Soybean root specific promoter Pmlp43 and application thereof
By cloning the soybean root-specific promoter Pmlp43, the problem of lack of temporal and air-conditioning and biosafety risks in the prior art was solved, soybean root-specific gene expression was achieved, and the accuracy and safety of breeding were improved.
Patent Information
- Application Number
- CN202510566176.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-30
- Publication Date
- 2025-07-25
AI Technical Summary
The lack of accurate temporal and air-conditioning capabilities in existing plant genetic engineering leads to continuous overexpression of genes, affecting the normal growth and development of plants. At the same time, there is a biosafety risk for promoters from foreign viruses.
The soybean root-specific promoter Pmlp43 was developed, and the promoter was cloned from the soybean genome by designing specific primers and ligating it with recombinant vectors to construct recombinant bacteria and introduce it into soybean plants to achieve root-specific expression.
The specific gene expression of soybean roots is achieved, energy loss in non-target sites is avoided, and the accuracy and biosafety of genetically engineered breeding are improved.
Smart Images
Figure CN120366307A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of plant genetic engineering, and particularly relates to a root-specific promoter Pmlp43 of soybean and its application. Background Art
[0002] As the core organ for plant material exchange and signal perception, the development of its specific regulatory elements has become a key breakthrough point in crop molecular design breeding. It is of great significance for improving crop root morphology, nutrient absorption, abiotic stresses such as salinity and drought, and traits such as root diseases and pests by using engineering techniques.
[0003] The promoter upstream of a gene, as the core element of gene expression regulation, precisely controls gene transcriptional activity through spatio-temporal specificity and environmental responsiveness regulatory mechanisms. In the research of plant gene functions and the practice of genetic improvement, the development and application of highly active promoters have important value. Currently, the plant genetic engineering field mainly relies on constitutive strong promoter systems, such as the cauliflower mosaic virus (CaMV) 35S promoter and the maize Ubiquitin (Ubi) promoter, but their applications have significant limitations: on the one hand, the 35S promoter derived from exogenous viruses may cause biosafety risks such as gene drift; on the other hand, the endogenous constitutive promoters in plants lack precise spatio-temporal regulation ability, which easily leads to continuous overexpression of the target gene, resulting in negative effects such as abnormal protein accumulation and metabolic imbalance, and ultimately affecting the normal growth and development of plants. These technical bottlenecks severely restrict the expected effects of functional genes in the directional improvement of crops. Therefore, the isolation, identification, and acquisition of novel promoters with tissue-specific or inducible expression characteristics have become the key breakthrough points for enhancing the precise regulation ability of plant genes and ensuring the safety of transgenic organisms. Summary of the Invention
[0004] The purpose of the present invention is to provide a root-specific promoter Pmlp43 of soybean.
[0005] In order to achieve the above invention purpose, the present invention provides the following technical solutions:
[0006] The present invention provides a root-specific promoter Pmlp43 of soybean, and the nucleotide sequence of the root-specific promoter Pmlp43 is as shown in SEQ ID NO.1.
[0007] The present invention provides a primer set for cloning the above root-specific promoter Pmlp43. The primer set includes Pmlp43-F1 and Pmlp43-R1. The sequence of Pmlp43-F1 is as shown in SEQ ID NO.2, and the sequence of Pmlp43-R1 is as shown in SEQ ID NO.3.
[0008] The present invention provides a kit containing the above primer set.
[0009] The present invention provides a method for constructing the root-specific promoter Pmlp43, comprising the following steps: using the promoter sequence of the soybean Glyma.08G230500.1 gene as a template, and performing PCR amplification with the above primer set to obtain a sequence fragment of the root-specific promoter Pmlp43.
[0010] The present invention provides a recombinant vector containing the above root-specific promoter Pmlp43.
[0011] The present invention provides a method for constructing the recombinant vector, comprising the following steps: ligating the digested pCAMBIA3300 vector with the above root-specific promoter Pmlp43 to obtain the recombinant vector.
[0012] The present invention provides a recombinant bacterium containing the above recombinant vector.
[0013] The present invention provides the application of the root-specific promoter Pmlp43, or the kit, or the recombinant vector, or the recombinant bacterium in the tissue-specific expression of plant roots.
[0014] The present invention provides a method for constructing a transgenic soybean plant, comprising the following steps:
[0015] (1) Infecting a target soybean plant with the above recombinant bacterium, and then inducing adventitious buds;
[0016] (2) Inoculating the adventitious buds onto a bud elongation medium and culturing until the bud length reaches 3-5 cm, and then inoculating onto a rooting medium and continuing the culture to obtain a transgenic soybean plant with tissue-specific expression in the stem.
[0017] Preferably, step (1) is carried out in an induction medium, and the induction medium uses water as a solvent and consists of components with the following mass concentrations: B5 salt 3.1-3.4 g / L, sucrose 28-32 g / L, MES 0.4-0.65 g / L, BAP 1.5-1.8 mg / L, cefotaxime 240-260 mg / L, Timentin 90-110 mg / L, glufosinate 5-6 mg / L, and agar powder 6-10 g / L.
[0018] Preferably, the shoot elongation medium uses water as a solvent and consists of components with the following mass concentrations: MS salts 4.2 - 4.6 g / L, sucrose 28 - 32 g / L, MES 0.4 - 0.65 g / L, aspartic acid 48 - 52 mg / L, L-glutamic acid 48 - 52 mg / L, IAA 0.08 - 0.12 mg / L, GA3 0.4 - 0.6 mg / L, zeatin riboside 0.9 - 1.1 mg / L, cefamycin 240 - 260 mg / L, Timentin 90 - 110 mg / L, glufosinate 5 - 6 mg / L, and agar powder 6 - 10 g / L.
[0019] Preferably, the rooting medium uses water as a solvent and consists of components with the following mass concentrations: MS salts 4.2 - 4.6 g / L, sucrose 18 - 22 g / L, MES 0.4 - 0.65 g / L, aspartic acid 48 - 52 mg / L, L-glutamic acid 48 - 52 mg / L, IBA 0.8 - 1.2 mg / L, and phytagel 2 - 4 g / L.
[0020] By adopting the above technical solutions, the present invention has the following beneficial effects:
[0021] In the present invention, the root-specifically expressed gene Glyma.08G230500.1 was screened based on the soybean transcriptome database. Specific primers were designed through genomic sequence analysis, and the root-specific promoter Pmlp43 fragment of this gene was successfully cloned from the genomic DNA of the soybean variety Williams 82. The obtained Pmlp43 promoter sequence was constructed into a fusion expression vector pCAMBIA3300 - Pmlp43 - DsRed with the red fluorescent protein reporter gene DsRed, and transgenic soybean plants were obtained by genetic transformation technology and introduced into the target plant soybean.
[0022] Experiments showed that the Glyma.08G230500.1 gene had the highest expression abundance in soybean roots, and the DsRed fluorescence signal was specifically limited to the roots of transgenic soybean plants. Compared with the prior art, the identified Pmlp43 promoter in the present invention has a significant root tissue specificity advantage. The present invention overcomes the current situation of the lack of endogenous specific promoters in soybeans and has important application value in analyzing gene functions and genetic engineering breeding. BRIEF DESCRIPTION OF THE DRAWINGS
[0023] Figure 1 It is a graph showing the RT-qPCR detection results of the Glyma.08G230500.1 gene in different tissue parts;
[0024] Figure 2 It is a PCR gel electrophoresis result graph for cloning the promoter Pmlp43;
[0025] Figure 3 Prediction result diagram of cis - acting elements of root - specific promoter Pmlp43;
[0026] Figure 4 Structural diagram of pCAMBIA3300 - Pmlp43 - DsRed recombinant vector;
[0027] Figure 5 Diagram of red fluorescence results in different parts of pCAMBIA3300 - Pmlp43 - DsRed transgenic soybean plants. Specific implementation manners
[0028] The present invention provides a root-specific promoter Pmlp43 of soybean. The nucleotide sequence of the root-specific promoter Pmlp43 is shown as SEQ ID NO.1, and the specific sequence is CTCTTCCAATTCATCTGATACACCATCTAGAGAAAGAGTTTGGAAAAACCAAAACAAAGCAACTCTTTCATGACAATGACTGAAAGTATAATTTGATTTTTGTTTTTCCGCATTTTGTTAATGACATGTGTTTTTTTTTGTAGTATGTAACATTATAGGTTAAAAAATTTAGTCTAACATAACCCAAAATTGCTAACAAGTTTGTGATATATATTATTCTCTTTTATGATTGTGATGTCTTTTTTATAGCGAGGAGAATAAATAAAATGTGTTATATATATATATATATACTTTTTAGATTGATTATATATTTTTATAATCTATCTACAAAAATTAATTTTTTAGATCACTTATCTAAAGAAATAGATCTAAAATAGTATGTTTTTAGAATGATCACTTAAACAAATTTTTAGAATGTTCGTGCAATCGTTGTAAAACAGATATTTAAAAATTAATGAAAGCTGGTTCCAAGGCAACCCGATGTGAATGGTCTAAATAGCTAGAAGGTATGAGCTAATTAGCCAACGAACGGAATTAGTCCACGTACAGATCAACAATGCAATTTAACTTTGTAACTAAACATGGGTTATATTTCTTTTATATTTCAAATAATTTTTAAAAACTATAATATTACAATTTTTATTATTTTAAATATTATTAATATCTTACGTGTATAAGCAACGGATACAAGTTATCACCGACGGACATGTCAGTGTTTTCCATTAACAATTGGATGATATATTAACAATGACGTAGAGTTGCTTAATTTTAGAAAGTTAGAGGAATAATGTGTAATTAAATTTTTATAGGAATCCAAATTGCATATTTATAAAACTTTTATAGGAATCCAAATTGAATTTAAGAATTTTTTATTGCGAGTTCATTTTCTAAAAAAGTTTTTCAAGAAGTTTTAAAATATATAATAGATAAGTATAGAAACAACATTTTTCTATAAAAGTAAAAGAAAAGAGAGACGAAGATAATAATAAATATTTCATATTAAGTGATAAAAATCATAAATTAAATAGTAAAACTTATTGCTGATAAAAAAAATTGCATTCTAAAATATAAAAAATAAAAATTTAGTAACAGACTTATATGTATAATTGGCCTGGAATATATGTCAATTACTAAATTTGGAATTTTCAAAATAAAATGATTAGGTACTTTTTTTTCTTGTAGGGTGTTGAAATATGGACCCTACCATAGATTAATTATTTAGTTATTAGGAGTGGGCAAATTATATTCTATATAAGTGGGATTTGGTCTCACTATTTTTTCCCATCTCCCATCCTTTGTTTGTTGATCCATCTCTTGTTTCTTGCTTTCTTTCTTCACC。
[0029] The present invention also provides a primer set for cloning the above-mentioned root-specific promoter Pmlp43. The primer set includes Pmlp43-F1 and Pmlp43-R1. The sequence of Pmlp43-F1 is shown in SEQ ID NO.2, and the specific sequence is 5’-TGGGAACAAGTGGGAGAATG-3’; the sequence of Pmlp43-R1 is shown in SEQ ID NO.3, and the specific sequence is 5’-GGTGAAGAAAGAAAGCAAGA-3’.
[0030] The present invention also provides a kit containing the above-mentioned primer set.
[0031] The present invention also provides a construction method of the root-specific promoter Pmlp43, including the following steps: using the promoter sequence of the soybean Glyma.08G230500.1 gene as a template, and performing PCR amplification with the above-mentioned primer set to obtain a sequence fragment of the root-specific promoter Pmlp43.
[0032] In the present invention, the sequence of the soybean Glyma.08G230500.1 gene is shown in SEQ ID NO.6, and the specific sequence is ATGTCACTTGCTGGGAAAATCACCACTGAAATCGGGGTTCATGCAACC GCTACAAAGTGGTTCAACCTCTTCGCAACACAACTCCATCATGTTCAAAACCTAACTGATAGAGTGCATGGAACCAAGCTGCATCAAGGTGAAGACTGGCATCACAACGAGACAGTCAAGCACTGGACTTATACCATAGATGGTAAGGTTACAACATGTCTGGAGAGTATTGAATCCATTGATGAACAGAGCAAAACAATCACCTACAAGCTCTTCAGTGGTGACATTGATCATAATTATAAGAACTTTAAGTTCATCTTTCAAGCCATTGATGATAATGATCATGGCGGTACTATTATCAAATGGACCGTTGAATACGAGAGGCTTCGTGAGGAGGTTGATCCTCCATATGGCCACATTGAATACCTGCACAAATGCACTAAAGATATTGATGGTCATCTTCTCAAAGCATAG.
[0033] In the present invention, the PCR amplification system includes 25 μL of high-fidelity enzyme mix, 2 μL of template, 1 μL of primer Pmlp43-F, 1 μL of primer Pmlp43-R, and ddH2O is added to make up to 50 μL.
[0034] In the present invention, the PCR amplification program is 95°C for 3 min; (95°C for 30 sec; 60°C for 30 sec; 72°C for 2 min;) 30 cycles; 72°C for 10 min.
[0035] The present invention provides a recombinant vector containing the above-mentioned root-specific promoter Pmlp43.
[0036] The present invention provides a method for constructing the recombinant vector, which includes the following steps: ligating the digested pCAMBIA3300 vector with the above-mentioned root-specific promoter Pmlp43 to obtain the recombinant vector.
[0037] The present invention provides a recombinant bacterium containing the above-mentioned recombinant vector.
[0038] The present invention provides the application of the above-mentioned root-specific promoter Pmlp43, or the kit, or the recombinant vector, or the recombinant bacterium in plant root tissue-specific expression.
[0039] The present invention provides a method for constructing a transgenic soybean plant, which includes the following steps:
[0040] (1) Infecting the target soybean plant with the above-mentioned recombinant bacterium, and then inducing adventitious buds;
[0041] (2) Inoculating the adventitious buds into a bud elongation medium and culturing until the bud length reaches 3-5 cm, and then inoculating into a rooting medium and continuing to culture to obtain a transgenic soybean plant with stem tissue-specific expression.
[0042] In the present invention, step (1) is carried out in an induction medium for induction. The induction medium uses water as a solvent, 优选的 and is composed of components with the following mass concentrations: 3.1-3.4 g / L of B5 salt, 28-32 g / L of sucrose, 0.4-0.65 g / L of MES, 1.5-1.8 mg / L of BAP, 240-260 mg / L of cephalosporin, 90-110 mg / L of Timentin, 5-6 mg / L of glufosinate, and 6-10 g / L of agar powder; further preferably, 3.21 g / L of B5 salt, 30 g / L of sucrose, 0.59 g / L of MES, 1.67 mg / L of BAP, 250 mg / L of cephalosporin, 100 mg / L of Timentin, 5-6 mg / L of glufosinate, and 8 g / L of agar powder.
[0043] In the present invention, the bud elongation medium uses water as a solvent and preferably consists of components with the following mass concentrations: MS salts 4.2 - 4.6 g / L, sucrose 28 - 32 g / L, MES 0.4 - 0.65 g / L, aspartic acid 48 - 52 mg / L, L - glutamic acid 48 - 52 mg / L, IAA 0.08 - 0.12 mg / L, GA3 0.4 - 0.6 mg / L, zeatin riboside 0.9 - 1.1 mg / L, cefamycin 240 - 260 mg / L, Timentin 90 - 110 mg / L, glufosinate 5 - 6 mg / L, and agar powder 6 - 10 g / L; more preferably, it is MS salts 4.43 g / L, sucrose 30 g / L, MES 0.59 g / L, aspartic acid 50 mg / L, L - glutamic acid 50 mg / L, IAA 0.1 mg / L, GA3 0.5 mg / L, zeatin riboside 1.0 mg / L, cefamycin 250 mg / L, Timentin 100 mg / L, glufosinate 5 - 6 mg / L, and agar powder 8 g / L.
[0044] In the present invention, the rooting medium uses water as a solvent and preferably consists of components with the following mass concentrations: MS salts 4.2 - 4.6 g / L, sucrose 18 - 22 g / L, MES 0.4 - 0.65 g / L, aspartic acid 48 - 52 mg / L, L - glutamic acid 48 - 52 mg / L, IBA 0.8 - 1.2 mg / L, and phytagel 2 - 4 g / L; more preferably, it is MS salts 4.43 g / L, sucrose 20 g / L, MES 0.59 g / L, aspartic acid 50 mg / L, L - glutamic acid 50 mg / L, IBA 1.0 mg / L, and phytagel 3 g / L.
[0045] The technical solutions provided by the present invention will be described in detail below in conjunction with examples, but they should not be construed as limiting the protection scope of the present invention.
[0046] The soybean variety Williams 82 described in the present invention can be obtained from the National Crop Germplasm Resources Platform (website: http: / / www.cgris.net / home).
[0047] Example 1 Transcription levels of the Glyma.08G230500.1 gene in different tissues
[0048] Total RNA was separately extracted from the root, leaf, stem, pod, seed and other tissue samples of soybean plants at the mature stage, transcribed into cDNA, and specific primers Glyma.08G230500.1-F1 and Glyma.08G230500.1-R1 were designed. Then, real-time quantitative PCR was performed using the specific primers to verify the expression levels of Glyma.08G230500.1 in different tissues and organs of soybean. The detection instrument was ABI PRISM 7500Fast Real-Time PCR System (Applied Biosystems, CA, USA), and the internal reference gene was GmACT6 (GenBank No. NM_001289231). The relative expression levels of the genes were detected using the 2 –ΔΔCT (Livak) method.
[0049] The sequence of the soybean Glyma.08G230500.1 gene described in the present invention is shown in SEQ ID NO.6. The sequence of Glyma.08G230500.1-F1 is shown in SEQ ID NO.4, and the specific sequence is 5’-ACGAGACAGTCAAGCACTGG-3’; the sequence of Glyma.08G230500.1-R1 is shown in SEQ ID NO.5, and the specific sequence is 5’-CCTCTCGTATTCAACGGTCCAT-3’.
[0050] The RT-qPCR program was as follows: 94°C, 10 min; (94°C, 45 s; 60°C, 45 s; 72°C, 30 s) for 35 cycles; 72°C, 10 min.
[0051] The RT-qPCR system consisted of 10 μL of SYBR Green PCR MasterMix, 2 μL of cDNA template, 0.2 μL of primer Glyma.08G230500.1-F1, 0.2 μL of primer Glyma.08G230500.1-R1, and ddH2O was added to make up to 20 μL.
[0052] The results showed that the expression level of the Glyma.08G230500.1 gene was the highest in the root, and almost no expression was detected in other tissues such as leaves and stems (as Figure 1 ), which was consistent with the transcriptome data, confirming the root-specific expression characteristics of the Glyma.08G230500.1 gene.
[0053] Example 2 Cloning of the promoter Pmlp43 of the Glyma.08G230500.1 gene
[0054] Specific primers were designed according to the promoter sequence of soybean Glyma.08G230500.1 genome, and then PCR amplification was carried out. The amplified products were electrophoretically separated on 1% agarose gel (the electrophoresis results are as Figure 2 shown). The agarose gel containing the target fragment was cut and collected into a centrifuge tube, recovered using the Omega Gel Extraction Kit, and cloned onto the pEASY-Blunt vector (purchased from Beijing TransGen Biotech Co., Ltd.), transformed into competent cells DH5α, positive clones were obtained through antibiotic screening, and after verification by colony PCR, it was sent for sequencing to confirm that the inserted DNA fragment was 1548 bp. After the sequence comparison was correct, the inventor named this sequence fragment as the root-specific promoter Pmlp43.
[0055] The specific primers designed in the present invention include Pmlp43-F1 and Pmlp43-R1. The sequence of Pmlp43-F1 is as shown in SEQ ID NO.2, and the specific sequence is 5’-TGGGAACAAGTGGGAGAATG-3’; the sequence of Pmlp43-R1 is as shown in SEQ ID NO.3, and the specific sequence is 5’-GGTGAAGAAAGAAAGCAAGA-3’.
[0056] The PCR amplification system of the present invention is as follows: including 25 μL of high-fidelity enzyme mix, 2 μL of template, 1 μL of primer Pmlp43-F1, 1 μL of primer Pmlp43-R1, and ddH2O was added to make up to 50 μL. The PCR amplification program of the present invention is as follows: 95°C, 3 min; (95°C, 30 sec; 60°C, 30 sec; 72°C, 2 min;) 30 cycles; 72°C, 10 min.
[0057] The system of the colony PCR amplification of the present invention includes 10 μL of 2X PCR MasterMix, 1 μL of template, 1 μL of forward primer, 1 μL of reverse primer, and ddH2O was added to make up to 20 μL. The program of colony PCR amplification is 95°C, 3 min; (95°C, 30 sec; 60°C, 30 sec; 72°C, 2 min;) 30 cycles; 72°C, 10 min. The forward primer used therein is the same as the sequence of Pmlp43-F1, and the reverse primer is the same as the sequence of Pmlp43-R1.
[0058] Example 3 Analysis of cis-acting elements of promoter Pmlp43
[0059] The PlantPAN 4.0 online software was used to analyze the cis-acting elements of the promoter Pmlp43 sequence obtained in Example 2.
[0060] The results showed that the Pmlp43 promoter sequence contains cis - acting elements such as CCAT - box, ABRE, TC - rich repeats, ARE, and WUN - motif (as Figure 3 shown).
[0061] The sequence of the CCAT - box is as shown in SEQ ID NO.7, and the specific sequence is ACGTGGC; the sequence of the ABRE is as shown in SEQ ID NO.8, and the specific sequence is ACGTGGC; the sequence of the TC - rich repeats is as shown in SEQ ID NO.9, and the specific sequence is ATTTCTCTTCT; the sequence of the ARE is as shown in SEQ ID NO.10, and the specific sequence is GGTTT; the sequence of the WUN - motif is as shown in SEQ ID NO.11, and the specific sequence is AAATTTCCT.
[0062] Example 4 Obtaining of transgenic soybeans containing the pCAMBIA3300 - Pmlp43 - DsRed recombinant vector
[0063] After double - digesting the pCAMBIA3300 vector (purchased from Beijing TransGen Biotech Co., Ltd.) with EcoRⅠ and HindⅢ, it was ligated with the red fluorescent protein reporter gene DsRed, and pCAMBIA3300 - DsRed was obtained by optimization.
[0064] The Pmlp43 promoter fragment of Glyma.08G230500.1 cloned on the pEASY - Blunt vector was seamlessly inserted into the pCAMBIA3300 - DsRed expression vector to obtain the pCAMBIA3300 - Pmlp43 - DsRed recombinant vector (as Figure 4 ).
[0065] Agrobacterium - mediated transformation was used. The pCAMBIA3300 - Pmlp43 - DsRed recombinant vector was introduced into Agrobacterium tumefaciens EHA105 (purchased from Beijing TransGen Biotech Co., Ltd.) to obtain recombinant Agrobacterium. The specific transformation process is as follows:
[0066] (1) Pick a single colony of Agrobacterium tumefaciens EHA105 and inoculate it into 5 mL of YEP liquid medium (50 - 100 mg / L spectinomycin, 25 mg / L rifampicin), and culture it overnight at 28 °C. The next day, expand the culture in 50 mL of YEP medium until OD 600nmwas 0.6 - 0.8. After centrifuging the bacterial cells at 3000 rpm for 10 min, they were resuspended in the liquid co-culture medium (components: 0.321 g / L of B5 salts, 30 g / L of sucrose, 3.9 g / L of MES, 1.67 mg / L of BAP, 0.25 mg / L of GA3, 400 mg / L of cysteine, 154.2 mg / L of DTT, and 200 μmol / L of AS, pH 5.4), and the OD 600nm was adjusted to 0.5 for use.
[0067] (2) Agrobacterium infection
[0068] Use a scalpel to cut open the Jiyu 86 soybean seeds along the hilum part of the soybean, remove the skin, make a slight scratch at the cotyledon node position, and then place the prepared explants in the resuspended Agrobacterium for infection for 30 min. Transfer the infected explants to the co-culture medium (components: 0.321 g / L of B5 salts, 30 g / L of sucrose, 3.9 g / L of MES, 1.67 mg / L of BAP, 0.25 mg / L of GA3, 400 mg / L of cysteine, 154.2 mg / L of DTT, 200 μmol / L of AS, and 5 g / L of agar powder, pH 5.4), and culture them in the dark at 23°C for 4 d.
[0069] (3) Adventitious bud induction
[0070] After the explants were co-cultured for 4 d, transfer the explants to the induction medium (components: 3.21 g / L of B5 salts, 30 g / L of sucrose, 0.59 g / L of MES, 1.67 mg / L of BAP, 250 mg / L of cefotaxime, 100 mg / L of Timentin, 5 - 6 mg / L of glufosinate, and 8 g / L of agar powder, pH 5.7). The adaxial surface of the cotyledon node and hypocotyl parts of the explants should be inserted into the medium facing upwards and at a 45° angle to the horizontal plane, and culture them under the conditions of 25°C and a 16 / 8 h light / dark cycle for about 2 weeks. Take out the explants, cut off the excess hypocotyl part, leaving only 5 mm, and then transfer the explants to fresh induction medium and continue to culture for 2 weeks under the same culture conditions.
[0071] (4) Bud elongation
[0072] Transfer the induced multiple buds (removing the cotyledon part of the tissue) to the bud elongation medium (components: 4.43 g / L of MS salts, 30 g / L of sucrose, 0.59 g / L of MES, 50 mg / L of asparagine, 50 mg / L of L-glutamic acid, 0.1 mg / L of IAA, 0.5 mg / L of GA3, 1.0 mg / L of zeatin riboside, 250 mg / L of cefotaxime, 100 mg / L of Timentin, 5 - 6 mg / L of glufosinate, and 8 g / L of agar powder, pH 5.7) for culture. The culture conditions are 25°C and a 16 / 8 h light / dark cycle. Subculture once every 2 weeks.
[0073] (5) Rooting
[0074] When the resistant buds grow to 3 - 5 cm, cut them off, soak them in IBA (1 mg / L) for 30 s, and then transfer them to the rooting medium (the components are 4.43 g / L of MS salts, 20 g / L of sucrose, 0.59 g / L of MES, 50 mg / L of asparagine, 50 mg / L of L - glutamic acid, 1.0 mg / L of IBA, and 3 g / L of phytagel, pH 5.6) for continuous culture. Transplant them to the greenhouse for growth and fruiting when strong roots grow out.
[0075] Using the specific primers of promoter Pmlp43, perform PCR detection on the T1 generation transgenic soybeans. After combining with herbicide screening and obtaining the transgenic soybeans containing pCAMBIA3300 - Pmlp43 - DsRed, observe the red fluorescence.
[0076] Example 5
[0077] Adopt the LUYOR - 3415RG dual - wavelength fluorescence imaging system to perform tissue - specific expression analysis on the T1 generation transgenic soybeans of pCAMBIA3300 - Pmlp43 - DsRed, and observe the red fluorescence in different parts of the pCAMBIA3300 - Pmlp43 - DsRed transgenic soybean plants.
[0078] The results show that there is red fluorescence only in the roots of the transgenic soybean plants (as Figure 4 shown), indicating that the promoter Pmlp43 is specifically expressed in the root tissue.
[0079] In summary, it can be seen that the technical solution of the present invention successfully cloned the root - specific promoter Pmlp43 fragment from the genomic DNA of the soybean variety Williams 82, and further obtained the transgenic soybean plants containing the expression vector pCAMBIA3300 - Pmlp43 - DsRed. In the present invention, it is verified that the gene Glyma.08G230500.1 has the highest expression abundance in the roots of soybeans, and the DsRed fluorescence signal is specifically limited to the roots of the transgenic soybean plants, that is, the Pmlp43 promoter has significant root - tissue - specific advantages.
[0080] The above - mentioned are only the preferred embodiments of the present invention. It should be pointed out that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and refinements can be made, and these improvements and refinements should also be regarded as the protection scope of the present invention.
Claims
1. A root-specific promoter Pmlp43 of soybean, characterized in that, The nucleotide sequence of the root-specific promoter Pmlp43 is shown as SEQ ID NO.
1.
2. A primer set for cloning the root-specific promoter Pmlp43 described in claim 1, characterized in that, The primer set includes Pmlp43-F1 and Pmlp43-R1. The sequence of Pmlp43-F1 is shown as SEQ ID NO.2, and the sequence of Pmlp43-R1 is shown as SEQ ID NO.
3.
3. A kit containing the primer set according to claim 2.
4. A method for constructing the root-specific promoter Pmlp43 according to claim 1, characterized in that, It includes the following steps: Using the promoter sequence of the soybean Glyma.08G230500.1 gene as a template, performing PCR amplification with the primer set according to claim 2 to obtain a sequence fragment of the root-specific promoter Pmlp43.
5. A recombinant vector containing the root-specific promoter Pmlp43 according to claim 1.
6. The method for constructing the recombinant vector according to claim 5, wherein, It includes the following steps: Connecting the digested pCAMBIA3300 vector with the root-specific promoter Pmlp43 according to claim 1, and that is obtained.
7. A recombinant bacterium containing the recombinant vector according to claim 5.
8. The application of the root-specific promoter Pmlp43 according to claim 1, or the kit according to claim 3, or the recombinant vector according to claim 5, or the recombinant bacterium according to claim 7 in the tissue-specific expression of plant roots.
9. A method for constructing a transgenic soybean plant, characterized in that, It includes the following steps: (1) Infecting the target soybean plant with the recombinant bacterium according to claim 7, and then inducing adventitious buds. (2) Inoculating the adventitious buds into a bud elongation medium and culturing until the bud length reaches 3 - 5 cm, and then inoculating into a rooting medium and continuing the culture to obtain a transgenic soybean plant with tissue-specific expression in the stem.
10. The construction method according to claim 9, characterized in that, Step (1) is carried out for induction in an induction medium. The induction medium uses water as a solvent and consists of components with the following mass concentrations: B5 salts 3.1 - 3.4 g / L, sucrose 28 - 32 g / L, MES 0.4 - 0.65 g / L, BAP 1.5 - 1.8 mg / L, cefamycin 240 - 260 mg / L, Timentin 90 - 110 mg / L, glufosinate 5 - 6 mg / L, and agar powder 6 - 10 g / L. The bud elongation medium uses water as a solvent and consists of components with the following mass concentrations: MS salts 4.2 - 4.6 g / L, sucrose 28 - 32 g / L, MES 0.4 - 0.65 g / L, aspartic acid 48 - 52 mg / L, L-glutamic acid 48 - 52 mg / L, IAA 0.08 - 0.12 mg / L, GA3 0.4 - 0.6 mg / L, zeatin riboside 0.9 - 1.1 mg / L, cefamycin 240 - 260 mg / L, Timentin 90 - 110 mg / L, glufosinate 5 - 6 mg / L, and agar powder 6 - 10 g / L. The rooting medium uses water as a solvent and is composed of components with the following mass concentrations: MS salts 4.2 - 4.6 g / L, sucrose 18 - 22 g / L, MES 0.4 - 0.65 g / L, aspartic acid 48 - 52 mg / L, L-glutamic acid 48 - 52 mg / L, IBA 0.8 - 1.2 mg / L, and plant gel 2 - 4 g / L.