Application of NdmB-containing mutant for efficiently producing paraxanthine and engineering strain
By genetically transforming E. coli BW25113, the Q289 site of caffeine N3 demethylase was optimized, and the problem of low paraxanthine production efficiency in the existing technology was solved, and the effect of efficient and green production of paraxanthine was achieved, and the yield and conversion rate reached the highest level at home and abroad.
Patent Information
- Application Number
- CN202510515090.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-23
- Publication Date
- 2025-07-25
AI Technical Summary
The existing chemical synthesis methods are harsh, expensive, and produce a large amount of pollutants. The conversion rate and yield of paraxanthine in biocatalytic methods are low, making it difficult to meet the needs of green and sustainable production and industrial applications.
By genetically engineering E. coli BW25113, expressing caffeine demethylase and formaldehyde dehydrogenase, using arabinose-induced promoter to regulate the reductase of caffeine demethylase, and induced by IPTG to regulate the optimized caffeine N3 demethylases NdmBQ289T, NdmBQ289S, NdmBQ289A or NdmBQ289G after initiation of LacO, the Q289 site mutants were optimized to improve the production efficiency of paraxanthine.
It has achieved efficient production of paraxanthine, with output reaching 6.29g/L, caffeine conversion rate reaching more than 95%, and a small by-product content, which has significantly improved the industrial application potential of paraxanthine.
Smart Images

Figure CN120366250A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the application of an NdmB mutant and an engineered strain for the efficient production of paraxanthine. Background Art
[0002] Paraxanthine (1,7-dimethylxanthine, PX), a major metabolite of caffeine, is extremely rare and difficult to be found in nature. As a special methylxanthine, paraxanthine has unique physiological functions and pharmacological properties in organisms. Studies have shown that paraxanthine can significantly promote fat breakdown, enhance metabolic rate, and also play a significant role in improving mental state. Compared with other xanthine compounds (such as caffeine), paraxanthine has lower toxicity and higher metabolic efficiency, thus becoming a compound that has attracted much attention in the fields of drug development and health products. In addition, through the specific interaction with adenosine receptors, paraxanthine may have a protective effect on neurons, providing potential possibilities for the treatment of neurodegenerative diseases (such as Parkinson's disease).
[0003] Currently, the production of paraxanthine mainly relies on two methods: chemical synthesis and biocatalysis. However, these methods have significant technical bottlenecks. Chemical synthesis methods usually require harsh conditions such as high temperature and high pressure, which are not only costly but also accompanied by the generation of a large amount of pollutants, making it difficult to meet the requirements of green and sustainable production. The biocatalytic approach relies on the catalytic action of caffeine N3-demethylase (NdmB), but due to the limited substrate specificity and catalytic efficiency of natural enzymes, the conversion rate and yield of paraxanthine in existing production systems are still low. In addition, by-products such as 7-methylxanthine and xanthine are often generated during the biocatalytic process. The accumulation of these by-products not only reduces the purity of the target product but also increases the cost of subsequent separation and purification, further limiting the large-scale industrial application of paraxanthine. Summary of the Invention
[0004] The purpose of the present invention is to solve the problems of harsh conditions, high cost, and generation of a large amount of pollutants in current chemical synthesis methods, as well as the low conversion rate and yield of paraxanthine in biocatalytic methods, and to provide the application of an NdmB mutant and an engineered strain for the efficient production of paraxanthine.
[0005] Application of an NdmB mutant for the efficient production of paraxanthine, wherein the NdmB mutant is used for the efficient production of paraxanthine, and the NdmB mutant is NdmB Q289T 、NdmB Q289S 、NdmB Q289A or NdmB Q289G ;
[0006] The NdmB Q289TThe amino acid sequence is shown in SEQ ID NO.1 in the sequence listing, and the nucleotide sequence is shown in SEQ ID NO.2 in the sequence listing;
[0007] The NdmB described above Q289S The amino acid sequence is shown in SEQ ID NO.3 in the sequence listing, and the nucleotide sequence is shown in SEQ ID NO.4 in the sequence listing;
[0008] The NdmB described above Q289A The amino acid sequence is shown in SEQ ID NO.5 in the sequence listing, and the nucleotide sequence is shown in SEQ ID NO.6 in the sequence listing;
[0009] The NdmB described above Q289G The amino acid sequence is shown in SEQ ID NO.7 in the sequence listing, and the nucleotide sequence is shown in SEQ ID NO.8 in the sequence listing.
[0010] An engineered strain carrying an NdmB mutant for highly efficient production of paraxanthine.
[0011] Principle of the present invention:
[0012] The present invention uses Escherichia coli BW25113 as the starting strain to express caffeine demethylase, formaldehyde dehydrogenase and formate dehydrogenase, and the genotype is modified as follows: the reductase NdmDt of the modified caffeine demethylase is regulated and expressed by the arabinose-inducible promoter pBAD, and the site-modified methylxanthine N3-demethylase NdmB is regulated and expressed by the p100 promoter after IPTG induction to start LacO Q289T NdmB Q289S NdmB Q289A or NdmB Q289G .
[0013] The present invention uses Escherichia coli BW25113 as the starting strain to achieve high-efficiency expression of caffeine demethylase and coenzyme metabolic enzymes through genetic modification. Specifically, the present invention uses the arabinose-inducible promoter pBAD to regulate and express the reductase NdmDt of the modified caffeine demethylase, and at the same time, the site-optimized caffeine N3-demethylase NdmB is regulated and expressed by the p100 promoter after IPTG induction to start LacO Q289T NdmB Q289S NdmB Q289A or NdmB Q289G .
[0014] Through the mutation analysis of the Q289 site, four NdmB mutants with clear functions were obtained. NdmB Q289T efficiently catalyzes caffeine to produce paraxanthine (hardly producing 7-methylxanthine), while NdmBQ289S , NdmB Q289A , NdmB Q289G can respectively regulate the proportion of further generation of 7-methylxanthine from paraxanthine according to different mutation degrees. Through the optimization of binding sites and the efficient screening of whole-cell biosensors, the present invention significantly improves the production efficiency of paraxanthine, providing technical support for the high-efficiency production and industrial application of paraxanthine.
[0015] Advantages of the present invention:
[0016] (1) The present invention discovers and optimizes the Q289 site of NdmB, and the obtained NdmB Q289T , NdmB Q289S , NdmB Q289A and NdmB Q289G mutants achieve the high-efficiency production of paraxanthine and can flexibly regulate the generation proportion of 7-methylxanthine according to requirements. Among them, the conversion efficiency of NdmB Q289T to caffeine reaches more than 95%, and the generated paraxanthine contains almost no 7-methylxanthine.
[0017] (2) Through the optimization of the whole-cell conversion process and fermentation conditions, the present invention realizes the high-efficiency production of paraxanthine, with the yield reaching 6.29 g / L, which is the highest level of synthesizing paraxanthine at home and abroad at present, and further enhances the industrial application potential of caffeine N3-demethylase.
[0018] The present invention can obtain applications and engineering strains with NdmB mutants for the high-efficiency production of paraxanthine. Description of the drawings
[0019] Figure 1 represents the molecular dynamics simulation conformational diagram of NdmB and caffeine; the relative positions of the protein and the ligand and the position of Q289 are shown in the figure;
[0020] Figure 2 represents the comparison diagram of the effects of the wild type of NdmB and its four mutants at the 289 site on degrading caffeine in the present invention;
[0021] Figure 3 represents the recombinant vector with NdmB Q289T provided in the present invention and can be used to construct a high-yield paraxanthine strain;
[0022] Figure 4 represents the yield change diagram of paraxanthine and other methylxanthines over time for BW / pYB1s-ndmDtB Q289T in the present invention. Detailed implementation manners
[0023] Embodiment 1: Application of NdmB mutant for highly efficient production of paraxanthine. The NdmB mutant is used for highly efficient production of paraxanthine, and the NdmB mutant is NdmB Q289T 、NdmB Q289S 、NdmB Q289A or NdmB Q289G ;
[0024] The amino acid sequence of the NdmB Q289T is shown in Sequence Listing SEQ ID NO.1, and the nucleotide sequence is shown in Sequence Listing SEQ ID NO.2;
[0025] The amino acid sequence of the NdmB Q289S is shown in Sequence Listing SEQ ID NO.3, and the nucleotide sequence is shown in Sequence Listing SEQ ID NO.4;
[0026] The amino acid sequence of the NdmB Q289A is shown in Sequence Listing SEQ ID NO.5, and the nucleotide sequence is shown in Sequence Listing SEQ ID NO.6;
[0027] The amino acid sequence of the NdmB Q289G is shown in Sequence Listing SEQ ID NO.7, and the nucleotide sequence is shown in Sequence Listing SEQ ID NO.8.
[0028] Embodiment 2: The difference between this embodiment and Embodiment 1 is that the specific steps for the NdmB mutant to highly efficiently produce paraxanthine are as follows:
[0029] Step 1: Method for protein induction expression of engineering bacteria with high paraxanthine production:
[0030] Streak the engineering strain with the NdmB mutant on an LB plate and culture it at 37°C for 12 h; pick a single colony on the plate, inoculate it into a liquid LB medium, and culture it overnight with shaking at 37°C; inoculate the culture into an induction medium ZYM-5052 at an inoculation amount of 1% by volume, culture it with shaking at 37°C for 1.5 - 3 h until the cell growth reaches the logarithmic growth phase, add an inducer and transfer it to culture with shaking at 25°C for 18 h;
[0031] Step 2: Method for biotransformation to degrade caffeine to produce paraxanthine:
[0032] After induction, measure the cell concentration in the medium, take out the cells according to the demand, centrifuge at 4°C for 10 min, wash once with a buffer solution, discard the supernatant, resuspend in the transformation solution, and culture with shaking at 20°C for 18 h to complete the highly efficient production of paraxanthine.
[0033] The other steps are the same as those in the first specific implementation manner.
[0034] Specific implementation manner three: The difference between this implementation manner and the first or second specific implementation manner is that in step 1, single colonies on the plate are picked and inoculated into liquid LB medium, and cultured overnight with shaking at 200 rpm at 37°C; the inducer consists of 0.2% arabinose and 1 mM IPTG at the final concentration.
[0035] The other steps are the same as those in the first or second specific implementation manner.
[0036] Specific implementation manner four: The difference between this implementation manner and one of the first to third specific implementation manners is that in step 1, the culture is inoculated into the self-inducing medium ZYM-5052 at an inoculation amount of 1% by volume, and cultured with shaking at 200 rpm at 37°C for 1.5 - 3 h.
[0037] The other steps are the same as those in the first to third specific implementation manners.
[0038] Specific implementation manner five: The difference between this implementation manner and one of the first to fourth specific implementation manners is that in step 1, the LB plate consists of 1.5% agar by mass percentage concentration and streptomycin containing 50 μg / mL;
[0039] The liquid LB medium in step 1 consists of 10 g / L tryptone, 10 g / L sodium chloride, 5 g / L yeast extract, and 50 μg / mL streptomycin.
[0040] The other steps are the same as those in the first to fourth specific implementation manners.
[0041] Specific implementation manner six: The difference between this implementation manner and one of the first to fifth specific implementation manners is that in step 1, the induction medium ZYM-5052 consists of 100 mL of substance A, 2 mL of substance B, 2 mL of substance C, 200 μL of substance D, and 100 μL of substance E;
[0042] Substance A consists of 1% tryptone by mass fraction and 0.5% yeast powder by mass fraction; Substance B consists of 1.25 M Na2HPO4, 1.25 M KH2PO4, 2.5 M NH4Cl, and 0.25 M Na2SO4; Substance C consists of 25% glycerol by mass fraction, 2.5% glucose by mass fraction, 10% L-arabinose by mass fraction, and 50 mM IPTG; Substance D is 1 M MgSO4; The trace element substance E consists of 50 mM FeCl3, 20 mM CaCl2, 10 mM MnCl2, 10 mM ZnSO4, 2 mM CoCl2, 2 mM NiCl2, 2 mM Na2MoO4, 2 mM Na2SeO3, and 2 mM H3BO3.
[0043] The other steps are the same as those in the first to fifth specific embodiments.
[0044] Specific embodiment seven: The difference between this embodiment and any one of the first to sixth specific embodiments is that: the conversion solution described in step 2 is composed of 40 mM caffeine and 50 mM Tirs-HCl.
[0045] The other steps are the same as those in the first to sixth specific embodiments.
[0046] Specific embodiment eight: This embodiment includes the engineered strain with NdmB mutant for highly efficient production of paraxanthine.
[0047] Specific embodiment nine: The difference between this embodiment and specific embodiment eight is that: the construction method of the engineered strain is carried out according to the following steps:
[0048] Step S1: Construct a genetically engineered bacterium with ndmB;
[0049] Digest the vector pYB1s-GFP with XhoI and BglII double enzymes, and electrophoretically recover the 3500 bp fragment; use the Gibson ligation method to ligate the caffeine demethylase encoding gene ndmB and the ndmDt fragment to the vector pYB1s-GFP respectively. Take 10 μL of the ligation product to transform DH5α, screen with a streptomycin-resistant plate, pick positive clones and culture them, and extract the recombinant vector pYB1s-ndmDtB.
[0050] Step S2: Construction method of the engineered strain with NdmB mutant;
[0051] Replace the DNA sequence of ndmB in the recombinant vector pYB1s-ndmDtB obtained in step S1 with the DNA sequences of 4 mutants of ndmB, NdmB Q289T , NdmB Q289S , NdmB Q289A or NdmB Q289G respectively to obtain pYB1s-ndmDtB Q289T , pYB1s-ndmDtB Q289S , pYB1s-ndmDtB Q289A or pYB1s-ndmDtB Q289G , and then transform them into Escherichia coli BW25113 competent cells by the heat shock method respectively to obtain the engineered strains with NdmB mutants NdmB Q289T , NdmB Q289S , NdmB Q289A or NdmB Q289G .
[0052] Other steps are the same as those in the eighth specific implementation manner.
[0053] Tenth specific implementation manner: The difference between this implementation manner and the eighth or ninth specific implementation manner is that the Gibson reaction system in step S1 reacts at 50 °C for 5 to 30 min; currently, generally, for 2 fragments, the reaction is for 5 min, for 3 - 4 fragments, the reaction is for 15 min, and for more than 4 fragments, the reaction is for 30 min.
[0054] Other steps are the same as those in the eighth or ninth specific implementation manner.
[0055] The following examples are used to verify the beneficial effects of the present invention:
[0056] Example 1:
[0057] I. Construction of a genetically engineered bacterium carrying ndmB:
[0058] 1. According to the amino acid sequence of methylxanthine N3-demethylase (ndmB) of Pseudomonas putida CBB5, optimize it according to the codon preference of Escherichia coli, and chemically synthesize the optimized sequence; use primers ndmB-F and ndmB-R for amplification to obtain caffeine N3-demethylase ndmB, with a fragment size of approximately 1000 bp, which is consistent with the target fragment. After sequencing analysis, the results show that the translated DNA sequence of the amplified sequence is the same as the DNA sequence of ndmB numbered GenBank: JQ061128.1 on NCBI. The DNA sequence is as shown in sequence 10 in the sequence listing, and the amino acid sequence of caffeine N3-demethylase encoded by this nucleotide sequence is as shown in sequence 9 in the sequence listing;
[0059] According to the amino acid sequence of caffeine demethylase oxidoreductase truncated protein (ndmDt) of Pseudomonas putida CBB5, optimize it according to the codon preference of Escherichia coli, and chemically synthesize the optimized sequence; use primers ndmDt-F and ndmDt-R for amplification to obtain the truncated ndmDt of caffeine demethylase reductase, with a fragment size of approximately 1000 bp, which is consistent with the target fragment. After sequencing analysis, the results show that the translated DNA sequence of the amplified sequence is the same as the DNA sequence of residues 267 - 588 of ndmD numbered GenBank: JQ061130.1 on NCBI. The DNA sequence is as shown in sequence 12 in the sequence listing, and the amino acid sequence of caffeine demethylase reductase encoded by this nucleotide sequence is as shown in sequence 11 in the sequence listing;
[0060] The full name of the said ndmB is methylxanthine N3-demethylase, which is an N3 demethylase; the said ndmDt is a protein truncated at the first 266 amino acid residues of an oxygenase reductase.
[0061] 2. Double-digest the vector pYB1s-GFP constructed in our laboratory with XhoI and BglII, and electrophoretically recover the 3500 bp fragment; using the Gibson ligation method, ligate the amplified and purified caffeine demethylase-encoding gene ndmB and ndmDt fragments to the vector pYB1s-GFP according to the ratio required in the instructions (the kit is Vazyme's ClonExpress Ultra One Step Cloning Kit (C115-01)), and react at 50 °C for 1 hour; take 10 μL of the ligation product to transform DH5α, screen with streptomycin-resistant plates, pick positive clones, culture the positive clones, extract the plasmids of the positive clones, and perform enzyme digestion verification. The results show that ndmDtB is at the correct position on the pYB1s plasmid vector. The recombinant plasmid was successfully constructed and named pYB1s-ndmDtB. The DNA sequence is shown in Sequence 13 in the sequence listing.
[0062] ndmB-F: atactacgacatgaaagaacagctgaaaccgctg;
[0063] ndmB-R: ggcacgatcaaggtcttagttactgttcttcttcaataacattggtcagc;
[0064] ndmDt-F: agcggcctggtgccgcgcggcagcctcgagatgaccaaagcaccgccgac;
[0065] ndmDt-R: gttctttcatgtcgtagtatttctcctcttttctagtatgtgtg;
[0066] II. Effect of the Q289 site mutation:
[0067] Figure 1 It shows the molecular dynamics simulation conformational diagram of NdmB and caffeine; the figure shows the relative positions of the protein and the ligand and the position of Q289.
[0068] To evaluate the effect of the mutation at position Q289 on NdmB, catalytic efficiency, and the ratio of target products, the present invention verified four mutants of NdmB Q289T, Q289S, Q289A, and Q289G, respectively, and determined their ratios for the conversion of caffeine to paraxanthine and 7-methylxanthine (as shown in Figure 2 ).
[0069] 1. Wild Type:
[0070] The N3-demethylation efficiency of wild-type NdmB for caffeine is extremely low, and no production of 7-methylxanthine and paraxanthine was detected by HPLC.
[0071] 2. NdmB Q289T Mutant (its amino acid sequence is as shown in Sequence 1 in the sequence listing, and the DNA sequence is as shown in Sequence 2 in the sequence listing):
[0072] The Q289T mutation significantly improved the selectivity of NdmB for paraxanthine, and the proportion of paraxanthine in the total products exceeded 98%, with almost no production of 7-methylxanthine. This indicates that the Q289T mutant is suitable for the efficient production of paraxanthine.
[0073] 3. NdmB Q289S Mutant (its amino acid sequence is as shown in Sequence 3 in the sequence listing, and the DNA sequence is as shown in Sequence 4 in the sequence listing):
[0074] The Q289S mutant showed a more balanced product generation ratio, with the ratio of paraxanthine to 7-methylxanthine being approximately 45:55. This mutant has the potential for the simultaneous production of both target products.
[0075] 4. NdmB Q289A Mutant (its amino acid sequence is as shown in Sequence 5 in the sequence listing, and the DNA sequence is as shown in Sequence 6 in the sequence listing):
[0076] The Q289A mutant showed a significant bias towards the production of 7-methylxanthine, with the proportion of 7-methylxanthine in the total products exceeding 90%, while paraxanthine accounted for only approximately 10%. This indicates that the Q289A mutant is suitable for applications with 7-methylxanthine as the target product.
[0077] 5. NdmB Q289G Mutant (its amino acid sequence is as shown in Sequence 7 in the sequence listing, and the DNA sequence is as shown in Sequence 8 in the sequence listing):
[0078] The performance of the Q289G mutant was between that of Q289S and Q289A, with the proportion of 7-methylxanthine in the total products being approximately 60% and paraxanthine accounting for approximately 40%, showing a certain flexibility in regulating the ratio of paraxanthine and 7-methylxanthine.
[0079] III. Method for constructing engineered strains with NdmB mutants:
[0080] Replace the DNA sequence of ndmB in (Step II) pYB1s-ndmDtB with the DNA sequences of 4 mutants of ndmB, namely NdmB Q289T , NdmB Q289S , NdmB Q289A or NdmB Q289G respectively, to obtain pYB1s-ndmDtB Q289T (Sequence 14), pYB1s-ndmDtB Q289S , pYB1s-ndmDtB Q289A , pYB1s-ndmDtB Q289G .
[0081] The aforementioned ndmDtB Q289T is constructed by the following method (pYB1s-ndmDtB Q289S , pYB1s-ndmDtB Q289A and pYB1s-ndmDtB Q289G are all constructed in the same way):
[0082] (1) Use the pBAD promoter to initiate the expression of the ndmDt gene and provide reductase support to maintain the enzyme activity during the production of paraxanthine;
[0083] (2) Regulate the expression level of the ndmB Q289T gene through the Anderson promoter J23100 to optimize its efficiency in catalyzing caffeine to produce paraxanthine;
[0084] (3) Test results show that when using the pBAD promoter to initiate the expression of the ndmDt gene and the J23100 promoter to initiate the expression of the ndmB Q289T gene, the production efficiency of paraxanthine reaches the highest, and the content of by-products is less than 5%.
[0085] According to Figure 2As a result, the abilities of the wild type and four mutants to degrade 8 mM caffeine were tested separately. The wild type hardly degraded caffeine, and no caffeine degradation products were detected. NdmBQ289T could efficiently degrade caffeine into PX, and the content of the further degradation product 7-MX of PX was less than 5%. Approximately 45% of PX was further degraded into 7-MX by NdmBQ289S; approximately 85% of PX was further degraded into 7-MX by NdmBQ289A, and approximately 55% of PX was further degraded into 7-MX by NdmBQ289G. In summary, NdmBQ289T produced the least amount of by-product 7-MX. Therefore, it was known that the recombinant plasmid pYB1s-ndmDtB Q289T was most suitable for the efficient production of paraxanthine, and it was transformed into competent Escherichia coli BW25113 cells by the heat shock method to obtain an engineering bacterium with high paraxanthine production.
[0086] IV. Specific steps for preparing paraxanthine using the engineering bacterium with high paraxanthine production:
[0087] Step 1. Method for protein induction expression of the engineering bacterium with high paraxanthine production:
[0088] The genetic engineering bacterium with high paraxanthine production was streaked on an LB plate and cultured at 37 °C for 12 h; single colonies grown on the plate were picked and inoculated into a liquid LB medium, and cultured overnight with shaking at 200 rpm at 37 °C; the culture was inoculated into the self-inducing medium ZYM-5052 at an inoculation amount of 1% (v / v), and cultured with shaking at 37 °C for 1.5 - 3 h until the bacterial cells grew to the logarithmic growth phase, then an inducer was added and the culture was transferred to 25 °C and cultured with shaking for 18 h;
[0089] The LB plate described in Step 1 was composed of agar with a mass percentage concentration of 1.5% and streptomycin containing 50 μg / mL;
[0090] The liquid LB medium described in Step 1 was composed of 10 g / L tryptone, 10 g / L sodium chloride, 5 g / L yeast extract, and 50 μg / mL streptomycin;
[0091] The induction medium ZYM-5052 described in Step 1 was composed of 100 mL of Substance A, 2 mL of Substance B, 2 mL of Substance C, 200 μL of Substance D, and 100 μL of Substance E;
[0092] The described substance A is composed of 1% tryptone and 0.5% yeast powder by mass fraction; the described substance B is composed of 1.25 M Na2HPO4, 1.25 M KH2PO4, 2.5 M NH4Cl and 0.25 M Na2SO4; the described substance C is composed of 25% glycerol, 2.5% glucose, 10% L-arabinose and 50 mM IPTG by mass fraction; the described substance D is 1 M MgSO4; the trace element substance E is composed of 50 mM FeCl3, 20 mM CaCl2, 10 mM MnCl2, 10 mM ZnSO4, 2 mM CoCl2, 2 mM NiCl2, 2 mM Na2MoO4, 2 mM Na2SeO3 and 2 mM H3BO3.
[0093] Step 2. Method for biotransforming and degrading caffeine to produce paraxanthine:
[0094] After induction, the cell concentration in the medium was measured, and the cells were taken out according to the demand and centrifuged at 4200 rpm for 10 min at 4°C, washed once with buffer, and after discarding the supernatant, resuspended in the transformation solution and shaken at 20°C for 18 h to complete the efficient production of paraxanthine.
[0095] Transformation solution: 40 mM caffeine, 50 mM Tirs-HCl. After shaking and transforming at 20°C and 200 rpm for 18 h, it was terminated to obtain the final transformation solution for the quantitative analysis of paraxanthine.
[0096] The obtained transformation solution was centrifuged at 10000 xg for 10 min, the supernatant was taken, filtered through a 0.22 μm filter membrane, and the paraxanthine yield was detected by HPLC. HPLC used an Agilent 1100 high-performance liquid chromatograph (equipped with a quaternary pump, DAD detector and workstation).
[0097] The paraxanthine quantification method used: LP-C8 Column 300×5.6 mm; mobile phase: methanol: water: glacial acetic acid (15:85:0.5 v / v / v), flow rate: 1.0 mL*min -1 , column temperature 35°C; injection volume 10 μL, detection wavelength 280 nm. The paraxanthine standard product was purchased from Shanghai Aladdin Biotechnology Co., Ltd.
[0098] As Figure 4 shown, through a series of strain modifications and fermentation optimizations, the paraxanthine reached 6.29 g / L, the caffeine conversion rate was 87.3%, and the paraxanthine concentration was the highest level reported in the current literature, showing good application prospects.
Claims
1. Application of NdmB mutant for highly efficient production of paraxanthine, characterized in that The NdmB mutant is used for efficiently producing paraxanthine. The NdmB mutant is NdmB Q289T 、NdmB Q289S 、NdmB Q289A or NdmB Q289G ; The NdmB described above Q289T has the amino acid sequence shown in Sequence Listing SEQ ID NO.1 and the nucleotide sequence shown in Sequence Listing SEQ ID NO.2; The NdmB described above Q289S has the amino acid sequence shown in Sequence Listing SEQ ID NO.3, and the nucleotide sequence shown in Sequence Listing SEQ ID NO.4; The NdmB described above Q289A has the amino acid sequence shown in Sequence Listing SEQ ID NO.5, and the nucleotide sequence shown in Sequence Listing SEQ ID NO.6; The described NdmB Q289G has the amino acid sequence shown in Sequence Listing SEQ ID NO.7, and the nucleotide sequence shown in Sequence Listing SEQ ID NO.
8.
2. Use of the NdmB mutant for the efficient production of paraxanthine according to claim 1, characterized in that The specific steps for the efficient production of paraxanthine by the NdmB mutant are as follows: Step 1. Method for protein induction expression of engineering bacteria with high paraxanthine production: Streak the engineering strain carrying the NdmB mutant onto an LB plate and culture it at 37 °C for 12 h; pick a single colony on the plate and inoculate it into a liquid LB medium, and culture it overnight with shaking at 37 °C; inoculate the culture into the induction medium ZYM-5052 at an inoculation amount of 1% by volume, shake and culture it at 37 °C for 1.5 - 3 h until the bacterial growth reaches the logarithmic growth phase, add an inducer and transfer it to shake and culture at 25 °C for 18 h; Step 2. Method for biotransforming and degrading caffeine to produce paraxanthine: Centrifuge the induced bacterial cells at 4 °C for 10 min, wash them once with a buffer solution, discard the supernatant, resuspend them in a transformation solution, and shake and culture them at 20 °C for 18 h to complete the efficient production of paraxanthine.
3. Use of the NdmB mutant for the efficient production of paraxanthine according to claim 1, characterized in that In Step 1, pick a single colony on the plate and inoculate it into a liquid LB medium, and culture it overnight with shaking at 37 °C at a rotation speed of 200 rpm; the inducer consists of arabinose with a final concentration of 0.2% and IPTG with a concentration of 1 mM.
4. Use of the NdmB mutant for highly efficient production of paraxanthine according to claim 1, characterized in that In Step 1, inoculate the culture into the self-induction medium ZYM-5052 at an inoculation amount of 1% by volume, and shake and culture it at 37 °C at a rotation speed of 200 rpm for 1.5 - 3 h.
5. Use of the NdmB mutant for the efficient production of paraxanthine according to claim 1, characterized in that The LB plate in Step 1 consists of agar with a mass percentage concentration of 1.5% and streptomycin with a concentration of 50 μg / mL; The liquid LB medium in Step 1 consists of 10 g / L tryptone, 10 g / L sodium chloride, 5 g / L yeast extract, and 50 μg / mL streptomycin.
6. Use of the NdmB mutant in the efficient production of paraxanthine according to claim 1, characterized in that The induction medium ZYM-5052 in Step 1 consists of 100 mL of Substance A, 2 mL of Substance B, 2 mL of Substance C, 200 μL of Substance D, and 100 μL of Substance E; The Substance A consists of tryptone with a mass fraction of 1% and yeast powder with a mass fraction of 0.5%; the Substance B consists of 1.25 M Na2HPO4, 1.25 M KH2PO4, 2.5 M NH4Cl, and 0.25 M Na2SO4; the Substance C consists of glycerol with a mass fraction of 25%, glucose with a mass fraction of 2.5%, L-arabinose with a mass fraction of 10%, and 50 mM IPTG; the Substance D is 1 M MgSO4; the trace element Substance E consists of 50 mM FeCl3, 20 mM CaCl2, 10 mM MnCl2, 10 mM ZnSO4, 2 mM CoCl2, 2 mM NiCl2, 2 mM Na2MoO4, 2 mM Na2SeO3, and 2 mM H3BO3.
7. Use of the NdmB mutant in the efficient production of paraxanthine according to claim 1, characterized in that The transformation solution in Step 2 consists of 40 mM caffeine and 50 mM Tirs-HCl.
8. An engineering strain carrying the NdmB mutant for the efficient production of paraxanthine as claimed in claim 1.
9. The engineered strain according to claim 8, characterized in that The construction method of the engineering strain is carried out according to the following steps: Step S1: Construct a genetic engineering bacterium carrying ndmB; The vector pYB1s-GFP was digested with XhoI and BglII, and the 3500 bp fragment was recovered by electrophoresis; using the Gibson ligation method, the caffeine demethylase encoding gene ndmB and ndmDt fragments were respectively ligated to the vector pYB1s-GFP. 10 μL of the ligation product was transformed into DH5α, and streptomycin-resistant plates were used for screening. Positive clones were picked and cultured, and the recombinant vector pYB1s-ndmDtB was obtained by extraction; Step S2: A method for constructing an engineered strain with an NdmB mutant; Replace the DNA sequence of ndmB in the recombinant vector pYB1s-ndmDtB obtained in step S1 with the DNA sequences of four mutants of ndmB, namely NdmB Q289T , NdmB Q289S , NdmB Q289A or NdmB Q289G respectively, to obtain pYB1s-ndmDtB Q289T , pYB1s-ndmDtB Q289S , pYB1s-ndmDtB Q289A or pYB1s-ndmDtB Q289G . Then, transform them into competent cells of Escherichia coli BW25113 by the heat shock method respectively to obtain engineering strains carrying NdmB mutants NdmB Q289T , NdmB Q289S , NdmB Q289A or NdmB Q289G .
10. The engineered strain according to claim 9, wherein The Gibson reaction system in Step S1 was reacted at 50 °C for 5 - 30 min.