SRNA, composition and application thereof

Abstract

The invention relates to sRNA, a composition and application of the sRNA and the composition, and belongs to the field of medicinal small nucleic acid. According to the sRNA provided by the invention, the expression quantity is reduced by targeting a specific sequence of mRNA of a sclerostin gene SOST, so that the expression quantity or activity of an alkaline phosphatase gene is improved to promote osteoblast differentiation and further prevent, treat or improve bone metabolic diseases such as osteoporosis, and the sRNA is particularly suitable for treating postmenopausal osteoporosis or senile osteoporosis.

Description

Technical Field

[0001] The present invention belongs to the technical field of medicinal small nucleic acid molecules, and particularly relates to an sRNA, a composition and their applications, which can be used for preventing, treating or improving bone metabolic diseases. Background Art

[0002] Osteoporosis (OP) is the most common bone disease, which is a systemic bone disease characterized by low bone mass, damaged microstructure of bone tissue, increased bone fragility and easy fracture. A bone disease characterized by decreased bone strength and increased fracture risk indicates that reduced bone mass is the main risk factor for osteoporotic fractures, but there are other risk factors. OP can occur at any age, but is more common in postmenopausal women and elderly men.

[0003] With the acceleration of the process of population aging, the incidence rate of osteoporosis has ranked third among chronic diseases following cardiovascular diseases and diabetes, becoming a common and frequently-occurring disease in the world. It seriously affects people's physical health and quality of life, and brings a huge economic burden to society. For the prevention and treatment of osteoporosis, the main current therapeutic drugs are calcium agents, vitamin D and bone resorption inhibitors (including estrogens, selective estrogen receptor modulators, bisphosphonates, etc.). However, the long-term use of these drugs will increase the incidence rates of gynecological cancers, cardiovascular diseases and thrombosis, and there are many problems such as kidney damage, long treatment courses, high costs and uncertain curative effects, which force patients to terminate the treatment during the treatment process due to their inability to tolerate the adverse reactions and bear the high treatment costs. Therefore, it is still very necessary to find new treatment measures against osteoporosis.

[0004] sRNA (small RNA) is a class of ribonucleic acid fragments with a length less than 200 nt. Most sRNAs are non-coding RNAs (ncRNAs), including: microRNA (miRNA), small nucleolar RNA (snoRNA), piwi-interacting RNA (piRNA), small nuclear RNA (U-RNA), small interfering RNA (siRNA), etc. sRNAs are widely present in animals, plants and microorganisms, and participate in regulating key biological processes such as cell proliferation, differentiation, metabolism and death by inducing gene silencing.

[0005] In the field of drug development, compared with small molecule inhibitors, chemical drugs or antibodies, the primary advantages of siRNA lie in high specificity and high-throughput screening. Additionally, siRNA drugs have a long half-life. Generally, the half-life of small molecule drugs in the body is calculated in hours, that of antibody drugs in days, while that of specially modified siRNA drugs is calculated in months, greatly reducing the dosing frequency. Therefore, the development of siRNA drugs has good prospects. Currently, there are very few reports on the research and development of small molecule nucleic acid drugs for the treatment of osteoporosis.

[0006] In view of this, the present invention is specifically proposed. Summary of the Invention

[0007] Aiming at the lack of existing small nucleic acid drugs for treating osteoporosis, the object of the present invention is to provide an sRNA, a composition and their applications. This sRNA belongs to antisense oligonucleotide (ASO), which targets a specific fragment of SOST mRNA, reduces its expression level, and thus increases the expression level or activity of alkaline phosphatase, thereby achieving the prevention, treatment or improvement of bone metabolic diseases.

[0008] To achieve the above object, the present invention adopts the following technical solutions:

[0009] The present invention first provides an sRNA, and its nucleotide sequence is any one of the following (1) to (5):

[0010] (1) A single-stranded RNA as shown in Sequence 1 in the Sequence Listing (5’-GGTCTGTGAGTTTGTGATGGCT-3’);

[0011] (2) A single-stranded RNA obtained by truncating 1-5 or 1-3 nucleotides from the 5’ end and / or 3’ end of the nucleotide sequence shown in Sequence 1 in the Sequence Listing;

[0012] (3) A single-stranded RNA with an identity greater than or equal to 80% (such as 85%, 90% or 95%) to the nucleotide sequence shown in Sequence 1 in the Sequence Listing and having the function of reducing or silencing the expression level of SOST mRNA;

[0013] (4) A sequence that hybridizes with the nucleic acid sequence shown in any one of (1)-(3) under stringent conditions;

[0014] (5) A double-stranded sRNA formed by the nucleic acid sequence shown in any one of (1)-(3) and its complementary sequence.

[0015] Furthermore, the sequence of the sRNA contains at least one of 2'-fluoro-modified nucleotides, 2'-methoxyethyl-modified nucleotides, 2'-deoxy-modified nucleotides, 2'-amino-modified nucleotides, 2'-O-allyl-modified nucleotides, 2'-C-alkyl-modified nucleotides, 2'-hydroxy-modified nucleotides, and 2'-O-alkyl-modified nucleotides. Preferably, it contains 2'-O-methyl-modified nucleotides. More preferably, the 3'-terminal nucleotide of the sRNA is a 2'-O-methyl-modified nucleotide.

[0016] The present invention also provides a DNA sequence whose nucleotide sequence can be transcribed into the above-mentioned sRNA.

[0017] The present invention further provides a genetically engineered recombinant expression vector, which includes the above DNA sequence of the present invention and can transcribe the sRNA described in any one of claims 1-3.

[0018] The present invention also provides a host cell, which contains the above-mentioned genetically engineered recombinant expression vector of the present invention.

[0019] The present invention also provides a pharmaceutical composition, which contains the above sRNA, the above DNA sequence, the above genetically engineered recombinant expression vector, or the above host cell, and a pharmaceutically acceptable excipient.

[0020] Furthermore, the pharmaceutical composition is a pharmaceutical dosage form suitable for administration by gavage, oral, intravenous, subcutaneous, transdermal, intramuscular, intra-arterial, intraperitoneal, intratracheal, intracerebrospinal, intra-articular, intrasynovial, intrathecal, intraventricular, or inhalation routes.

[0021] Furthermore, the composition further includes a drug delivery carrier, preferably a liposome.

[0022] The fifth aspect of the present invention also provides the use of the above sRNA, DNA sequence, genetically engineered recombinant expression vector, host cell, or pharmaceutical composition in the preparation of a drug for preventing, treating, or improving bone metabolic diseases.

[0023] Furthermore, the bone metabolic disease is osteoporosis, preferably postmenopausal osteoporosis or senile osteoporosis.

[0024] Furthermore, the bone metabolic disease is prevented, treated, or improved by increasing the gene expression level or activity of alkaline phosphatase.

[0025] Furthermore, the bone metabolic disease is prevented, treated, or improved by promoting osteoblast differentiation.

[0026] Compared with the prior art, the technical solution of the present invention has the following beneficial effects:

[0027] The sRNA provided by the present invention targets a specific fragment of the mRNA of the sclerostin gene SOST, reduces its expression level, thereby increasing the expression level or activity of the alkaline phosphatase gene to promote osteoblast differentiation, and thus prevent, treat or improve bone metabolism diseases, such as osteoporosis, and is particularly suitable for treating postmenopausal osteoporosis or senile osteoporosis. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] In order to more clearly explain the technical solutions and effects of the present invention, the drawings of the specific embodiments will be briefly introduced below. Obviously, the drawings in the following description are some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.

[0029] Figure 1 It is the result of the dual-luciferase reporter gene experiment in Example 1, where WT is wild type and MUT is mutant (MUT).

[0030] Figure 2 It is the result graph of detecting the relative expression level of SOST mRNA by RT-qPCR experiment in Example 2.

[0031] Figure 3 It is the result graph of detecting the alkaline phosphatase activity in each group of cells in Example 3.

[0032] Figure 4 It is the structural diagram of the dual-luciferase reporter gene system psiCHECK TM -2Vector used in Example 1. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0033] To make the objectives, technical solutions and advantages of the present invention clearer, the technical solutions of the present invention will be clearly and completely described below in conjunction with the specific embodiments and examples of the present invention. Those skilled in the art should understand that the described embodiments are only for helping to understand the present invention and should not be regarded as specific limitations on the present invention. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts fall within the scope of protection of the present invention. The process parameters without specific conditions noted in the following examples are usually in accordance with conventional conditions.

[0034] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which the present invention belongs. In case of contradiction, the present specification including the definitions shall prevail.

[0035] The present invention employs many conventional techniques in the fields of molecular biology, microbiology, and DNA recombination. These techniques are well-known and are explained in the following documents, for example, Current Protocols in Molecular Biology, Volumes I, II, and III, 1997 (edited by F.M. Ausubel); Molecular Cloning: A Laboratory Manual, Second Edition (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 1989) by Sambrook et al.; DNA Cloning: A Practical Approach, Volumes I and II, edited by D.N. Glover (1985); Oligonucleotide Synthesis, edited by M.L. Gait (1984); Hames & Higgins, Nucleic Acid Hybridization, (1985); Transcription and Translation, edited by Hames & Higgins (1984); Animal Cell Culture, edited by R.I. Freshney (1986).

[0036] The reagents and products without specified sources in the present invention are all conventional commercially available products.

[0037] The first aspect of the present invention provides an sRNA, and its nucleotide sequence is any one of the following (1) to (5):

[0038] (1) A single-stranded RNA as shown in Sequence 1 in the Sequence Listing (5’-GGTCTGTGAGTTTGTGATGGCT-3’);

[0039] (2) A single-stranded RNA obtained by truncating 1 - 5 or 1 - 3 nucleotides from the 5’ end and / or 3’ end of the nucleotide sequence shown in Sequence 1 in the Sequence Listing;

[0040] (3) A single-stranded RNA with an identity of greater than or equal to 80% (such as 85%, 90%, or 95%) to the nucleotide sequence shown in Sequence 1 in the Sequence Listing and having the function of reducing or silencing the expression level of SOST mRNA;

[0041] (4) A sequence that hybridizes with any of the nucleic acid sequences shown in (1) - (3) under stringent conditions;

[0042] (5) A double-stranded sRNA formed by the nucleic acid sequence shown in any one of (1)-(3) and its complementary sequence.

[0043] In the RNA sequences mentioned in the present invention, T is U (uracil), and in the DNA sequences, T is thymine.

[0044] The "stringent conditions" used in the present invention are well-known, including, for example, hybridizing at 60 °C for 12 - 16 hours in a hybridization solution containing 400 mM NaCl, 40 mM PIPES (pH 6.4), and 1 mM EDTA, and then washing at 65 °C for 15 - 60 minutes with a washing solution containing 0.1% SDS and 0.1% SSC.

[0045] The sRNA provided by the present invention was discovered by the inventors through a large number of experiments. The inventors designed multiple small RNAs targeting different positions for SOST mRNA. Through effect comparison, it was found that the sRNA provided by the present invention can target sost and reduce the expression level of sost mRNA, while increasing the activity or expression level of alkaline phosphatase, with the best effect, and significantly has the effect of promoting osteogenesis, and can be used for preventing, treating, or improving bone metabolic diseases such as osteoporosis.

[0046] Further, the sequence of the sRNA contains at least one of 2'-fluoro-modified nucleotides, 2'-methoxyethyl-modified nucleotides, 2'-deoxy-modified nucleotides, 2'-amino-modified nucleotides, 2'-O-allyl-modified nucleotides, 2'-C-alkyl-modified nucleotides, 2'-hydroxy-modified nucleotides, 2'-O-alkyl-modified nucleotides. Preferably, it contains 2'-O-methyl-modified nucleotides, and more preferably, the 3'-terminal nucleotide of the sRNA is a 2'-O-methyl-modified nucleotide. The sRNA with modified nucleotides can enhance nucleic acid stability and reduce immunogenicity and other benefits.

[0047] The second aspect of the present invention provides a DNA sequence whose nucleotide sequence can be transcribed into the sRNA described in the first aspect.

[0048] The third aspect of the present invention provides a genetically engineered recombinant expression vector, and the genetically engineered recombinant expression vector includes the DNA sequence of the second aspect of the present invention and can transcribe the sRNA described in the first aspect of the present invention.

[0049] The fourth aspect of the present invention provides a host cell, and the host cell contains the genetically engineered recombinant expression vector described in the third aspect of the present invention.

[0050] The fifth aspect of the present invention provides a pharmaceutical composition comprising the sRNA of the first aspect, the DNA sequence of the second aspect, the genetically engineered recombinant expression vector of the third aspect, or the host cell of the fourth aspect, and a pharmaceutically acceptable excipient.

[0051] Further, the pharmaceutical composition is a pharmaceutical dosage form suitable for administration by gavage, oral, intravenous, subcutaneous, transdermal, intramuscular, intra-arterial, intraperitoneal, intralung, intraspinal, intra-articular, intrasynovial, intrathecal, intraventricular, or inhalation routes.

[0052] Further, the composition further comprises a drug delivery carrier, preferably a liposome.

[0053] The fifth aspect of the present invention provides the use of the sRNA of the first aspect, the DNA sequence of the second aspect, the genetically engineered recombinant expression vector of the third aspect, the host cell of the fourth aspect, or the pharmaceutical composition of the fifth aspect in the preparation of a drug for preventing, treating, or improving bone metabolic diseases.

[0054] Further, the bone metabolic disease is osteoporosis, preferably postmenopausal osteoporosis or senile osteoporosis.

[0055] Further, the bone metabolic disease is prevented, treated, or improved by increasing the gene expression level or activity of alkaline phosphatase.

[0056] The bone metabolic disease is prevented, treated, or improved by promoting osteoblast differentiation.

[0057] The effects of the technical solutions of the present invention are verified and illustrated by the following examples.

[0058] Selection of sRNA Target Sites

[0059] The sclerostin gene (SOST) encodes sclerostin, which is specifically expressed in osteocytes and plays an important role in bone metabolism by acting on osteoblasts. It is an inhibitor of the WNT / β-catenin signaling pathway and can stimulate osteoblast differentiation and bone formation. Therefore, the inventors selected multiple target positions based on the SOST mRNA sequence (NCBI reference number: NM_025237.3), designed corresponding sRNAs, and used the sRNAs to reduce the expression level of SOST mRNA. After screening multiple target positions, it was found that using the 1764-1785 nucleotide sequence of this mRNA sequence as the targeting site (target 1) had very ideal effects, significantly reducing the expression level of SOST mRNA, significantly increasing the alkaline phosphatase activity of cells, and promoting the osteogenic differentiation of pre-osteoblast MC3T3-E1 cells. The small molecule RNA designed for this target 1 has a nucleic acid sequence as shown in sequence 1 in the sequence listing. The sRNA-sost-1764 used in the following examples is a single-stranded RNA, with a nucleic acid sequence as shown in sequence 1 in the sequence listing, and the 3'-terminal nucleotide is a 2'-O-methyl modified nucleotide, which is artificially synthesized.

[0060] Example 1 verified that sRNA-sost-1764 can directly target the 3'UTR of SOST mRNA

[0061] (1) Inoculate 293T cells with a density of 80-90% into the DMEM (high glucose) medium in a 48-well plate at a certain ratio, with 200 μL of medium in each well, and place it in a cell culture incubator for cultivation at 37 °C with 5 mL / L CO2. When the cell growth density is about 50%-60%, it is used for step (2).

[0062] (2) Transfect the relevant substances into the 293T cells in step (1) according to the following grouping.

[0063] The experiment was divided into four groups:

[0064] The first group: Transfect the wild-type plasmid and sRNA-sost-1764;

[0065] The second group: Transfect the wild-type plasmid and NC sequence (NC-sRNA);

[0066] The third group: Transfect the mutant plasmid and sRNA-sost-1764;

[0067] The fourth group: Transfect the mutant plasmid and NC sequence.

[0068] Each group was set with three replicates.

[0069] The construction method of the wild-type plasmid (WT) is as follows:

[0070] The basic vector is the dual-luciferase reporter gene system psiCHECK TM -2Vector, psiCHECK TM -2Vector co-expresses Firefly Luciferase and Renilla Luciferase. The target gene sequence of sRNA-sost-1764 is inserted into this basic vector. The target gene sequence is the nucleotides at positions 1749 - 1800 in the SOST mRNA sequence, and the specific RNA sequence is -ca ggcccgaggg agcagccatc acaaactcacagaccagcac atcccttttg- (Sequence 2). This Sequence 2 is inserted at the 3' end of the Renilla luciferase gene, specifically between NotⅠ and SgfⅠ. See Figure 4 . sRNA-sost-1764 can complementarily pair with a segment of Sequence 2. The plasmid construction, amplification, and purification were entrusted to General Biosystems (Anhui) Co., Ltd. to complete.

[0071] The construction method of the mutant plasmid (MUT) is as follows:

[0072] The basic vector is the dual-luciferase reporter gene system psiCHECK TM -2Vector, psiCHECK TM -2Vector co-expresses Firefly Luciferase and Renilla Luciferase. The target gene sequence 3 is inserted into this basic vector. Specifically: -ca ggcccgagggagc cattcca cacggacagtcagttagcac atcccttttg-. This RNA sequence is modified based on Sequence 2, so that sRNA-sost-1764 cannot complementarily pair with it. The insertion position of Sequence 3 is the same as that of Sequence 2 above, between NotⅠ and SgfⅠ. See Figure 4 . The plasmid construction, amplification, and purification were entrusted to General Biosystems (Anhui) Co., Ltd. to complete.

[0073] NC-sRNA is an artificially synthesized single-stranded RNA sequence with 2'-O-methyl modification at the 3' end, used as a comparison sequence. The sequence is as shown in Sequence 4 in the sequence listing: 5’-TTGTACTACACAAAAGTACTG-3’.

[0074] The transfection method is as follows: The wild-type plasmid and the mutant plasmid are transfected using LipofectamineTM Lipo 2000, 0.2 μg of plasmid is added to each well, and the sRNA is transfected using LipofectamineTM RNAiMAX, and the final concentration of the sRNA is 50 nmol·L -1 .

[0075] (3) After the transfection is completed, gently shake the 48-well plate to fully disperse the transfection reagent in the cell culture supernatant. Return the 48-well plate to the cell culture incubator and continue culturing.

[0076] (4) After 36 - 48 h, take out the cells in the 48-well plate and prepare for detection.

[0077] (5) Discard the cell culture supernatant, add 65 μL of lysis buffer to each well, lysate and shake on a plate oscillator for 30 min, and transfer to a 1.5 mL EP tube. Centrifuge at 13200 g at 4 °C for 10 min. Transfer the supernatant to a new EP tube.

[0078] (6) Take a white-bottom 96-well plate, add 18 μL of lysis buffer and 2 μL of the cell lysate supernatant to each well, and mix well by shaking on a plate oscillator for 30 s.

[0079] (7) Prepare the detection substrate solution and the reaction termination solution according to the instructions of the Dual-Luciferase Reporter Assay System (Cat.# E1910 purchased from Promega Corporation (USA)), initialize using a GloMax 96 microplate luminometer (Promega). And wash the instrument in the order of ddH2O - 75 mL / L alcohol - ddH2O - air, and pre-fill the instrument pipeline with the detection substrate solution and the reaction termination working solution.

[0080] (8) Perform the detection on the machine to obtain the activities of Renilla luciferase and firefly luciferase in different groups.

[0081] Since the target gene sequences 2 and 3 are constructed into the 3' end of the Renilla luciferase gene, the sRNA sequence causes the degradation of the target gene mRNA by complementary pairing with the target gene, and the detection shows a decrease in the fluorescence of the Renilla luciferase substrate. The psiCHECKTM-2 Vector uses the fluorescence of the firefly luciferase substrate expressed by itself as an internal reference, and measures the effect of different sRNAs on the target gene by comparing the ratio of the fluorescence of the Renilla luciferase substrate / the fluorescence of the firefly luciferase substrate (Relative luciferase activity).

[0082] From Figure 1It can be seen that for wild-type plasmids, sRNA-sost-1764 can target and bind to the SOST gene, inhibiting the ratio of Renilla luciferase / Firefly luciferase, while NC-sRNA has basically no effect on the ratio of Renilla luciferase / Firefly luciferase. For mutant plasmids, both sRNA-sost-1764 and NC-sRNA have no effect on the ratio of Renilla luciferase / Firefly luciferase. After the target gene mutates, sRNA-sost-1764 cannot bind to it, thus restoring the expression of the Renilla luciferase gene, which verifies the effective binding of sRNA-sost-1764 to target gene sequence 1.

[0083] Example 2 verifies the inhibition of SOST gene transcription level by sRNA-sost-1764 on 293T cells

[0084] (1) Inoculate 293T cells with a density of 80-90% into the DMEM (high glucose) medium in a 6-well plate at a certain ratio, 1 mL of medium per well, and place it in a cell culture incubator for culture at 37 °C and 5 mL / L CO2. When the cell growth density reaches 50%-60%, it is used for subsequent experiments.

[0085] (2) Transfect the relevant substances into the cells in step (1) according to the following experimental groups:

[0086] Blank group (Native): Only add transfection reagent without transfecting any sRNA;

[0087] Non-sense sequence group: Transfect NC-sRNA (the same as NC-sRNA in Example 1);

[0088] Experimental group: Transfect sRNA-SOST-1764;

[0089] Set three replicates for each group.

[0090] The transfection method is as follows: sRNA is transfected using LipofectamineTM RNAiMAX, and the final concentration of sRNA is 50 nmol / L.

[0091] (3) After transfection, continue cell culture for 24 h, then collect the cells and perform RT-qPCR experiments to detect the relative expression level of SOST mRNA. The internal reference is GAPDH.

[0092] From Figure 2 It can be seen that sRNA-SOST-1764 reduces the expression of the SOST gene in 293T cells at the transcriptome level.

[0093] Example 3 verifies that sRNA-SOST-1764 promotes the osteogenic differentiation of pre-osteoblasts

[0094] The in vitro osteogenic differentiation experiment used MC3T3-E1 cells.

[0095] Osteogenic induction was carried out using an osteogenic inducer. The final concentrations of each component in the osteogenic inducer in the culture medium were: 50 μg·mL -1 ascorbic acid, 10 mmol·L -1 β-glycerophosphate, 10 nmol·L -1 dexamethasone.

[0096] (1) When the density of MC3T3-E1 cells grew to a confluence rate of 80-90%, the cells were seeded in a certain proportion. A 12-well plate was used and placed back in the cell culture incubator at 37°C with 5 mL / L CO2 for overnight culture. The culture medium was divided into two types. One was α-MEM medium containing the osteogenic inducer, and the final concentrations of various components in the osteogenic inducer in the medium were as described above; the other medium was α-MEM medium without the osteogenic inducer;

[0097] (2) The following experimental groups were transfected with relevant substances into the cells in step (1):

[0098] Blank group (blank): Cells cultured in α-MEM medium without the osteogenic inducer, without transfection of any substance;

[0099] Model group (con): Cells cultured in α-MEM medium containing the osteogenic inducer, without transfection of any substance;

[0100] Non-sense sequence group (NC-sRNA): α-MEM medium containing the osteogenic inducer, and transfected with the non-sense sequence NC-sRNA (the NC-sRNA sequence was the same as that in Example 1);

[0101] Experimental group (sRNA-SOST-1764): α-MEM medium containing the osteogenic inducer, transfected with sRNA-SOST-1764;

[0102] Each group was set with three replicates.

[0103] The transfection method was as follows: sRNA was transfected using LipofectamineTM RNAiMAX, and the final concentration of the nucleic acid was 50 nmol·L -1 .

[0104] (3) After transfection, continue to co-incubate with the cells for 3 days, and then use an alkaline phosphatase detection kit to detect the alkaline phosphatase activity.

[0105] From Figure 3It can be seen that sRNA-SOST-1764 significantly increases the alkaline phosphatase activity of cells and promotes the osteogenic differentiation of pre-osteoblast MC3T3-E1 cells. However, NC-sRNA cannot play the role of increasing the alkaline phosphatase activity of cells.

[0106] As is known by common technical knowledge, the present invention can be implemented by other embodiments that do not depart from its spirit or essential features. Therefore, the above-disclosed embodiments are illustrative in all aspects and not exclusive. All changes within the scope of the present invention or within the scope equivalent to the present invention are encompassed by the present invention.

Claims

1. An sRNA, whose nucleotide sequence is any one of the following (1) to (5): (1) A single-stranded RNA shown in Sequence 1 of the Sequence Listing; (2) A single-stranded RNA obtained by truncating 1-5 or 1-3 nucleotides from the 5'-end and / or 3'-end of the nucleotide sequence shown in Sequence 1 of the Sequence Listing; (3) A single-stranded RNA having an identity of greater than or equal to 80% (such as 85%, 90% or 95%) with the nucleotide sequence shown in Sequence 1 of the Sequence Listing and having the function of reducing or silencing the expression level of SOST mRNA; (4) A sequence that hybridizes with any nucleic acid sequence shown in (1)-(3) under stringent conditions; (5) A double-stranded sRNA formed by any nucleic acid sequence shown in (1)-(3) and its complementary sequence.

2. The sRNA according to claim 1, characterized in that, The sequence of the sRNA contains at least one of 2'-fluoro-modified nucleotides, 2'-methoxyethyl-modified nucleotides, 2'-deoxy-modified nucleotides, 2'-amino-modified nucleotides, 2'-O-allyl-modified nucleotides, 2'-C-alkyl-modified nucleotides, 2'-hydroxy-modified nucleotides, 2'-O-alkyl-modified nucleotides.

3. The sRNA according to claim 2, wherein The 3'-terminal nucleotide of the sRNA sequence is a 2'-O-methyl-modified nucleotide.

4. A DNA sequence, characterized in that, Its nucleotide sequence can be transcribed into the sRNA described in any one of Claims 1-3.

5. A genetically engineered recombinant expression vector, characterized in that, The gene engineering recombinant expression vector includes the DNA sequence described in Claim 4 and can transcribe the sRNA described in any one of Claims 1-3.

6. A host cell, characterized in that, The host cell contains the gene engineering recombinant expression vector described in Claim 5.

7. A pharmaceutical composition, characterized in that, The pharmaceutical composition contains: the sRNA described in any one of Claims 1-3, the DNA sequence described in Claim 4, the gene engineering recombinant expression vector described in Claim 5 or the host cell described in Claim 6, and a pharmaceutically acceptable excipient.

8. The pharmaceutical composition according to claim 7, wherein, The pharmaceutical composition is a pharmaceutical dosage form suitable for administration by gavage, oral, intravenous, subcutaneous, percutaneous, intramuscular, intra-arterial, intraperitoneal, intralung, intraspinal, intra-articular, intrasynovial, intrathecal, intraventricular, or inhalation routes; and / or, the pharmaceutical composition further includes a drug delivery carrier.

9. Use of the sRNA described in any one of Claims 1-3, the DNA sequence described in Claim 4, the gene engineering recombinant expression vector described in Claim 5, the host cell described in Claim 6 or the pharmaceutical composition described in any one of Claims 7-8 in the preparation of a drug for preventing, treating or improving bone metabolism diseases.

10. Use according to claim 9, characterized in that, The bone metabolism disease is osteoporosis; and / or, the bone metabolism disease is prevented, treated or improved by increasing the expression level or activity of alkaline phosphatase gene; and / or, the bone metabolism disease is prevented, treated or improved by promoting osteoblast differentiation.

Images