder.
[0035] TB liquid medium: 12 g·L -1 peptone, 12 g·L -1 yeast powder, 12.5 g·L -1 dipotassium hydrogen phosphate, 2.3 g·L -1 potassium dihydrogen phosphate, 4 mL·L -1 glycerol.
[0036] After the above culture media are dissolved in water, they are sterilized at a pressure of 0.105 MPa and a temperature of 121 °C for 20 min.
[0037] 100 mg / mL ampicillin: Weigh 5 g of sodium ampicillin and dissolve it in 50 mL of sterile water. After complete dissolution, filter it with a 0.22-μm filter membrane, aliquot it into ep tubes, and store it at -20 °C.
[0038] 50 mg / mL kanamycin sulfate: Weigh 2.5 g of kanamycin sulfate and dissolve it in 50 mL of sterile water. After complete dissolution, filter it with a 0.22-μm filter membrane, aliquot it into ep tubes, and store it at -20 °C.
[0039] 120 mg / mL IPTG: Weigh 6 g of IPTG and dissolve it in 50 mL of sterile water. After complete dissolution, filter it with a 0.22-μm filter membrane, aliquot it into ep tubes, and store it at -20 °C.
[0040] The test materials and test instruments used in the embodiments of the present invention:
[0041] 1. Test materials
[0042] The Escherichia coli E. coli BL21(DE3) strain carrying the plasmid Pet-28a(+) with the target gene of reductase was purchased from Beijing Tsingke Biotechnology Co., Ltd.; the competent cells of E. coli DH5α and E. coli BL21(DE3) were prepared and stored in our laboratory; SurePAGE TM The precast protein gel and protein marker were purchased from GenScript Biotech Corporation in China.
[0043] Dipotassium hydrogen phosphate anhydrous, Potassium dihydrogen phosphate anhydrous, methanol for chromatography, acetonitrile for chromatography, and methylamine were purchased from Sinopharm Chemical Reagent Co., Ltd., yeast extract and peptone were purchased from Thermo Fisher Scientific Co., Ltd., Tris base, concentrated hydrochloric acid, sodium dodecyl sulfate, bromophenol blue, glycerol, 2-mercaptoethanol, absolute ethanol, glacial acetic acid, Coomassie Brilliant Blue, phosphoric acid, glycine, and 20% SDS were purchased from Saiguo Biotechnology Co., Ltd.
[0044] Kanamycin was purchased from Shanghai Merck Chemical Technology Co., Ltd., ampicillin, NADH, and NADPH were purchased from Shanghai Titan Scientific Co., Ltd., isopropyl β-D-thiogalactopyranoside (IPTG) was purchased from Shanghai Aladdin Biochemical Technology Co., Ltd., and dimethyl sulfoxide (DMSO) was purchased from Shanghai Macklin Biochemical Co., Ltd.
[0045] Nucleic acid Marker and nucleic acid dye were purchased from Tsingke Biotechnology Co., Ltd.
[0046] Preparation of competent cells: The E. coli BL21(DE3) strain preserved in a glycerol tube was obtained from an -80°C refrigerator, streaked on an antibiotic-free LB plate, and cultured at 37°C for 10 h to obtain single colonies; a single colony from the LB plate was picked and inoculated into a test tube containing 10 mL of LB medium, and cultured at 37°C and 180 rpm for 9 h; 2 mL of the bacterial solution was taken from the test tube and inoculated into 100 mL of LB medium, and cultured at 37°C and 180 rpm until the OD600 reached 0.4 - 0.6; the bacterial solution was pre-cooled on ice, transferred to a sterilized centrifuge tube, placed on ice for 10 min, and centrifuged at 4°C and 5000 rpm for 10 min; the supernatant was poured out, and the precipitated cells were resuspended with 0.1 mol / L CaCl2 aqueous solution pre-cooled at 4°C and placed on ice for 30 min; centrifuged at 4°C and 5000 rpm for 10 min, the supernatant was discarded, and the precipitated cells were resuspended with 0.1 mol / L CaCl2 aqueous solution containing 15% glycerol pre-cooled at 4°C. 100 μL of the resuspended cells were aliquoted into sterilized 1.5 mL centrifuge tubes and stored in an -80°C refrigerator, and taken out when needed.
[0047] 2. Test instruments
[0048] Table 1 Test instruments
[0049]
[0050]
[0051] In the following examples, the method for determining the conversion activity of the reductive amination enzyme for catalyzing C4″-carbonyl-C5″-hydroxy-avermectin is as follows:
[0052] The assay system is as follows: The total reaction system is 1 mL, including 250 μL of potassium phosphate buffer, 200 μL of 20 mM methylamine, 200 μL of 10 mM NADPH, 50 μL of 1 M glucose, 50 μL of 2 g / L GDH, 50 μL of 20 mM C4″-carbonyl-C5″-hydroxy-avermectin dissolved in 5% (v / v) DMSO, and 200 μL of the supernatant obtained by centrifuging the wet bacterial cells after disruption. The reaction is carried out at 30 °C and 800 rpm for 72 h. The reaction solution is extracted with ethyl acetate, and the extract is dried in a fume hood and then redissolved with pure acetonitrile and made up to 1 mL; then it is filtered through a 0.22 μm microporous nylon membrane to obtain the test sample solution, and the content is calculated according to the standard curve.
[0053] In the following examples, the method for determining the standard curve of emamectin methylamine is as follows:
[0054] Prepare the emamectin methylamine standard solution: Weigh 0.88 g and dissolve it in 60 mL of 50% acetonitrile (acetonitrile: water = 1:1). After dissolving in a clean beaker, transfer it to a volumetric flask. Rinse the beaker three times with 20 mL of 50% acetonitrile and transfer all to the volumetric flask with a glass rod, and then make up to 100 mL. Cover the lid and shake well to obtain a 10 mM emamectin methylamine standard sample solution; then use the standard solution to prepare 1 mM, 0.8 mM, 0.5 mM, and 0.1 mM emamectin methylamine sample solutions for making the standard curve.
[0055] In the following examples, the method for detecting the content of emamectin methylamine is as follows:
[0056] Detect using HPLC, and the detection conditions are as follows: Thermo Fisher U3000 liquid chromatograph; C18 chromatographic column (4.6 mm × 250 mm); column temperature: 30 °C; mobile phase acetonitrile: water (0 - 30 min, 50% acetonitrile - 100% acetonitrile; 30 - 40 min, 100% acetonitrile - 50% acetonitrile); flow rate: 1.2 mL / min; detection wavelength: 243 nm; injection volume: 10 μL. Measure the peak area of the test sample solution at the corresponding time of the peak of emamectin methylamine in the standard sample solution, and then substitute it into the emamectin methylamine standard curve to calculate the concentration of emamectin methylamine produced by catalysis.
[0057] In the following examples, the calculation method of the conversion rate: (initial molar concentration of the substrate - remaining molar concentration of the substrate) / initial molar concentration of the substrate.
[0058] In the following examples, the yield calculation method is: molar concentration of the generated product / initial molar concentration of the substrate.
[0059] In the following examples, the amino acid sequence of the wild-type reductive amination enzyme is shown in SEQ ID NO.1, and the coding sequence is shown in SEQ ID NO.2.
[0060] SEQ ID NO.1:
[0061] MSKHIGIFGLGAMGTALAAKYLEHGYKTSVWNRTTAKAIPLVEQGAKLASTISEGVNANDLIIICLLNNQVVEDALRDALQTLPSKTIVNLTNGTPNQARKLADFVTSHGARYIHGGIMAVPTMIGSPHAVLLYSGESLELFQSIESHLSLLGMSKYLGTDAGSASLHDLALLSGMYGLFSGFLHAVALIKSGQDTSTTATGLLPLLTPWLSAMTGYLSSIAKQIDDGDYATQGSNLGMQLAGVENIIRAGEEQRVSSQMILPIKALIEQAVGEGHGGEDLSALIEYFKVGKNVD.
[0062] SEQ ID NO.2:
[0063] atgagcaaacatattggcatttttggcctgggcgcgatgggcaccgcgctggcggcgaaatatctggaacatggctataaaaccagcgtgtggaaccgcaccaccgcgaaagcgattccgctggtggaacagggcgcgaaactggcgagcaccattagcgaaggcgtgaacgcgaacgatctgattattatttgcctgctgaacaaccaggtggtggaagatgcgctgcgcgatgcgctgcagaccctgccgagcaaaaccattgtgaacctgaccaacggcaccccgaaccaggcgcgcaaactggcggattttgtgaccagccatggcgcgcgctatattcatggcggcattatggcggtgccgaccatgattggcagcccgcatgcggtgctgctgtatagcggcgaaagcctggaactgtttcagagcattgaaagccatctgagcctgctgggcatgagcaaatatctgggcaccgatgcgggcagcgcgagcctgcatgatctggcgctgctgagcggcatgtatggcctgtttagcggctttctgcatgcggtggcgctgattaaaagcggccaggataccagcaccaccgcgaccggcctgctgccgctgctgaccccgtggctgagcgcgatgaccggctatctgagcagcattgcgaaacagattgatgatggcgattatgcgacccagggcagcaacctgggcatgcagctggcgggcgtggaaaacattattcgcgcgggcgaagaacagcgcgtgagcagccagatgattctgccgattaaagcgctgattgaacaggcggtgggcgaaggccatggcggcgaagatctgagcgcgctgattgaatattttaaagtgggcaaaaacgtggat。
[0064] Screening of wild-type reductive amination enzyme in Example 1
[0065] Through literature retrieval and multiple sequence alignment, the sources and gene sequence-related information of reductive aminase (RedAm) were consulted; the gene sequences or amino acid sequences of reductive aminase from different sources were queried through the gene database (https: / / www.ncbi.nlm.nih.gov / genome / ), and the reductive aminase AspRedAm derived from Aspergillus oryzae was screened out. It was optimized according to the codon preference of Escherichia coli, and NcoI restriction site, HidIII restriction site, His tag and terminator were introduced into the sequence published in GenBank, and then synthesized by Hangzhou Qingke Biotechnology Co., Ltd. to obtain the wild-type reductive aminase gene (the amino acid sequence is shown in SEQ ID NO.1).
[0066] Example 2 Construction and expression of wild-type reductive aminase recombinant engineering bacteria
[0067] The wild-type reductive aminase AspRedAm gene fragment obtained in Example 1 was ligated with the plasmid pET-28a(+), and the recombinant plasmid was constructed. Then, the recombinant plasmid was transformed into E. coli BL21(DE3) competent cells to construct wild-type recombinant engineering bacteria. The transformation steps were as follows: The E. coli BL21(DE3) competent cells were placed on ice, 2 μL of the recombinant plasmid was added, and they were placed on ice for 30 min, heat-shocked in a 42 °C water bath for 45 s, incubated on ice for 5 min, then added with LB liquid medium without antibiotics, cultured at 37 °C for 45 - 60 min, and then centrifuged at 4500 rpm for 5 min, and 600 μL of the supernatant was discarded. The remaining bacteria were gently pipetted and mixed evenly, then pipetted and spread on the plate with the correct resistance. Pour 5 - 10 glass beads on the plate and gently shake until there is no bacterial liquid on the plate. Pour the glass beads into pure alcohol, and the plate was placed in an inverted position in a 37 °C incubator for 12 - 16 h. After colonies grew on the overnight culture plate, a single colony was picked and inoculated into LB liquid medium containing 50 mg / mL kanamycin, cultured at 180 rpm and 37 °C for 8 - 12 h, then sent to Hangzhou Qingke Biotechnology Co., Ltd. for sequencing. Using software for alignment, the bacterial liquid of the successfully sequenced wild-type recombinant engineering bacteria E. coli BL21(DE3)-pET-28a-AspRedAm was mixed with 30% glycerol at a ratio of 1:1 and stored in a -80 °C refrigerator.
[0068] The successfully constructed engineering bacteria were inoculated into LB liquid medium, and cultured in a 37 °C shaker at 180 rpm for 2 - 3 h. When the cell density OD 600 value reached 0.6, IPTG was added, and then the flask was transferred to a 28 °C shaker and continued to be cultured at 180 rpm for 12 h. After the culture was completed, the culture solution was centrifuged at 8000 rpm for 10 min, the supernatant was discarded, and the wet bacteria were collected for subsequent experiments.
[0069] Example 3 Screening of reductase mutants and construction of engineered bacteria
[0070] 1. Acquisition of reductase template gene
[0071] The recombinant E. coli BL21 (DE3)-pET28a-AspRedAm engineering bacteria were streaked and inoculated in a medium containing 50 mg·L -1 The culture was carried out at 37℃ for 12h in LB solid medium containing kanamycin. A single colony was picked and inoculated into a medium containing 50mg·L -1 In LB liquid medium containing kanamycin, culture at 180 rpm / min and 37°C for 8-12 hours. Extract the recombinant engineering bacteria plasmid according to the kit.
[0072] 2. Site-directed mutagenesis of the reductase gene
[0073] According to the gene sequence of the reductase AspRedAm from Aspergillus oryzae included in Genbank, mutation primers for site-directed mutagenesis were designed. The plasmid extracted in step 1 of this example was used as the original template for site-directed mutagenesis using rapid PCR technology. The primers in Table 2 were used for PCR amplification. After completion, the bands were compared by nucleic acid gel electrophoresis. The correct PCR product was added with 1.5 uL Dpn1 and digested in a shaker at 37°C for more than 2 hours.
[0074] First round of mutation: The amino acid residues within 6 angstroms around the substrate C4"carbonyl-C5"hydroxyl-avermectin were mutated to alanine.
[0075] PCR reaction system (total reaction system is 50 μL): 2×Phanta max Buffer 25 μL, 10 mM dNTPmixture (2.5 mM each of dATP, dCTP, dGTP and dTTP) 1 μL, Phanta Max Super-FIDelity DNA Polymerase 0.5 μL, 2 μL each of upstream and downstream primers with a concentration of 50 μM (as shown in Table 2), 1 μL of separate recombinant template pET-28a-AspRedAm, and 18.5 μL of ddH2O.
[0076] PCR reaction conditions: pre-denaturation at 95°C for 5 min, denaturation at 95°C for 30 s, annealing at 62°C for 30 s, extension at 72°C for 5 min, for a total of 30 cycles, and final extension at 72°C for 10 min.
[0077] Construction of genetically engineered bacteria:
[0078] Take 10 μL of the PCR product and add it to 100 μL of Escherichia coli BL21(DE3) competent cells. Place it on ice for 30 min, heat shock it in a 42 °C water bath for 45 s, incubate it on ice for 4 min, add 600 μL of LB liquid medium, culture it at 37 °C for 45 - 60 min, centrifuge and discard 600 μL of the supernatant, and then spread it on an LB solid medium plate containing 50 mg·L -1 kanamycin, and culture it at 37 °C for 12 h. Pick a single colony and inoculate it into an LB liquid medium containing 50 mg·L -1 kanamycin resistance, culture it at 180 rpm / min and 37 °C for 8 - 12 h, send it to Hangzhou Qingke Biotechnology Co., Ltd. for sequencing, use software to compare the successfully sequenced mutants, and extract the recombinant mutant plasmid using a kit.
[0079] After that, transform the mutant plasmid with correct sequencing into 100 μL of Escherichia coli BL21(DE3) competent cells. Except for the final spreading on an LB solid medium plate containing 50 mg·L -1 kanamycin resistance, the remaining steps are the same as the above transformation steps.
[0080] After colonies grow on the overnight plate, pick a single colony and inoculate it into an LB liquid medium containing 50 mg·L -1 kanamycin, culture it at 180 rpm / min and 37 °C for 8 - 12 h, and then transfer it to an LB liquid medium containing 50 mg·L -1 kanamycin resistance at an inoculum volume concentration of 2%. Shake-flask culture it at 37 °C and 180 rpm / min until the OD value reaches 0.6 - 0.8, add IPTG with a final concentration of 24 mg·L -1 , induce expression at 20 °C and 180 rpm / min for 24 h, centrifuge the bacterial solution at 8000 rpm for 10 min, and collect the wet bacterial cells.
[0081] Take the wet bacterial cells prepared in Example 2 and the above operations of this example, dissolve them in 5 mL of phosphate buffer with a concentration of 0.5 g / L and a pH of 7.4. The total reaction system is 1 mL, and the system includes 250 μL of potassium phosphate buffer, 200 μL of 20 mM methylamine, 200 μL of 10 mM NADPH, 50 μL of 1 M glucose, 50 μL of 2 g / L GDH, 50 μL of 20 mM C4"-carbonyl-C5"-hydroxy-avermectin dissolved in 5% (v / v) DMSO, 200 μL of the supernatant obtained by crushing and centrifuging the wet bacterial cells. Then react at 30 °C and 800 rpm for 72 h. Extract the reaction solution with ethyl acetate, dry the extract in a fume hood, and then redissolve it with pure acetonitrile and make the volume up to 1 mL; then filter it through a 0.22 μm microporous nylon membrane to obtain the test sample solution, and inject 10 μL of it into a high-performance liquid chromatograph for analysis.
[0082] The yields of wild-type WT and the constructed mutants L173A, S174A, Y177A, G178A, G182A, H185A, I225A, D226A, M260A, I261A, I264A, F288A in catalyzing C4"-carbonyl-C5"-hydroxy-avermectin were 3%, 13.2%, 12.1%, 57.4%, 7.4%, 6.5%, 28.3%, 55.8%, 20.6%, 17.8%, 22.3%, 23.5%, 18.3% respectively. Among them, the yields of Y177A and I225A were nearly 19.1 and 18.6 times higher than that of the wild type respectively.
[0083] Table 2 Primers related to alanine scanning PCR
[0084]
[0085]
[0086] Second-round mutation: The sites Y177 and I225 with a significant increase in the first-round alanine mutation were subjected to saturation mutation, and the obtained mutants were Y177D, Y177S, Y177K, Y177F, I225V, I225R, I225G, I225P, I225W. Their yields were 22.6%, 35.8%, 26.9%, 63.2%, 42.1%, 18.6%, 37.3%, 53.2%, 50.1% respectively. The best mutant at the Y177 site was Y177F, and its yield was increased by about 21 times compared with the wild type.
[0087] Third-round mutation: Using the primers shown in Table 3, with the mutant Y177F as the template, the following combined mutations were carried out using the same mutation method as the first round: Y177F / I225V, Y177F / I225R, Y177F / I225G, Y177F / I225P, Y177F / I225W. The calculated yields were 5.1%, 11.2%, 56.6%, 65.2%, 67.9% respectively. The optimal mutant Y177F / I225W had a yield increased by 41.5 times compared with the wild type.
[0088] Table 3 Primers related to combined mutation PCR
[0089] N225V-FW ATCGCGAAACAGGTTGACGACGGTGAT N225V-RV CTGTTTCGCGATAGAGCTCAGGTAACC N225R-FW ATCGCGAAACAGCGTGACGACGGTGAT N225R-RV CTGTTTCGCGATAGAGCTCAGGTAACC N225G-FW ATCGCGAAACAGGGTGACGACGGTGAT N225G-RV CTGTTTCGCGATAGAGCTCAGGTAACC N225P-FW ATCGCGAAACAGCCGGACGACGGTGAT N225P-RV CTGTTTCGCGATAGAGCTCAGGTAACC N225W-FW ATCGCGAAACAGTGGGACGACGGTGAT N225W-RV CTGTTTCGCGATAGAGCTCAGGTAACC
[0090] Example 4 Transformation of C4"-carbonyl-C5"-hydroxy-avermectin into emamectin benzoate by AspRedAm mutant (Y177F)
[0091] The mutant Y177F wet cells were prepared by the method in Example 3. 0.5 g / L of wet cells were dissolved in 5 mL of phosphate buffer with a pH of 7.4 and shaken well to dissolve. Under ice bath conditions, ultrasonic cell disruption was carried out. The power of the ultrasonic cell disruptor was set at 100 W, working for 1 s and with an interval of 2 s, and the total disruption time was 10 min. Subsequently, the cell disruption solution was centrifuged at 12,000 rmp and 4 °C for 15 min to remove cell debris, and the supernatant was collected. The total reaction system was 1 mL, and the system included 250 μL of potassium phosphate buffer, 200 μL of 20 mM methylamine, 200 μL of 10 mM NADPH, 50 μL of 1 M glucose, 50 μL of 2 g / L GDH, 50 μL of 20 mM C4"-carbonyl-C5"-hydroxy-avermectin dissolved in 5% (v / v) DMSO, and 200 μL of the supernatant obtained by disrupting and centrifuging the wet cells. Then, the reaction was carried out at 30 °C and 800 rpm for 72 h. The reaction solution was extracted with ethyl acetate, the extract was dried in a fume hood, and then redissolved with pure acetonitrile and made up to 1 mL; then it was filtered through a 0.22 μm microporous nylon membrane to obtain the test sample solution, and 10 μL of the sample was injected into a high-performance liquid chromatograph for analysis. The conversion rate of the reductase mutant Y177F in phosphate buffer was calculated to be 81.8%.
[0092] Example 5: Conversion of C4"-carbonyl-C5"-hydroxy-avermectin to emamectin benzoate by AspRedAm mutant (I225W)
[0093] The mutant wet cells were prepared by the method in Example 3. 0.5 g / L of wet cells were dissolved in 5 mL of potassium phosphate buffer with a pH of 7.4 and shaken well to dissolve. Under ice bath conditions, ultrasonic cell disruption was carried out. The power of the ultrasonic cell disruptor was set at 100 W, working for 1 s and with an interval of 2 s, and the total disruption time was 10 min. Subsequently, the cell disruption solution was centrifuged at 12,000 rmp and 4 °C for 15 min to remove cell debris, and the supernatant was collected. The total reaction system was 1 mL, and the system included 250 μL of potassium phosphate buffer, 200 μL of 20 mM methylamine, 200 μL of 10 mM NADPH, 50 μL of 1 M glucose, 50 μL of 2 g / L GDH, 50 μL of 20 mM C4"-carbonyl-C5"-hydroxy-avermectin dissolved in 5% (v / v) DMSO, and 200 μL of the supernatant obtained by disrupting and centrifuging the wet cells. Then, the reaction was carried out at 30 °C and 800 rpm for 72 h. The reaction solution was extracted with ethyl acetate, the extract was dried in a fume hood, and then redissolved with pure acetonitrile and made up to 1 mL; then it was filtered through a 0.22 μm microporous nylon membrane to obtain the test sample solution, and 10 μL of the sample was injected into a high-performance liquid chromatograph for analysis. The conversion rate of the reductase mutant I225W in potassium phosphate buffer with a pH of 7.4 was calculated to be 75.2%.
[0094] Example 6 Transformation of C4" carbonyl-C5" hydroxy-avermectin to emamectin benzoate by AspRedAm mutant (Y177F / I225W)
[0095] The wet cells of mutant Y177F / I225W were prepared by the method in Example 3. 100 mL of potassium phosphate buffer with a pH of 7.4 was prepared. 0.5 g / L of wet cells was dissolved in 5 mL of potassium phosphate buffer, and the solution was shaken well to dissolve. Under ice bath conditions, ultrasonic cell disruption was carried out. The power of the ultrasonic cell disruptor was set at 100 W, working for 1 s and intervals of 2 s, and the total disruption time was 10 min. Subsequently, the cell disruption solution was centrifuged at 12,000 rmp and 4 °C for 15 min to remove cell debris, and the supernatant was collected. The total reaction system was 1 mL, and the system included 250 μL of potassium phosphate buffer, 200 μL of 20 mM methylamine, 200 μL of 10 mM NADPH, 50 μL of 1 M glucose, 50 μL of 2 g / L GDH, 50 μL of 20 mM C4" carbonyl-C5" hydroxy-avermectin dissolved in 5% (v / v) DMSO, and 200 μL of the supernatant obtained by disrupting and centrifuging the wet cells. Then, the reaction was carried out at 30 °C and 800 rpm for 72 h. The reaction solution was extracted with ethyl acetate, and the extract was dried in a fume hood and then redissolved with pure acetonitrile and made up to 1 mL; then it was filtered through a 0.22 μm microporous nylon membrane to obtain the test sample solution, and 10 μL of the test sample solution was injected into a high-performance liquid chromatography for analysis. The conversion rate of the reductase mutant Y177F / I225W in potassium phosphate buffer was calculated to be 84.8%.
[0096] Example 7 Enhancement of the expression effect of reductase mutants
[0097] Using high-throughput screening technology, the expression effects of different promoters on the target gene in host cells were used to evaluate their effects on the expression level of reductase. The screening indicators included enzyme activity, the content of the target protein, expression stability, etc. A strong promoter with a good expression effect on reductase was screened from the in-house promoter library of this laboratory, and a suitable terminator matching the strong promoter was further screened. By testing the effects of different terminators on the transcription process, a sequence that could effectively terminate transcription and minimize any spurious expression in the late stage of transcription was selected. Finally, the optimal combination of promoter and terminator was screened.
[0098] First, primers were designed using the site-directed mutagenesis method, and the promoter and terminator were fused with the reductive amination enzyme gene through the rapid PCR technique. The primers used are shown in Table 4. The fused gene sequence was cloned onto the pET-28a(+) plasmid using the one-step cloning method to construct the expression vector pET28a-P-AspRedAm-T, which was then transformed into the host cell Escherichia coli BL21(DE3) by the chemical transformation method to obtain the recombinant strain E. coli BL21(DE3)-pET28a-P-AspRedAm-T. Subsequently, the effects of each pair of promoter and terminator were evaluated by detecting the activity of the target enzyme and its expression level in the cells.
[0099] Table 4 Primers for Fusing Promoter and Terminator
[0100] Pro1-FW atacgagtgactatagggTCCAAGCACATCGGTATCTTCG Pro1-RV ccctatagtcactcgtattaGTATATCTCCTTCTTAAAGTTAAACAAA Ter1-FW ggactgcaggaggagcagTAACAAAGCCCGAAAGGAAGC Ter1-RV ctgctcctcctgcagtccGTCAACGTTTTTACCCACCTTGA Pro2-FW ttaaccctcactaaagggTCCAAGCACATCGGTATCTTCG Pro2-RV ccctttagtgagggttaattGTATATCTCCTTCTTAAAGTTAAACAAA Ter2-FW tagttattgctcagcggtTAACAAAGCCCGAAAGGAAGC Ter2-RV ccgctgagcaataactagGTCAACGTTTTTACCCACCTTGA
[0101] The preferred promoters and terminators are as follows:
[0102] Promoter1: 5'-TAATACGAGTGACTATAGGG-3' (SEQ ID NO.45);
[0103] Terminator1: 5'-GGACTGCAGGAGGAGCAG-3' (SEQ ID NO.46);
[0104] Promoter 2: 5'-AATTAACCCTCACTAAAGGG-3' (SEQ ID NO.47);
[0105] Terminator 2: 5'-CTAGTTATTGCTCAGCGGT-3' (SEQ ID NO.48).
[0106] The above preferred promoters and terminators were randomly combined to obtain P1T1, P1T2, P2T1, and P2T2, and their enzyme gene expression levels were increased by 43%, 22%, 10%, and 29% respectively. The optimal combination of promoter and terminator is P1T1.
[0107] Example 8 Synthesis of Emamectin from C4" Carbonyl-C5" Hydroxy-Avermectin by Transforming Synthetic Cells of AspRedAm Wild-Type and Mutants Containing the Screened Promoter and Terminator
[0108] Prepare synthetic cell wet thalli using the methods in Example 3 and Example 7. Prepare 100 mL of potassium phosphate buffer with a pH of 7.4. Dissolve 0.5 g / L of wet thalli in 5 mL of potassium phosphate buffer, shake well to dissolve, and under ice bath conditions, perform ultrasonic cell disruption. Set the power of the ultrasonic cell disruptor to 100 W, work for 1 s, with an interval of 2 s, and the total disruption time is 10 min. Subsequently, centrifuge the cell disruption solution at 12,000 rmp and 4 °C for 15 min to remove cell debris and collect the supernatant. The total reaction system is 1 mL, and the system includes 250 μL of potassium phosphate buffer, 200 μL of 20 mM methylamine, 200 μL of 10 mM NADPH, 50 μL of 1 M glucose, 50 μL of 2 g / L GDH, 50 μL of 20 mM C4″-carbonyl-C5″-hydroxy-avermectin dissolved in 5% (v / v) DMSO, 200 μL of the supernatant obtained by disrupting and centrifuging the wet thalli. Then, react at 30 °C and 800 rpm for 72 h. Extract the reaction solution with ethyl acetate, dry the extract in a fume hood, and then redissolve it with pure acetonitrile and make up the volume to 1 mL. Then, filter it through a 0.22 μm microporous nylon membrane to obtain the test sample solution, inject 10 μL into a high-performance liquid chromatograph for analysis, and calculate that the conversion rates of the wild type containing P1T1, mutant Y177F, mutant I225W, and combined mutant Y177F / I225W are 40%, 85.4%, 80.8%, 88.3%, and 90.6% respectively.
Claims
1. A reductive amination enzyme mutant, characterized in that, The reductive amination enzyme mutant is obtained by single-point or multi-point mutation at positions 177 and 225 of the sequence shown in SEQ ID NO.
1.
2. The reductive amination enzyme mutant according to claim 1, wherein The reductive amination enzyme mutant is obtained by mutating the amino acid sequence shown in SEQ ID NO.1 according to one of the following mutation forms: (1) Tyrosine at position 177 is mutated to alanine or phenylalanine; (2) Isoleucine at position 225 is mutated to alanine, proline or tryptophan; (3) Tyrosine at position 177 is mutated to phenylalanine, and isoleucine at position 225 is mutated to proline, tryptophan or glycine.
3. The coding gene of the reductive amination enzyme mutant according to claim 1.
4. A gene combination, characterized in that, The gene combination includes the coding gene according to claim 3 and the promoter and terminator of the coding gene; the nucleotide sequence of the promoter is shown in SEQ ID NO.45, and the nucleotide sequence of the terminator is shown in SEQ ID NO.
46.
5. A recombinant vector, characterized in that, The recombinant vector contains the coding gene according to claim 3 or the gene combination according to claim 4.
6. A genetically engineered bacterium, characterized in that, The genetically engineered bacterium contains the coding gene according to claim 3 or the gene combination according to claim 4.
7. The application of the reductive amination enzyme mutant according to any one of claims 1 or 2, or the coding gene according to claim 3, or the gene combination according to claim 4, or the recombinant vector according to claim 5, or the genetically engineered bacterium according to claim 6 in catalyzing the synthesis of emamectin benzoate intermediate 4″-keto-5″-hydroxy-avermectin to methylamino avermectin.
8. A method for producing emamectin methylamino, characterized in that, Using 4″-keto-5″-hydroxy-avermectin as the substrate and the reductive amination enzyme mutant according to any one of claims 1 or 2 as the catalyst to form a reaction system for synthesizing methylamino avermectin.
9. A method for preparing a genetically engineered bacterium with high expression of reductive amination enzyme, characterized in that, It includes the following steps: (1) Fusing the promoter and terminator with the gene of the reductive amination enzyme or its mutant; (2) Constructing an expression vector containing the fusion gene obtained in step (1); (3) Transforming the constructed expression vector into a host cell; The amino acid sequence of the reductive amination enzyme is shown in SEQ ID NO.1, and the mutant is the reductive amination enzyme mutant according to claim 1 or claim 2.
10. The preparation method according to claim 9, wherein The host cell is Escherichia coli.