Farnesyl pyrophosphate synthase gene IbFPS of sweet potato and application of farnesyl pyrophosphate synthase gene IbFPS in regulation and control of resistance to fusarium oxysporum
By overexpressing the IbFPS gene in sweet potatoes, the anti-Fosarium oxysporus of sweet potatoes is regulated, and the problem of sweet potato disease is solved and the resistance and quality of sweet potatoes are improved.
Patent Information
- Application Number
- CN202510491504.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-18
- Publication Date
- 2025-07-25
AI Technical Summary
There is no effective method in the prior art to regulate the anti-Fosarium oxysporidium disease of sweet potatoes, resulting in serious impact on the yield and quality of sweet potatoes.
By transforming the sweet potato farnesyl pyrophosphate synthase gene IbFPS into sweet potato, overexpressed sweet potato plants were obtained using Agrobacterium-mediated methods to regulate plant resistance to Fusarium oxysporidium.
It significantly reduces the soluble sugar content, proline content and SOD enzyme activity, improves the resistance of sweet potatoes to Fusarium oxysporus, and provides a theoretical basis for improving the disease resistance of sweet potatoes and selecting new varieties.
Smart Images

Figure CN120366344A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the fields of molecular biology and plant genetic engineering technology, and specifically relates to a sweet potato farnesyl pyrophosphate synthase gene IbFPS and its application in regulating resistance to Fusarium oxysporum Background Art
[0002] Sweet potato ( Ipomoea batatas (L.) Lam) is an important food, feed, industrial raw material and new energy crop. Sweet potato is a vegetatively propagated crop and is vulnerable to fungal diseases during the seedling raising period, early cutting stage, field growth period and tuber storage period. Among them, Fusarium oxysporum f. sp. batatas (abbreviated as Fob), which infects sweet potato, is highly harmful and can cause the occurrence of various major sweet potato diseases, including root rot, stem rot, dry rot and canker, resulting in the rot of tubers or stems, seriously affecting the yield and quality of sweet potato Fusariumoxysporum
[0003] Currently, during the sweet potato breeding process, there is no relevant report on regulating resistance to Fusarium oxysporum Summary of the Invention
[0004] In view of the research gap existing in the prior art, the present invention provides a sweet potato farnesyl pyrophosphate synthase gene IbFPS .
[0005] The present invention also provides an application of a sweet potato farnesyl pyrophosphate synthase gene IbFPS in regulating resistance to Fusarium oxysporum
[0006] The technical solution adopted by the present invention to achieve the above object is as follows The present invention provides a sweet potato farnesyl pyrophosphate synthase gene IbFPS , and its nucleotide sequence is as shown in SEQ ID NO.1
[0007] The present invention also provides a recombinant vector pCAMBIA1301- IbFPS containing the above sweet potato farnesyl pyrophosphate synthase gene IbFPS .
[0008] The present invention further provides a host cell containing the above sweet potato farnesyl pyrophosphate synthase gene IbFPS
[0009] The present invention also provides an application of the above sweet potato farnesyl pyrophosphate synthase gene IbFPS in regulating plant resistance to Fusarium oxysporum
[0010] Preferably, the specific method for regulating plant resistance to Fusarium oxysporum is: including the sweet potato IbFPS The gene was ligated to a vector and transformed into sweet potato via Agrobacterium-mediated transformation to obtain overexpressing sweet potato IbFPS transgenic plants.
[0011] The present invention also provides an application of the above-mentioned plant overexpression recombinant vector pCAMBIA1301- IbFPS in regulating plant resistance to Fusarium oxysporum.
[0012] Using genetic engineering technology, the present invention cloned the full-length farnesyl pyrophosphate synthase gene from the highly disease-resistant sweet potato variety "Jishu 26", IbFPS constructed a cloning vector and a plant expression vector, and successfully transformed the long-vine sweet potato variety "Xushu 22" to obtain overexpressing sweet potato plants. It was found that under control conditions, IbFPS gene overexpression significantly reduced the soluble sugar content, proline content, SOD enzyme activity, H2O2 content and MDA content in the tuberous roots. After inoculation with Fob, IbFPS the infection area ratio of the fungus at the inoculation site in gene-overexpressing sweet potato was significantly reduced, the soluble sugar content, proline content and SOD enzyme activity were significantly reduced, but the changes in H2O2 content and MDA content were not significant, indicating that IbFPS the gene can increase the resistance of transgenic sweet potato to Fob by reducing the soluble sugar content, proline content and SOD enzyme activity. This will lay a foundation for further studying the IbFPS regulation mechanism of the gene in the growth and development process of sweet potato, provide a theoretical basis for using molecular means to improve the plant type of sweet potato and breed new varieties, and also have great application prospects.
[0013] The present invention cloned and isolated the farnesyl pyrophosphate synthase gene using the cDNA of the highly disease-resistant sweet potato variety "Jishu 26" as a template, IbFPS the farnesyl pyrophosphate synthase gene IbFPS , the full length of its ORF sequence is 1029 bp, encoding 342 amino acids.
[0014] The present invention further constructed a plant overexpression recombinant vector PCAMBIA1301- IbFPS , transformed and obtained overexpressing IbFPS sweet potato plants. Observing the transgenic sweet potato plants, it was found that the resistance of the transgenic sweet potato lines to Fusarium oxysporum was significantly improved compared with that of the wild type. This laid a foundation for further studying the IbFPS function of in regulating the resistance of sweet potato to Fusarium oxysporum, and provided a reference for using molecular means to accelerate the breeding of new sweet potato varieties with disease resistance.
[0015] The beneficial effects of the present invention are as follows: By transforming the sweet potato farnesyl pyrophosphate synthase gene IbFPS into the sweet potato variety "Xushu 22", after identification, 5 overexpressing sweet potatoes were obtained in totalIbFPS Gene-positive plants. It is shown that the farnesyl pyrophosphate synthase gene of sweet potato IbFPS regulates the resistance of sweet potato to Fusarium oxysporum, which will provide technical reference for the improvement of sweet potato disease resistance and the breeding of new varieties. Description of the Drawings
[0016] Figure 1 Analysis of the expression levels in the tuberous roots of different varieties of sweet potato IbFPS ; Figure 2 Analysis of the expression levels in the tuberous roots of wild-type and transgenic sweet potatoes IbFPS ; Figure 3 Phenotypic and physiological index determination of wild-type and transgenic sweet potato plants inoculated with Fusarium oxysporum; in the figure, A. Phenotype; B. Ratio of diseased area; C. Soluble sugar content; D. Proline content; E. SOD activity; F. H2O2 activity; G: MDA content. Detailed Embodiments
[0017] The present invention will be further described below in conjunction with specific embodiments.
[0018] Example 1 IbFPS Detection of the expression levels of genes in different tissues of sweet potato The materials used in this example are plant materials of various tissues of "Jishu 26" at the harvest stage. After collection, they are quickly frozen in liquid nitrogen and stored in an ultra-low temperature refrigerator (-80°C).
[0019] 1) Extraction of total RNA from various tissues of sweet potato According to the instructions of the TaKaRa plant total RNA extraction kit, the specific operation is as follows: The various tissues of "Jishu 26" sweet potato stored in ultra-low temperature Quickly transfer to a mortar pre-cooled with liquid nitrogen, and grind the tissue with a pestle. During this process, continuously add liquid nitrogen until it is ground into powder respectively; add the powdered samples into 1.5 mL sterile tubes containing 450 μl Buffer PE, and pipette repeatedly until there is no obvious precipitate in the lysate; centrifuge the lysate at 12,000 rpm and 4 °C for 5 min; carefully aspirate the supernatant into a new 1.5 mL sterile tube. Add 1 / 10 volume of Buffer NB to the supernatant, mix well by Vortex oscillation, centrifuge at 12,000 rpm and 4 °C for 5 min; carefully aspirate the supernatant into a new 1.5 mL sterile tube, add 450 μL of Buffer RL, and mix the solution evenly with a pipette; add 1.5 times the volume of absolute ethanol to the mixed solution, mix the solution evenly with a pipette, and immediately transfer all the mixed solution into an RNA Spin Column; centrifuge at 12,000 rpm for 1 min, discard the filtrate, and place the RNA Spin Column back into a 2 ml Collection Tube; add 600 μL of 80% ethanol to the RNA Spin Column, centrifuge at 12,000 rpm for 30 s, discard the filtrate; add 50 μL of DNase I reaction solution to the center of the RNA Spin Column membrane, and let it stand at room temperature for 15 min; add 350 μL of Buffer RWB to the center of the RNA Spin Column membrane, centrifuge at 12,000 rpm for 30 s, discard the filtrate; add 600 μL of 80% ethanol to the RNA Spin Column, centrifuge at 12,000 rpm for 30 s, discard the filtrate; relocate the RNA Spin Column onto a 2 mL Collection Tube, centrifuge at 12,000 rpm for 2 min; place the RNA Spin Column onto a 1.5 mL RNase Free Collection Tube, add 30 μL of RNase Free dH2O to the center of the RNA Spin Column membrane, let it stand at room temperature for 5 min, and centrifuge at 12,000 rpm for 2 min to elute the RNA. The obtained RNA is stored in an -80 °C refrigerator for standby after concentration and purity detection.
[0020] Aspirate 2 μL of RNA and detect it by 1% agarose gel electrophoresis. The results show that the 28S and 18S bands are relatively clear, and the brightness of the 28S band is about twice that of the 18S band, indicating good RNA quality. Detect the RNA purity with a micro nucleic acid protein analyzer, OD 260 / OD 280 and OD260 / OD 230 All are between 1.8 and 2.1, with good integrity and can be used for reverse transcription.
[0021] 2) Synthesis of the first strand of reverse transcribed cDNA Before reverse transcribing RNA, perform electrophoresis to detect whether it is degraded, and use RNA / DNA calculator to measure the RNA concentration, and proceed according to the requirements of the RNA reverse transcription kit for RNA. The first strand of reverse transcribed cDNA uses the TaKaRa reverse transcription rate kit PrimeScript TM RT reagent Kit(Perfect Real Time), and the specific operation is carried out according to the kit instruction manual.
[0022] 3) Fluorescent quantitative analysis According to the sweet potato IbFPS sequencing results, design fluorescent quantitative primers for sweet potato genes using BLAST in NCBI, use ACTIN as the internal reference gene, dilute the reverse transcribed cDNA by 10 times, take 1 μL as the template, and the fluorescent quantitative primers used are as follows: IbFPS -F (SEQ ID NO.2): 5’-ACTCCACCCTCAAGTCCG -3’ IbFPS -F (SEQ ID NO.2): 5’-ACTCCACCCTCAAGTCCG -3’ IbFPS- R (SEQ ID NO.3): 5’- CTTCCCTCCAGGCACATT -3’ ACTIN-F (SEQ ID NO.4): 5’- AGCAGCATGAAGATTAAGGTTGTAGCAC -3’ ACTIN -R (SEQ ID NO.5): 5’- TGGAAAATTAGAAGCACTTCCTGTGAAC -3’ Prepare the reaction solution according to the instruction manual of the SYBR Green Pro TaqHS qPCR Kit kit (Aikrui Biotech Co., Ltd.), and run the PCR program on the Roche Lightcycler®480 fluorescent quantitative instrument: 95℃ for 2 min; 95℃ for 15 s, 55℃ for 15 s, 72℃ for 15 s, cycle 40 times; 37℃ for 1 s. After the reaction is completed, obtain the amplification curve, export the data, perform data analysis using Excel, and calculate the relative expression level using the 2 -ΔΔCq relative quantification method, and the data analysis results are as Figure 1 shown.
[0023] In Example 1, based on the analysis of the fluorescence quantitative results, the expression profiles of the IbFPS gene of different sweet potato varieties inoculated with Fob were determined. From Figure 1 it can be seen that the IbFPS gene of sweet potato is up-regulated by Fob induction and has the highest expression in the disease-sensitive variety JS35.
[0024] Example 2 Cloning of the gene and construction of the recombinant plasmid The plant materials used in this example were "Jishu 26" and "Xushu 22", which were preserved by this experiment. The plant expression vector used in the experiment was pCAMBIA1301, which was preserved by this experiment; the Escherichia coli strain used was Trans 5α, and the Agrobacterium strain was EHA105, purchased from Beijing Tsingke Biotechnology Co., Ltd., and was used for vector construction and transformation of sweet potato.
[0025] 1) Design and cloning of primers for the target gene According to the CDS sequence of the IbFPS gene of sweet potato published in sweetpotato garden (see SEQ NO.1), Prime5.0 was used to design amplification primers, and restriction enzyme sites (Kpn I, Sal I) were added at both ends. The primer sequences were as follows: IbFPS - Kpn I –F (SEQ ID NO.6): 5'- GG GGTACC ATGAGCGATCTTAAGGCCAAGTTTC -3' (the underlined part is the Kpn I restriction enzyme site), IbFPS - Sal I -R (SEQ ID NO.7): 5'- CG GTCGAC CTTTTGCCTCTTGTATATCTTGGCC-3' (the underlined part is the Eco RI restriction enzyme site).
[0026] Using cDNA as a template, LA Taq high-fidelity enzyme was used to clone the IbFPS gene of sweet potato. The PCR amplification system (50 μL) was: 0.5 μl LA Taq, 10 μl Mg 2+Plus mix, 8 μL dNTP Mixture, 1 μL Forward Primer, 1 μL Reverse Primer, 2 μL Template DNA, 25.5 μL ddH2O. The PCR program is as follows: The reaction conditions are pre-denaturation at 94°C for 3 min, denaturation at 95°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 2 min, 34 cycles, total extension at 72°C for 10 min, and incubation at 4°C.
[0027] After the PCR reaction is completed, agarose gel electrophoresis is performed for detection and the target fragment is cut, and the gel is recovered and purified to obtain the PCR target amplification product. The DNA gel recovery kit of Aikerui Biotechnology Company is used for the purification and recovery of the target fragment. The specific operation is as follows: Cut the single target band from the agarose gel and put it into a clean centrifuge tube, and weigh it; Add 3 times the volume of solution GSB to the gel block (if the gel is 0.1 g, its volume can be regarded as 100 μL, then add 300 μL of GSB solution), place it in a 55°C water bath, and gently invert the centrifuge tube up and down continuously during this period until the gel block is completely dissolved; Let the melted gel solution cool to room temperature, add 1 time the volume of isopropanol (if the gel is 0.1 g, then add 100 μL of isopropanol), and gently mix; Add the mixture to the centrifugal column, let it stand at room temperature for 1 min, centrifuge at 12,000 rpm for 1 min, discard the effluent, and then put the centrifugal column back into the collection tube; Add 650 μL of solution WB to the centrifugal column, centrifuge at 12,000 rpm for 1 min, discard the effluent; Centrifuge at 12,000 rpm for 2 min to remove as much residual WB as possible, place the adsorption column at room temperature with the lid open for 5 min to completely dry; Put the centrifugal column into a clean centrifuge tube, suspend and drop 30 μL of ddH2O (ddH2O needs to be preheated in a 60 - 70°C water bath) at the middle position of the adsorption membrane, let it stand at room temperature for 2 min, and centrifuge at 12,000 rpm for 2 min to collect the DNA solution. Take 2 μL of the recovered and purified product, perform gel electrophoresis detection using 1.5% agarose, and place the rest in a -20°C refrigerator for subsequent ligation with the pCAMBIA1301 vector to construct an overexpression vector.
[0028] 3) Plasmid extraction: Extract the plasmid according to the instruction manual of the Tiangen Plasmid Mini Kit (Midiprep), and the specific steps are as follows: Take 10 mL of the overnight cultured bacterial solution, centrifuge at 12,000 rpm for 1 min, and discard the supernatant; take 500 μL of P1 solution (containing RNase A) and add it to the centrifuge tube with the bacterial cell pellet, and use a vortex mixer to thoroughly suspend the bacterial cell pellet; take 500 μL of P2 solution and add it to the centrifuge tube, gently invert the tube up and down to fully lyse the bacterial cells, take 700 μL of P3 solution and add it to the centrifuge tube, immediately gently invert the tube up and down to mix well, and when a white flocculent precipitate appears, centrifuge at 12,000 rpm for 10 min; take 500 μL of equilibration buffer BL and add it to adsorption column CP4, centrifuge at 12,000 rpm for 1 min, discard the waste liquid in the collection tube, put the adsorption column back into the collection tube, add the collected supernatant to filtration column CS in batches, centrifuge at 12,000 rpm for 2 min, carefully add the solution collected in the collection tube to adsorption column CP4 in batches, centrifuge at 12,000 rpm for 1 min, discard the waste liquid in the collection tube, and put adsorption column CP4 back into the collection tube; take 500 μL of deproteinization solution PD and add it to adsorption column CP4, centrifuge at 12,000 rpm for 1 min, discard the waste liquid in the collection tube, and put adsorption column CP4 back into the collection tube again; take 600 μl of wash buffer PW (containing absolute ethanol) and add it to adsorption column CP4, centrifuge at 12,000 rpm for 1 min, discard the waste liquid in the collection tube, put adsorption column CP4 back into the collection tube, centrifuge at 12,000 rpm for 2 min to remove the residual wash buffer in the adsorption column; transfer adsorption column CP4 to a new 1.5 ml centrifuge tube, add 60 μL of ddH2O to the middle of the adsorption membrane; let it stand at room temperature for 2 min, centrifuge at 12,000 rpm for 1 min, and the solution collected in the centrifuge tube is the plasmid. Finally, measure the plasmid concentration to prepare for the next experiment.
[0029] 4) Double digestion reaction Digest the extracted pCAMBIA1301 plasmid with Kpn I and Sal I at 37 °C for 30 min, electrophoretically recover the linear vector, and store it at -20 °C for later use. The double digestion reaction system is 50 μL: 20 μL of pCAMBIA1301 plasmid, 5 μL of 5× buffer, 1 μL of Kpn I, 1 μL of Sal I, and 23 μL of ddH2O.
[0030] 5) Recombination reaction The recovered target gene and vector pCAMBIA1301 after digestion were detected by agarose gel electrophoresis. According to the detected purity and concentration, each reagent was added according to the ligation system. The ligation reaction system was as follows: 7 μL of linearized pCAMBIA1301 vector, 3 μL of inserted fragment, 4 μL of T4 buffer, 2 μL of T4, and ddH2O up to 20 μL. React at 37 °C for 30 min, place at room temperature (do not immediately place in the cooler), and transform into Escherichia coli competent Trans5α after 10 min.
[0031] 6) Transfer the ligation product into Escherichia coli Take out the competent cell Trans5α strain from the ultra-low temperature refrigerator and melt it on ice. Pipette 10 μL of the recombinant product into 100 μL of competent cells; place the centrifuge tube on ice for an ice bath for 10 min; perform a water bath in a 42 °C water bath, heat shock for 50 s, do not shake during this period; then immediately place it on ice for an ice bath for 2 min; add 500 μL of liquid medium without antibiotics in the laminar flow hood, culture at 37 °C and 200 rpm for 60 min for recovery; centrifuge at 6000 rpm for 1 min, aspirate 350 μL of the supernatant; resuspend the precipitated bacteria and spread them on an LB plate (the concentration of Kana is 50 mg / L), and culture at 37 °C overnight.
[0032] 7) Identification of recombinants Pick a single colony on the plate and inoculate it into an LB liquid medium containing antibiotics (Kana), and culture it overnight at 37 °C and 200 rpm with shaking. Perform colony PCR of the bacterial solution using the full-length primers of the target gene to screen for positive clones. The screened positive clones were sent to Qingdao Tsingke Biotechnology Co., Ltd. for sequencing. For the positive clones with correct sequencing results, after large-scale culture, the plasmid was extracted using the Tiangen plasmid extraction kit to prepare for the transformation of Agrobacterium tumefaciens competent cells.
[0033] In this Example 2, the cDNA of "Jishu 26" was used as a template to clone and isolate the farnesyl pyrophosphate synthase gene IbFPS, and the recombinant vector pCAMBIA1301- IbFPS was successfully constructed for the genetic transformation of sweet potato.
[0034] Example 3 Genetic transformation of sweet potato and identification of positive plant lines 1) Preparation and transformation of Agrobacterium tumefaciens EHA105 competent cells Steps for preparing competent cells: Pick a single colony and inoculate it into 10 mL of YEP liquid medium containing the antibiotic rifampicin. Incubate it overnight on a shaker at 28°C with a rotation speed of 180 - 250 rpm. Transfer 2 mL of the bacterial solution into 50 mL of YEP liquid medium containing the antibiotic rifampicin and continue culturing until the OD value reaches 0.3 - 0.4. Transfer the bacterial solution into a sterile centrifuge tube and incubate it on ice for 30 min. Centrifuge at 5000 rpm for 10 min and discard the supernatant. Add 2 mL of pre-cooled CaCl2 solution containing 15% glycerol and 0.1 mol·L -1 and gently suspend the cells. Aliquot the Agrobacterium suspension into 1.5 mL sterile centrifuge tubes, 200 μL per tube. Quickly freeze it with liquid nitrogen and store it in a -80°C refrigerator for later use.
[0035] Specific steps for competent cell transformation: Take 10 μL of plasmid DNA and add it to 200 μL of thawed Agrobacterium competent cells on ice. Incubate on ice for 5 min, quickly freeze in liquid nitrogen for 5 min, and then incubate in a 37°C water bath for 5 min. Add 800 μL of YEP liquid medium and incubate at 28°C with a rotation speed of 100 rpm for 2 - 4 h. Centrifuge at 5000 rpm, pour off most of the supernatant, leaving about 50 μL, and resuspend the cells. Spread the bacterial solution on YEP solid medium containing the antibiotics rifampicin and kanamycin. Incubate it upside down at 28°C for 48 - 72 h until single colonies grow on the plate. Pick a single colony, extract the plasmid, and perform PCR identification of the target gene. Send the identified positive clones to Qingdao Qingke Biotechnology Co., Ltd. for sequencing. Select the positive colonies with correct sequencing results for shaking culture, add an appropriate amount of sterile 50% glycerol, and store them at -80°C for later use.
[0036] 2) Induction of embryogenic callus and establishment of embryogenic cell suspension line of sweet potato variety Xushu 22: The harvested Xushu 22 sweet potato tubers are used to provide sweet potato shoot tips. Peel the shoot tip meristem and inoculate it on MS solid medium containing 2.0 mg / L 2,4-D. Incubate it in the dark at room temperature of 27±1°C to induce callus, and then perform multiplication and subculture to establish an embryogenic cell suspension line for transformation.
[0037] 3) Cultivation of Agrobacterium: Activate the Agrobacterium solution on a resistant plate. Pick a single colony and inoculate it into 5 mL of YEP liquid medium containing the corresponding antibiotic. Incubate it at 28°C with a rotation speed of 200 rpm until the OD 600 value is in the range of 0.8 - 1.0.
[0038] 4) Preparation of the suspension cell line and infection of Agrobacterium tumefaciens: Select a suspension cell line in good condition that has grown for 8 - 12 weeks for grinding. After subculture for 3 d, take embryogenic suspension cell clusters with a diameter of about 0.7 - 1.4 mm for Agrobacterium infection and transformation.
[0039] 5) Co-culture and delayed culture: The suspension cell line after Agrobacterium infection was transferred onto MS solid medium containing 30 mg / L acetosyringone (AS) and 2 mg / L 2,4-D for co-culture in the dark at a temperature of 27 ± 1°C. After 3 days of co-culture, the cell clusters were washed once with MS liquid medium containing 200 mg / L cefotaxime (CS) and 2 mg / L 2,4-D, soaked statically in MS liquid medium containing 100 mg / L CS and 2 mg / L 2,4-D for 30 min, and finally cultured for 1 week in MS liquid medium containing 2 mg / L 2,4-D. The culture conditions were 27 ± 1°C, 500 Lux light (13 h light per day), and shaking culture at 100 rpm.
[0040] 6) Screening of resistant cell clusters: After delayed culture, the cell clusters were transferred onto MS solid medium containing 5.0 mg / L hygromycin (Hyg), 100 mg / L CS and 2 mg / L 2,4-D for dark culture at a temperature of 27 ± 1°C, and the fresh medium was changed every 2 weeks. After 4 weeks, the resistant cell clusters were transferred onto MS solid medium containing 10.0 mg / L Hyg, 100 mg / L CS and 2 mg / L 2,4-D for co-culture for 4 - 8 weeks.
[0041] 7) Induction of somatic embryos: The resistant cell clusters with good growth status were transferred onto MS medium containing 1.0 mg / L ABA and 100 mg / L CS to induce the growth of somatic embryos. The culture conditions were 27 ± 1°C, 3000 Lux light (13 h light per day).
[0042] 8) Regeneration and identification of putative transgenic plants: The mature somatic embryos that turned green on the ABA medium after 2 - 4 weeks of induction, together with the callus, were transferred onto MS solid medium and cultured until complete plants were formed at a temperature of 27 ± 1°C, with 13 h light per day and a light intensity of 3000 Lux to obtain putative transgenic plants.
[0043] Trans IbFPS The identification of transgenic plants was performed using a combination of PCR detection and qRT-PCR detection.
[0044] The PCR detection method was as follows: DNA was extracted from the sweet potato variety Xushu 22 and the putative transgenic lines for PCR identification. The pCAMBIA1301- IbFPS vector plasmid was used as the positive control, water and the wild-type sweet potato variety Xushu 22 were used as the negative controls, and the primers were as follows: pCAMBIA1301-F (SEQ ID NO.8): 5'-GACGCACAATCCCACTATCC-3' pCAMBIA1301-R (SEQ ID NO.9): 5'-AGCTTGGGTGGATAG-3' The amplified PCR products were electrophoretically separated on a 1% (w / v) agarose gel. The PCR-positive plants had a specific electrophoretic band, and the line numbers of the PCR-positive plants were recorded.
[0045] The qRT-PCR detection method was as follows: RNA was extracted from the transgenic positive sweet potato plants, reverse transcribed into cDNA, and qRT-PCR was performed, using Xushu 22 as the control WT.
[0046] In Example 3, through the Agrobacterium-mediated genetic transformation method, the pCAMBIA1301- IbFPS overexpression recombinant vector linked with the sweet potato IbFPS gene was transferred into sweet potato, and 5 overexpressed sweet potato lines were obtained. The qRT-PCR detection results using sweet potato tuberous roots showed that the expression level of the IbFPS gene in the tuberous roots of the transgenic sweet potato lines was significantly increased ( Figure 2 ). In the figure, L1-L5 are 5 overexpressed sweet potato lines.
[0047] Example 4 Functional identification of sweet potato IbFPS in regulating resistance to Fusarium oxysporum Phenotypic observations and physiological index determinations were carried out on the transgenic plants and the control. The results were as Figure 3 shown. Under the control conditions, IbFPS gene overexpression did not change the area of the inoculation hole, but the soluble sugar content, proline content, SOD enzyme activity, H2O2 content and MDA content in the tuberous roots were significantly reduced. After inoculation with Fob, IbFPS the infection area ratio of the inoculation hole in the gene-overexpressed sweet potato was significantly reduced, the soluble sugar content, proline content and SOD enzyme activity were significantly reduced, but the changes in H2O2 content and MDA content were not significant. The above results showed that IbFPS the gene could increase the resistance of transgenic sweet potato to Fob by reducing the soluble sugar content, proline content and SOD enzyme activity.
Claims
1. A sweet potato farnesyl pyrophosphate synthase gene IbFPS , characterized in that Its nucleotide sequence is shown in SEQ ID NO.
1.
2. A plant overexpression recombinant vector pCAMBIA1301- containing the sweet potato farnesyl pyrophosphate synthase gene as described in claim 1 IbFPS IbFPSIbFPS . 3. A host cell containing the sweet potato farnesyl diphosphate synthase gene as described in claim 1 IbFPS 4. Use of the sweet potato farnesyl pyrophosphate synthase gene as described in claim 1 IbFPS in regulating plant resistance to Fusarium oxysporum.
5. The application according to claim 4, characterized in that The specific method is as follows: Connect the sweet potato containing the IbFPS gene to a vector, and transform it into sweet potato through Agrobacterium-mediated transformation to obtain sweet potato IbFPS overexpressing transgenic plants.
6. An application of the plant overexpression recombinant vector pCAMBIA1301- IbFPS in regulating plant resistance to Fusarium oxysporum.