Helicoverpa armigera UGT33 gene cluster targeted knockout sgRNA, detection primer and application

Abstract

The invention belongs to the technical field of gene editing, and discloses a cotton bollworm UGT33 gene cluster targeted knockout sgRNA, the sgRNA comprises sgRNA1 and sgRNA2, the sequence of the sgRNA1 is 5 '-, and the sequence of the sgRNA2 is 5'-.

Description

Technical Field

[0001] The present invention belongs to the technical field of gene editing, and specifically relates to an sgRNA for targeted knockout of the Helicoverpa armigera UGT33 gene cluster, a method for constructing a homozygous line of Helicoverpa armigera UGT33 gene cluster knockout mutants based on the sgRNA, detection primers for judging Helicoverpa armigera UGT33 gene cluster knockout mutants, and the application of the sgRNA and detection primers in cultivating new varieties of Helicoverpa armigera. Background Art

[0002] The cotton bollworm (Helicoverpa armigera) belongs to the family Noctuidae of Lepidoptera and is a polyphagous pest with strong adaptability and a wide host range. It can damage more than 200 crops such as cotton (Gossypium spp.), corn (Zea mays), soybean (Glycine max), and tomato (Solanum lycopersicum). Its larvae directly damage the physiological functions of crops by feeding on plant reproductive organs (flower buds, fruits, cotton bolls) and vegetative tissues (leaves, stems), resulting in double losses in yield and quality. Globally, the annual agricultural economic losses caused by the cotton bollworm exceed $5 billion, and it is listed as one of the top ten agricultural pests in the world.

[0003] Plant secondary metabolites (PSMs) are defensive compounds formed by plants during long-term evolution and have broad-spectrum insecticidal activity. Among them, plant-derived furanocoumarin compounds (such as xanthotoxin and imperatorin) have broad-spectrum insecticidal activity and can play an insecticidal role by interfering with the midgut detoxification enzyme system of insects or inducing oxidative stress. Pests such as the cotton bollworm can significantly reduce the toxicity of such compounds through metabolic detoxification mechanisms (such as UGT-mediated glucuronidation reactions). Research shows that the Helicoverpa armigera UGT33 family genes play a key role in the detoxification of furanocoumarins, but the cooperative functions of its gene cluster have not been systematically analyzed.

[0004] Insect detoxification genes (such as UGTs, P450s) are often arranged in clusters in the form of gene clusters, and there is functional redundancy or synergy among members. The traditional single-gene knockout strategy can only partially inhibit detoxification genes, and other members within the gene cluster can compensate for the loss of function through up-regulated expression, resulting in weakened phenotypes or even complete masking. At the same time, the traditional single-gene knockout cannot simulate the gene cluster amplification phenomenon in natural resistance evolution, limiting the predictive ability of pest adaptive evolution. The existing CRISPR / Cas9 strategy relies on single-sgRNA-induced double-strand breaks (DSBs) to generate small insertions / deletions (Indels) through non-homologous end joining (NHEJ). However, the deletion of large chromosomal fragments (>10 kb) requires two synchronous DSB events, and the occurrence probability decreases exponentially with the increase in fragment length. It is reported that the efficiency of the single-sgRNA strategy in inducing 50-kb fragment deletion in Helicoverpa armigera is less than 5%. Summary of the Invention

[0005] In view of the technical problem that the single-sgRNA strategy cannot be stably inherited, the present invention provides an sgRNA for targeted knockout of the UGT33 gene cluster in Helicoverpa armigera, which realizes the precise knockout of large chromosomal fragments (>60 kb, including 12 genes) through the CRISPR / Cas9 technology mediated by dual sgRNAs. And during the construction process, by hybridizing two different editing types, homozygotes in the offspring can be quickly screened out directly through first-generation sequencing, breaking through the functional limitations of single-gene editing, and providing an innovative technical path for pest resistance management.

[0006] To achieve the above object, the present invention adopts the following technical solutions:

[0007] In the first aspect, the present invention provides an sgRNA for targeted knockout of the UGT33 gene cluster in Helicoverpa armigera, and the sgRNA is sgRNA1 and sgRNA2, wherein:

[0008] The sequence of sgRNA1 is: 5’- CCA AAGGAACTCACTTGAATCAC-3’, and this sequence is located at the 462-bp position of the first exon in the coding region of the UGT33J1 gene in Helicoverpa armigera;

[0009] The sequence of sgRNA2 is: 5’- CCA ACATGATCAAATCGAATTTC-3’, and this sequence is located at the 365-bp position of the first exon in the coding region of the UGT33B8 gene in Helicoverpa armigera.

[0010] In the second aspect, the present invention provides a method for constructing a homozygous strain of a Helicoverpa armigera UGT33 gene cluster knockout mutant based on the above-mentioned sgRNA for targeted knockout of the UGT33 gene cluster in Helicoverpa armigera, including the following steps:

[0011] a) Analyze the genes of the Helicoverpa armigera UGT33 family and map them on the chromosome;

[0012] b) Design two sgRNA sequences targeting the first and last genes of the Helicoverpa armigera UGT33 gene cluster;

[0013] c) Synthesize the two sgRNAs in vitro, and microinject the mixture of the two sgRNAs and Cas9 protein into Helicoverpa armigera eggs, rear and hatch them, denoted as the G0 generation;

[0014] d) Mate the G0 generation adults in single pairs of male and female to obtain fertile offspring, denoted as the G1 generation;

[0015] e) Mate the females of the T1 type and the males of the T2 type, as well as the males of the T1 type and the females of the T2 type in the G1 generation respectively to obtain the G2 generation, and mate the adults of the T1 / T2 type, i.e., the homozygous mutant individuals with the UGT33 gene cluster knocked out in the G2 generation to obtain the G3 generation, which is the homozygous strain of the Helicoverpa armigera UGT33 gene cluster knockout mutant.

[0016] Preferably, the Helicoverpa armigera UGT33 gene cluster includes UGT33J1, UGT33B1B, UGT33B1A, UGT33B5, UGT33B7A, UGT33B7C, UGT33B12, UGT33B3, UGT33B2, UGT33B11, UGT33B9A and UGT33B8.

[0017] In the third aspect, the present invention provides detection primer I for judging the Helicoverpa armigera UGT33 gene cluster knockout mutant, and the forward primer sequence of the detection primer I is 5’-CCTGCATTGAGGGAAGGTCA-3’, and the reverse primer sequence is 5’-GACACCCATGGCAGTTACGA-3’.

[0018] In the fourth aspect, the present invention provides detection primer II for judging the Helicoverpa armigera UGT33 gene cluster knockout mutant, and the forward primer sequence of the detection primer II is 5’-GGAGAAGCACCGGCTAATCT-3’, and the reverse primer sequence is 5’-CTGGGAGGAACTGGACGATT-3’.

[0019] In the fifth aspect, the present invention provides detection primer III for judging the Helicoverpa armigera UGT33 gene cluster knockout mutant, and the forward primer sequence of the detection primer III is 5’-CCCTGAAGGAGAAGCACCAG-3’, and the reverse primer sequence is 5’-CTAGCTCTGCTACAGACGGC-3’.

[0020] Sixth aspect, the present invention provides a method for detecting the knockout mutant of the Helicoverpa armigera UGT33 gene cluster by using the above detection primer I, detection primer II, and detection primer III. When detecting the knockout mutant of the Helicoverpa armigera UGT33 gene cluster, if a target band can be amplified by using detection primer I, and no target band can be amplified by using detection primer II and detection primer III, then this individual is a homozygous mutant with a knockout of the Helicoverpa armigera UGT33 gene cluster.

[0021] Specifically, if a band of about 400 bp can be amplified by using detection primer I (taking Plus DNA Marker as an example, the band amplified by detection primer I is between 250 bp and 500 bp. Further, the target band amplified by detection primer I is 386 bp or 423 bp), and no 578 bp band can be amplified by using detection primer II, and no 515 bp band can be amplified by using detection primer III, then this individual is a homozygous mutant with a knockout of the Helicoverpa armigera UGT33 gene cluster.

[0022] Seventh aspect, the present invention provides a kit containing the above sgRNA for targeted knockout of the Helicoverpa armigera UGT33 gene cluster, and detection primer I, detection primer II, and detection primer III for judging the knockout mutant of the Helicoverpa armigera UGT33 gene cluster.

[0023] Eighth aspect, the present invention provides the application of the above sgRNA for targeted knockout of the Helicoverpa armigera UGT33 gene cluster, detection primer I, detection primer II, and detection primer III for judging the knockout mutant of the Helicoverpa armigera UGT33 gene cluster in the cultivation of new varieties of Helicoverpa armigera.

[0024] Ninth aspect, the present invention provides the application of the above sgRNA for targeted knockout of the Helicoverpa armigera UGT33 gene cluster in the preparation of an inhibitor for controlling Helicoverpa armigera.

[0025] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0026] The present invention focuses on the UGT33 gene cluster of Helicoverpa armigera, and realizes the precise knockout of large chromosomal fragments (>60 kb, containing 12 genes) through the double-sgRNA-mediated CRISPR / Cas9 technology, breaking through the functional limitations of single-gene editing. Moreover, during the construction process, by hybridizing two different editing types, homozygotes in the offspring can be quickly and accurately screened by first-generation sequencing, reducing the probability of false positives of homozygotes during the screening process.

[0027] The large-fragment deletion mutant of the UGT33 gene cluster screened by the present invention shows a significantly increased sensitivity to the furanocoumarin substance xanthotoxin, providing a reference molecular target for the development of new insecticides or insect-resistant crops, and at the same time providing an innovative technical path for pest resistance management. Brief Description of the Drawings

[0028] Figure 1 It is a schematic diagram of the screening process for constructing a deletion mutant of the UGT33 gene cluster of Helicoverpa armigera, where: Figure 1 -A is the primer sequence of the target sites of two sgRNAs; Figure 1 -B and Figure 1 -C are the sequencing results of two editing types of T1 and T2; Figure 1 -D is the sequencing result of the homozygous T1 / T2; Figure 1 -E is the construction process of the mutant strain of Helicoverpa armigera; Figure 1 -F is the amplification result of primers I to III for detecting the knockout mutant.

[0029] Figure 2 It is the sensitivity change of Helicoverpa armigera to xanthotoxin after knocking out the UGT33 gene cluster. Detailed Implementation Modes

[0030] The following examples are used to illustrate the present invention, but are not used to limit the protection scope of the present invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art. The test methods in the following examples are all conventional methods unless otherwise specified.

[0031] Example 1

[0032] 1.1 Experimental Materials

[0033] The Helicoverpa armigera SCD background strain was collected from Côte d'Ivoire, Africa in the 1970s and provided by the Insect Molecular Toxicology Laboratory of Nanjing Agricultural University to Henan University in 2019. This strain has been continuously reared indoors without contacting any pesticides for more than 50 years. The rearing conditions are a temperature of 26°C ± 1°C and a photoperiod of 16h:8h (L:D).

[0034] 1.2 Chromosomal Location of the UGT33 Gene Cluster Genes in Helicoverpa armigera

[0035] According to the annotated UGT33 family gene information of Helicoverpa armigera, Bombyx mori, and Spodoptera frugiperda, the Blast function in Geneious prime software was used to annotate and analyze the UGT33 genes of the SCD strain of Helicoverpa armigera reared in this laboratory. It was found that there is a gene cluster at 6.80 - 6.87 M on chromosome 28 in the UGT33 family gene cluster. This gene cluster consists of 12 UGT genes connected end to end. These 12 genes are UGT33J1, UGT33B1B, UGT33B1A, UGT33B5, UGT33B7A, UGT33B7C, UGT33B12, UGT33B3, UGT33B2, UGT33B11, UGT33B9A, and UGT33B8 in sequence.

[0036] 1.3 CRISPR / Cas9 Target Design

[0037] The genes UGT33J1 and UGT33B8 at the head and tail of the UGT33 gene cluster were used as the target sites for sgRNA. According to the principle that the PAM sequence is NGG, two appropriate sgRNA sequences were designed in the exon 1 region of the UGT33J1 gene and the UGT33B8 gene. As Figure 1 shown in -A, the target site sequences of the two sgRNAs are UGT33J1: 5’- CCA AAGGAACTCACTTGAATCAC-3’ ( CCA is the PAM sequence) (SEQ ID NO.1), located at the 365 bp position of the first exon in the coding region; UGT33B8: 5’- CCA ACATGATCAAATCGAATTTC-3’ ( CCA is the PAM sequence) (SEQ ID NO.2), located at the 365 bp position of the first exon in the coding region.

[0038] 1.4 Synthesis of sgRNA and Preparation of Cas9 Protein

[0039] The GeneArt TM Precision sgRNA Synthesis Kit (Thermo Fisher Scientific) kit was used for in vitro synthesis of sgRNA, and the concentration of the purified sgRNA was detected using a NanoDrop TM spectrophotometer. The Cas9 protein was obtained using GeneArt TM Platinum TMCas9 Nuclease (Thermo Fisher Scientific). The final concentration of both sgRNAs in the mixture was 150 ng / μl, and the final concentration of Cas9 protein was 200 ng / μl.

[0040] 1.5 Embryo microinjection

[0041] The SCD strain of Helicoverpa armigera was used as the background strain for gene editing genetic manipulation. According to the photoperiod, new egg-laying cloth was replaced half an hour before turning off the light. After 1 h of egg-laying, egg collection was completed and microinjection began. The eggs on the gauze were placed in disinfected water, gently rinsed, and the eggshells were peeled off. Then, the disinfectant was removed with a vacuum pump, and after rinsing 3 - 5 times with ultrapure water, the water was filtered dry. The eggs were transferred to a 2% agarose solid medium, carefully arranged in three or four rows with a spacing of about 1 mm using forceps, and about 100 eggs in each row were adhered to a glass slide with double-sided tape. The injection needle was prepared. The capillary glass tube was placed on a needle puller, the parameters were set, and after pulling the needle, it was ground to the required thickness for injection with a needle grinder.

[0042] Using the FemtoJet and InjectMan NI 2 microinjection systems, a mixture of approximately 1 nL of Cas9 protein and sgRNA was injected into the eggs of Helicoverpa armigera. The entire injection process was completed within 2 h. After injection, the number of injected eggs was counted. After the eggs turned black, flour was sprinkled on them and they were placed on artificial feed. After growing to the second instar, they were reared individually in Drosophila tubes, and the hatching rate was recorded, which was the G0 generation.

[0043] 1.6 Screening and identification of mutants

[0044] According to Figure 1 -E, the following procedure was used to construct mutant strains: Among 1180 injected eggs, 240 larvae hatched, and the hatching rate was 20.3% (240 / 1180). Among the 240 larvae, 128 developed into adults (G0 generation) (128 / 240, 53%). The female and male adults of the G0 generation were mated in single pairs, and a total of 45 pairs of female and male adults were paired. Among the 45 single pairs, 31 pairs produced fertile offspring (G1 generation).

[0045] Ten second-instar larvae were randomly selected from each of the 31 single pairs for preparing genomic DNA samples. Three pairs of knockout mutant detection primers were designed (as shown in Table 1). PCR amplification was performed using detection primer I. A band of approximately 400 bp appeared in the G1 generation of 3 out of 31 single pairs. The approximately 400 bp fragment was sequenced, and it was confirmed that the deletion of the UGT33 gene cluster was generated and inherited in this single pair. Moreover, the 3 single pairs verified by sequencing had different gene editing types. Among them, the sequence of type T1 was as follows (386 bp): CCTGCATTGAGGGAAGGTCATCCCCGAAATACTTC TTCATCAAAACATTCTGTCTTTCTTCTATGCTCGCAAATAAATATTCCACTGTATATTTCACATACAACTCATTTAGCTTCTCATACATCGTCAGATTGTAGATCCTCATAGCCATGGATTCAGGATACAAAAATGGATGTACCGGAGCTCCAAGCACCTTGTAGTTTTCAAACATTGCTCAAATCGAATTTCTCTTTCAATATCTTTTGCACTTCATCCATTTTCATTTGATATCCAAAAACATCGACCATCATTAGCATAGCTGTTTGTATCTGTTTAACTATATCACCGCGGCCTGTGGCTATTTCTTCGTGTAGTACTTTCAAAAAT T CGTAACTGCCATGGGTGTC (SEQ ID NO.3);

[0046] The T2 type sequence is as follows (423bp): CCTGCATTGAGGGAAGGTCA TCCCCGAAATACT TCTTCATCAAAACATTCTGTCTTTCTTCTATGCTCGCAAATAAATATTCCACTGTATATTTCACATACAACTCATTTAGCTTCTCATACATCGTCAGATTGTAGATCCTCATAGCCATGGATTCAGGATACAAAAATGGATGTACCGGAGCTCCAAGCACCTTGTAGTTTTCAAACATCGCTCCAAAGATTCAGTATCAATGTTGTTCTCACACAAGATCAAATCGAATTTCTCTTTCAATATCTTTTGCACTTCATCCATTTTCATTTGATATCCAAAAACATCGACCATCATTAGCATAGCTGTTTGTATCTGTTTAACTATATCACCGCGGCCTGTGGCTATTTCTTCGTGTAGTACTTTCAAAAAT TCGTAACTGCCATGGGTG TC (SEQ ID NO.4).

[0047] Table 1 Primers for detecting knockout mutants

[0048]

[0049]

[0050] Select a single pair of two gene editing types of T1 and T2 and rear their larvae until pupation. After pupation, extract genomic DNA from the exuviae of the last instar larvae, perform PCR amplification using detection primer I, and then perform first-generation sequencing, as Figure 1 shown in -B to 1-C. Among 96 pupae of the single pair of G1 generation with the T1 gene editing type, 26 T1-type individuals (13 females and 13 males) were detected. Among 144 pupae of the single pair of G1 generation with the T2 gene editing type, 24 T2-type individuals (16 females and 8 males) were detected.

[0051] Mate 13 female adults of the T1 type with 8 male adults of the T2 type, and conversely, mate 13 male adults of the T1 type with 16 female adults of the T2 type to produce the G2 generation. Genotype the 292 effectively detected G2-generation individuals. The homozygous type is T1 / T2 ( Figure 1 D). Its characteristic is that the forward sequencing starts with a "single peak" and becomes a "double peak" after the editing site, indicating that one chromosome of this Helicoverpa armigera individual has a deletion of the UGT33 gene cluster of the T1 type, and the other chromosome has a deletion of the UGT33 gene cluster of the T2 type. Together, it is a homozygous mutant with a deletion of the UGT33 gene cluster. Among 292 pupae, 28 homozygotes (T1 / T2) were detected (15 females and 13 males).

[0052] Mate the 28 homozygotes to produce the G3 generation. After the egg-laying is completed, extract the genomic DNA of the parents to detect the genotype, which is all homozygous of the T1 / T2 type. Randomly select 10 early second-instar larvae of the G3 generation as a mixed sample, select 8 samples with a total of 80 larvae, and use detection primers I to III for detection. The results show that for all single-pair offspring, only detection primer I can amplify a band of about 400 bp (after further sequencing, the amplified sequence is 386 bp or 423 bp), while detection primers II and III cannot amplify the target band ( Figure 1 -F). Keep the offspring produced by the T1 / T2 homozygous parents for breeding to produce a homozygous line of gene cluster knockout mutants, named SCD-d33c.

[0053] Example 2: Psoralen Bioassay

[0054] The mixed poisoning method was used to detect the changes in the sensitivity of the knockout strain SCD-d33c and the background strain SCD to xanthotoxin. Xanthotoxin was accurately weighed according to the concentration gradient and evenly mixed in 100 g of artificial diet for Helicoverpa armigera. The mixed artificial diet was dispensed into 24-well plates. One newly hatched larva of Helicoverpa armigera was picked into each well, and covered with a layer of plastic wrap and two layers of black cloth to prevent the test insects from escaping. There were two plates for each concentration. It was placed in a constant temperature and light incubator (temperature 26°C ± 1°C, humidity 60% ± 10%, photoperiod 16 h: 8 h) for feeding. After 7 days, when the blank control grew to about half, about the middle of the 4th instar, and about the end of the 4th instar, the results were checked. Larvae that died or could not grow to the 3rd instar were all recorded as dead. The PoloPlus software was used to analyze the bioassay data. Calculate the LC 50 value, the 95% confidence limit of LC 50 and the slope of the two strains. If the 95% confidence limits of the LC 50 of the two strains do not overlap, it is recorded that the sensitivity difference between the two strains is significant. The sensitivity multiple is the ratio of the LC 50 of the SCD strain to the LC 50 of the SCD-d33c strain. The results are as shown in Figure 2 . The results show that: compared with the strain SCD, the sensitivity of the strain SCD-d33c to xanthotoxin is significantly improved. Its LC 50 value decreased from 5.80 mg / g to 2.88 mg / g, a decrease of 2.01 times, and the 95% confidence limits of the LC 50 of the two strains do not overlap, indicating that the knockout of the UGT33 gene cluster significantly improves the sensitivity of Helicoverpa armigera to xanthotoxin.

[0055] The above-mentioned embodiments are only the preferred embodiments of the present invention, which are only used to explain the present invention and do not limit the scope of implementation of the present invention. For those skilled in the art of this technology, of course, other implementation methods can be easily made by means of substitution or change according to the technical content disclosed in this specification. Therefore, all changes and improvements made on the principle of the present invention should be included within the scope of the patent application of the present invention.

Claims

1. An sgRNA for targeted knockout of the Helicoverpa armigera UGT33 gene cluster, characterized in that, The sgRNAs are sgRNA1 and sgRNA2, where: The sequence of sgRNA1 is: 5’- CCA AAGGAACTCACTTGAATCAC-3’, and this sequence is located at the 462bp position of the first exon in the coding region of the Helicoverpa armigera UGT33J1 gene; The sequence of sgRNA2 is: 5'- CCA ACATGATCAAATCGAATTTC-3', and this sequence is located at the 365bp position of the first exon in the coding region of the Helicoverpa armigera UGT33B8 gene.

2. The method for constructing a homozygous line of knockout mutants of the Helicoverpa armigera UGT33 gene cluster according to the sgRNA of claim 1, characterized in that, It includes the following steps: a) Analyze the UGT33 family genes of Helicoverpa armigera and map them on chromosomes; b) Design two sgRNA sequences for targeted knockout of the head and tail genes of the UGT33 family gene cluster of Helicoverpa armigera; c) Synthesize two sgRNAs in vitro, and microinject the mixture of the two sgRNAs and Cas9 protein into Helicoverpa armigera eggs, rear and hatch them, denoted as the G0 generation; d) Mate the G0 generation adults in single pairs of male and female to obtain fertile offspring, denoted as the G1 generation; e) Mate the females of the T1 type and the males of the T2 type in the G1 generation, and the males of the T1 type and the females of the T2 type respectively to obtain the G2 generation. Mate the adults of the T1 / T2 type, that is, the homozygous mutant individuals with the UGT33 gene cluster knocked out in the G2 generation to obtain the G3 generation, which is the homozygous strain of the Helicoverpa armigera UGT33 gene cluster knockout mutant.

3. The method according to claim 2, wherein The Helicoverpa armigera UGT33 family gene cluster includes UGT33J1 , UGT33B1B , UGT33B1A , UGT33B5 , UGT33B7A , UGT33B7C , UGT33B12 , UGT33B3 , UGT33B2 , UGT33B11 , UGT33B9A and UGT33B8 .

4. Detection primer I for the knockout mutant of the Helicoverpa armigera UGT33 gene cluster, characterized in that, The forward primer sequence of the detection primer I is 5’-CCTGCATTGAGGGAAGGTCA-3’, and the reverse primer sequence is 5’-GACACCCATGGCAGTTACGA-3’.

5. Detection primer II for the knockout mutant of the Helicoverpa armigera UGT33 gene cluster, characterized in that, The forward primer sequence of the detection primer II is 5’-GGAGAAGCACCGGCTAATCT-3’, and the reverse primer sequence is 5’-CTGGGAGGAACTGGACGATT-3’.

6. Detection primer III for the knockout mutant of the Helicoverpa armigera UGT33 gene cluster, characterized in that, The forward primer sequence of the detection primer III is 5’-CCCTGAAGGAGAAGCACCAG-3’, and the reverse primer sequence is 5’-CTAGCTCTGCTACAGACGGC-3’.

7. A method for detecting the knockout mutant of the Helicoverpa armigera UGT33 gene cluster using the detection primer I, detection primer II, and detection primer III described in claims 4 to 6, characterized in that, When detecting the Helicoverpa armigera UGT33 gene cluster knockout mutant, if the target band can be amplified using the detection primer I, and the target band cannot be amplified using the detection primer II and the detection primer III, then this individual is the Helicoverpa armigera UGT33 gene cluster knockout homozygous mutant.

8. A kit containing the sgRNA for targeted knockout of the Helicoverpa armigera UGT33 gene cluster described in claim 1, and the detection primer I, detection primer II, and detection primer III described in claims 4 - 6.

9. Application of the sgRNA for targeted knockout of the Helicoverpa armigera UGT33 gene cluster described in claim 1, and the detection primer I, detection primer II, and detection primer III described in claims 4 - 6 in cultivating new varieties of Helicoverpa armigera.

10. Application of the sgRNA for targeted knockout of the Helicoverpa armigera UGT33 gene cluster described in claim 1 in preparing an inhibitor for controlling Helicoverpa armigera.

Images