Application of PDRP1 and PDRP2 genes in regulation and control of tomato plant fertility
By regulating the expression or activity of PDRP1 and PDRP2 genes, the CRISPR/Cas9 system is used to reduce the fertility and fruit yield of tomato plants, which solves the unclear problem of fertility regulation during tomato reproduction and development, and achieves theoretical support for tomato breeding and improving agricultural production efficiency.
Patent Information
- Application Number
- CN202410098070.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-01-24
- Publication Date
- 2025-07-25
AI Technical Summary
In the prior art, the regulation of small peptides during the reproductive development of tomato plants is not clear enough, which affects its fertility and fruit yield, and it is difficult to create male sterile strains through genetic engineering to improve agricultural production efficiency.
By regulating the expression or activity of PDRP1 and PDRP2 genes, the CRISPR/Cas9 system knocks out or reduces the content or activity of these genes, products that regulate plant fertility, pistil and stamen length, seed and fruit yield, including nucleic acid molecules encoding genes, expression cassettes, recombinant vectors and transgenic plant cell lines, etc.
It significantly reduces pollen breeding, reduces flower organ size and seed yield, provides a theoretical basis for cultivating tomato sterile lines and fruit development, and enhances the theoretical support for tomato breeding.
Smart Images

Figure HDA0004679204590000011 
Figure HDA0004679204590000021
Abstract
Description
Technical Field
[0001] The present invention relates to the application of PDRP1 and PDRP2 genes in regulating the fertility of tomato plants in the field of biotechnology. Background Art
[0002] Tomato (Solanum lycopersicum) originated from the warm and humid regions of the Andes Mountains in South America. It is a day-neutral plant and can be widely cultivated in different regions. Therefore, tomato is one of the most popular fruit and vegetable crops. The modern cultivated tomato variety M82 provided by Dani Zamir is often used as a control group in scientific research.
[0003] In the past few decades, secreted small peptides involved in short or long-distance communication during plant formation and development have attracted considerable attention from researchers. Current studies have discovered some widespread and conserved secreted small peptide families, such as CLAVATA3 (CLV3) / ENDOSPERM SURROUNDING REGION (ESR)-related (CLE). CLE-like small peptides are expressed in different plant tissues and regulate different plant growth and development processes. For example, the core members SlCLV3 and SlCLE9 in the CLV-WUS negative feedback pathway can regulate tomato shoot apical stem cells, thereby affecting the number of floral organs and fruit size in the above-ground part. Or when Arabidopsis thaliana is subjected to drought stress, its roots can produce AtCLE25 and transmit it to the leaves through the vascular system and then activate the production of abscisic acid to improve the drought resistance of the plant. In addition, the PCP-B (POLLEN COAT PROTEIN-B) small peptide in the pollen coat competitively binds to the receptor with the RALF33 (RAPID ALKALINIZATION FACTOR) small peptide secreted by the stigma itself, promoting pollen hydration. The S-locus cysteine-rich peptide SCR (S-LOCUS CYSTENINERICH PROTEIN) / SP11 (S-LOCUS PROTEIN 11) on the pollen surface can be specifically recognized by the receptor-like kinase on the pistil surface, preventing pollen hydration and other processes, and regulating the self-incompatibility process of plants. At present, the research on plant small peptides in the reproductive development process of tomatoes is not very clear, and tomatoes are important economic crops, and their reproductive development process is crucial for their yield. Starting from genes and using genetic engineering means to create male-sterile tomato plants is helpful for tomato agricultural production. Summary of the Invention
[0004] The technical problem to be solved by the present invention is how to regulate the fertility of plants.
[0005] To solve the above technical problem, the present invention first provides the following any application of a protein or a substance that regulates the content or activity of the protein:
[0006] D1) Regulating plant fertility;
[0007] D2) Regulating the length of pistils and / or stamens of plants;
[0008] D3) Regulating plant seed yield;
[0009] D4) Regulating plant fruit yield;
[0010] D5) Preparing a product for regulating plant fertility;
[0011] D6) Preparing a product for regulating the length of pistils and / or stamens of plants;
[0012] D7) Preparing a product for regulating plant seed yield;
[0013] D8) Preparing a product for regulating plant fruit yield;
[0014] The protein is PDRP1 peptide and / or PDRP2 peptide, and the PDRP1 peptide is as follows A1), A2) or A3):
[0015] A1) A protein with an amino acid sequence of SEQ ID No. 3;
[0016] A2) A protein obtained by substituting and / or deleting and / or adding one or several amino acid residues to the amino acid sequence shown in SEQ ID No. 3 in the sequence listing and having the same function;
[0017] A3) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of A1) or A2);
[0018] The PDRP2 peptide is as follows B1), B2) or B3):
[0019] B1) A protein with an amino acid sequence of SEQ ID No. 6;
[0020] B2) A protein obtained by substituting and / or deleting and / or adding one or several amino acid residues to the amino acid sequence shown in SEQ ID No. 6 in the sequence listing and having the same function;
[0021] B3) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of B1) or B2).
[0022] The PDRP1 peptide in A2) above is a protein having 75% or more identity with the amino acid sequence of the protein shown in SEQ ID No. 3 and having the same function. The PDRP2 peptide in B2) above is a protein having 75% or more identity with the amino acid sequence of the protein shown in SEQ ID No. 6 and having the same function. Identity refers to the identity of amino acid sequences. The identity of amino acid sequences can be determined using homology search sites on the Internet, such as the BLAST web page of the NCBI homepage website. For example, in Advanced BLAST 2.1, by using blastp as the program, setting the Expect value to 10, setting all Filters to OFF, using BLOSUM62 as the Matrix, and setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values) respectively and performing a search, the identity value (%) of a pair of amino acid sequences can be calculated. The "having 75% or more identity" means having 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity.
[0023] The proteins in A2) and B2) above can be artificially synthesized, or their encoding genes can be synthesized first and then biochemically expressed.
[0024] The encoding gene of the PDRP1 peptide in A2) above can be obtained by deleting the codons of one or several amino acid residues in the DNA sequence shown in SEQ ID No. 2, and / or performing missense mutations of one or several base pairs, and / or connecting the encoding sequences of tags at its 5' end and / or 3' end. Among them, the DNA molecule shown in SEQ ID No. 2 encodes the PDRP1 peptide shown in SEQ ID No. 3. The encoding gene of the PDRP2 peptide in B2) above can be obtained by deleting the codons of one or several amino acid residues in the DNA sequence shown in SEQ ID No. 5, and / or performing missense mutations of one or several base pairs, and / or connecting the encoding sequences of tags at its 5' end and / or 3' end. Among them, the DNA molecule shown in SEQ ID No. 5 encodes the PDRP2 peptide shown in SEQ ID No. 6.
[0025] The tags described in A3) and B3) can be a polypeptide or protein that is fusion-expressed with the target protein using in vitro DNA recombination technology to facilitate the expression, detection, tracing, and / or purification of the target protein. The tags can be Poly-Arg, Poly-His, FLAG, Strep-tag II, c-myc, MBP tag, HA tag, GST tag, and / or SUMO tag, etc.
[0026] In the above applications, the plant fertility can be plant pollen fertility.
[0027] The seed yield can be reflected in the seed weight and / or quantity.
[0028] The fruit yield can be reflected in the fruit quantity.
[0029] In the above applications, the substance that regulates the protein content or activity can be a substance that reduces the protein content or activity. The regulation of plant fertility can be to reduce plant fertility. The regulation of the length of plant pistils and / or stamens can be to reduce the length of plant pistils and / or stamens. The regulation of plant seed yield can be to reduce plant seed yield. The regulation of plant fruit yield can be to reduce plant fruit yield.
[0030] Specifically, the reduction of plant fertility can be reflected in the reduction of pollen activity or the absence of the intine of pollen.
[0031] In the above applications, the substance that regulates the protein content or activity can be a substance that regulates the content or activity of the PDRP1 peptide and / or a substance that regulates the content or activity of the PDRP2 peptide. The substance that regulates the content or activity of the PDRP1 peptide can be any one of the following E1) to E9):
[0032] E1) A nucleic acid molecule encoding the PDRP1 peptide;
[0033] E2) An expression cassette containing the nucleic acid molecule described in E1);
[0034] E3) A recombinant vector containing the nucleic acid molecule described in E1), or a recombinant vector containing the expression cassette described in E2);
[0035] E4) A recombinant microorganism containing the nucleic acid molecule described in E1), or a recombinant microorganism containing the expression cassette described in E2), or a recombinant microorganism containing the recombinant vector described in E3);
[0036] E5) A transgenic plant cell line containing the nucleic acid molecule described in E1), or a transgenic plant cell line containing the expression cassette described in E2);
[0037] E6) A transgenic plant tissue containing the nucleic acid molecule described in E1), or a transgenic plant tissue containing the expression cassette described in E2);
[0038] E7) A transgenic plant organ containing the nucleic acid molecule described in E1), or a transgenic plant organ containing the expression cassette described in E2);
[0039] E8) A nucleic acid molecule that reduces the content of the PDRP1 peptide;
[0040] E9) An expression cassette, recombinant vector, recombinant microorganism, transgenic plant cell line, transgenic plant tissue or transgenic plant organ containing the nucleic acid molecule described in E8);
[0041] The substance that regulates the content or activity of the PDRP2 peptide is any one of the following F1) to F9):
[0042] F1) A nucleic acid molecule encoding the PDRP2 peptide;
[0043] F2) An expression cassette containing the nucleic acid molecule described in F1);
[0044] F3) A recombinant vector containing the nucleic acid molecule described in F1), or a recombinant vector containing the expression cassette described in F2);
[0045] F4) A recombinant microorganism containing the nucleic acid molecule described in F1), or a recombinant microorganism containing the expression cassette described in F2), or a recombinant microorganism containing the recombinant vector described in F3);
[0046] F5) A transgenic plant cell line containing the nucleic acid molecule described in F1), or a transgenic plant cell line containing the expression cassette described in F2);
[0047] F6) A transgenic plant tissue containing the nucleic acid molecule described in F1), or a transgenic plant tissue containing the expression cassette described in F2);
[0048] F7) A transgenic plant organ containing the nucleic acid molecule described in F1), or a transgenic plant organ containing the expression cassette described in F2);
[0049] F8) A nucleic acid molecule that reduces the content of the PDRP2 peptide;
[0050] F9) An expression cassette, recombinant vector, recombinant microorganism, transgenic plant cell line, transgenic plant tissue or transgenic plant organ containing the nucleic acid molecule described in F8).
[0051] In the above applications, the nucleic acid molecule described in E1) can be any of the following e11) or e12) or e13) or e14) or e15):
[0052] e11) The coding sequence is the DNA molecule of SEQ ID No.2 in the sequence listing;
[0053] e12) The DNA molecule shown as SEQ ID No.2 in the sequence listing;
[0054] e13) The DNA molecule shown as SEQ ID No.1 in the sequence listing;
[0055] e14) A DNA molecule that has 75% or more identity with the nucleotide sequence defined by e11) or e12) or e13) and encodes the PDRP1 peptide;
[0056] e15) A DNA molecule that hybridizes with the nucleotide sequence defined by e11) or e12) or e13) or e14) under stringent conditions and encodes the PDRP1 peptide;
[0057] F1) The nucleic acid molecule is one of the following f11) or f12) or f13) or f14) or f15):
[0058] f11) The coding sequence is the DNA molecule of SEQ ID No.5 in the sequence listing;
[0059] f12) The DNA molecule shown as SEQ ID No.5 in the sequence listing;
[0060] f13) The DNA molecule shown as SEQ ID No.4 in the sequence listing;
[0061] f14) A DNA molecule that has 75% or more identity with the nucleotide sequence defined by f11) or f12) or f13) and encodes the PDRP2 peptide;
[0062] f15) A DNA molecule that hybridizes with the nucleotide sequence defined by f11) or f12) or f13) or f14) under stringent conditions and encodes the PDRP2 peptide.
[0063] Wherein, the nucleic acid molecule can be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule can also be RNA, such as mRNA or hnRNA, etc.
[0064] Those of ordinary skill in the art can easily use known methods, such as directed evolution and site-directed mutagenesis, to mutate the nucleotide sequences encoding PDRP1 peptide and PDRP2 peptide of the present invention. Nucleotides that have been artificially modified and have 75% or higher identity with the nucleotide sequences of PDRP1 peptide and PDRP2 peptide isolated from the present invention, as long as they encode PDRP1 peptide and PDRP2 peptide and have the functions of PDRP1 peptide and PDRP2 peptide, are all derived from the nucleotide sequences of the present invention and are equivalent to the sequences of the present invention.
[0065] As used herein, the term "identity" refers to sequence similarity to a native nucleic acid sequence. "Identity" includes nucleotide sequences having 75% or higher, or 85% or higher, or 90% or higher, or 95% or higher identity with the nucleotide sequences encoding the proteins consisting of the amino acid sequences shown in SEQ ID No.3 and SEQ ID No.6 of the present invention. Identity can be evaluated by the naked eye or by computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.
[0066] In the above applications, the stringent conditions may be as follows: hybridize at 50°C in a mixed solution of 7% sodium dodecyl sulfate (SDS), 0.5 M NaPO4, and 1 mM EDTA, and wash in 2×SSC, 0.1% SDS at 50°C; or: hybridize at 50°C in a mixed solution of 7% SDS, 0.5 M NaPO4, and 1 mM EDTA, and wash in 1×SSC, 0.1% SDS at 50°C; or: hybridize at 50°C in a mixed solution of 7% SDS, 0.5 M NaPO4, and 1 mM EDTA, and wash in 0.5×SSC, 0.1% SDS at 50°C; or: hybridize at 50°C in a mixed solution of 7% SDS, 0.5 M NaPO4, and 1 mM EDTA, and wash in 0.1×SSC, 0.1% SDS at 50°C; or: hybridize at 50°C in a mixed solution of 7% SDS, 0.5 M NaPO4, and 1 mM EDTA, and wash in 0.1×SSC, 0.1% SDS at 65°C; or: hybridize in a solution of 6×SSC, 0.5% SDS at 65°C, and then wash the membrane once each with 2×SSC, 0.1% SDS and 1×SSC, 0.1% SDS; or: hybridize and wash the membrane twice in a solution of 2×SSC, 0.1% SDS at 68°C for 5 min each time, and then hybridize and wash the membrane twice in a solution of 0.5×SSC, 0.1% SDS at 68°C for 15 min each time; or: hybridize and wash the membrane under the conditions of 0.1×SSPE (or 0.1×SSC), 0.1% SDS at 65°C.
[0067] The above-mentioned identity of 75% or more may be an identity of 80%, 85%, 90% or more than 95%.
[0068] In the above application, the expression cassette containing the nucleic acid molecule encoding the PDRP1 peptide (PDRP1 gene expression cassette) described in E2) refers to DNA that can express the PDRP1 peptide in a host cell. This DNA may not only include a promoter that initiates the transcription of the PDRP1 gene, but also a terminator that terminates the transcription of the PDRP1 gene. Further, the expression cassette may also include an enhancer sequence. The expression cassette containing the nucleic acid molecule encoding the PDRP2 peptide (PDRP2 gene expression cassette) described in F2) refers to DNA that can express the PDRP2 peptide in a host cell. This DNA may not only include a promoter that initiates the transcription of the PDRP2 gene, but also a terminator that terminates the transcription of the PDRP2 gene. Further, the expression cassette may also include an enhancer sequence. Promoters that can be used in the present invention include, but are not limited to: constitutive promoters, tissue-, organ- and development-specific promoters, and inducible promoters. Examples of promoters include, but are not limited to: the constitutive promoter 35S of cauliflower mosaic virus; the wound-inducible promoter from tomato, leucine aminopeptidase ("LAP", Chao et al. (1999) Plant Physiol 120: 979-992); the chemically inducible promoter from tobacco, pathogenesis-related 1 (PR1) (induced by salicylic acid and BTH (benzothiadiazole-7-thiocarboxylic acid S-methyl ester)); the tomato protease inhibitor II promoter (PIN2) or the LAP promoter (both can be induced by methyl jasmonate); the heat shock promoter (U.S. Patent 5,187,267); the tetracycline-inducible promoter (U.S. Patent 5,057,422); seed-specific promoters, such as the foxtail millet seed-specific promoter pF128 (CN101063139B (Chinese Patent 200710099169.7)), promoters specific for seed storage proteins (e.g., the promoters of phaseolin, napin, oleosin, and soybean beta conglycin (Beachy et al. (1985) EMBO J. 4: 3047-3053)). They can be used alone or in combination with other plant promoters. All references cited herein are incorporated by reference in their entirety.Suitable transcription terminators include, but are not limited to: Agrobacterium nopaline synthase terminator (NOS terminator), cauliflower mosaic virus CaMV 35S terminator, tml terminator, pea rbcS E9 terminator, and nopaline and octopine synthase terminators (see, e.g., Odell et al. (1985) Nature 313:810; Rosenberg et al. (1987) Gene, 56:125; Guerineau et al. (1991) Mol. Gen. Genet, 262:141; Proudfoot (1991) Cell, 64:671; Sanfacon et al. Genes Dev., 5:141; Mogen et al. (1990) Plant Cell, 2:1261; Munroe et al. (1990) Gene, 91:151; Ballad et al. (1989) Nucleic Acids Res. 17:7891; Joshi et al. (1987) Nucleic Acid Res., 15:9627).
[0069] A recombinant vector containing the PDRP1 peptide / PDRP2 peptide gene expression cassette can be constructed using existing expression vectors. The plant expression vectors include binary Agrobacterium vectors and vectors that can be used for plant microprojectile bombardment, etc., such as pAHC25, pBin438, pCAMBIA1302, pCAMBIA2301, pCAMBIA1301, pCAMBIA1300, pBI121, pCAMBIA1391-Xa, PSN1301 or pCAMBIA1391-Xb (from CAMBIA), etc. The plant expression vector may further contain the 3′ untranslated region of the foreign gene, that is, it contains a polyadenylation signal and any other DNA fragments involved in mRNA processing or gene expression. The polyadenylation signal can direct the addition of polyadenylic acid to the 3′ end of the mRNA precursor. For example, the genes of Agrobacterium tumefaciens Ti plasmid (such as the nopaline synthase gene Nos) and the 3′ untranslated regions transcribed from plant genes (such as soybean storage protein genes) have similar functions. When constructing a plant expression vector using the gene of the present invention, enhancers can also be used, including translation enhancers or transcription enhancers. These enhancer regions can be the ATG start codon or the start codon in the adjacent region, etc., but must have the same reading frame as the coding sequence to ensure the correct translation of the entire sequence. The sources of the translation control signal and the start codon are extensive and can be natural or synthetic. The translation initiation region can be from the transcription initiation region or the structural gene. For the convenience of identifying and screening transgenic plant cells or plants, the used plant expression vector can be processed, such as adding a gene encoding an enzyme or a luminescent compound that can produce a color change and can be expressed in plants (GUS gene, luciferase gene, etc.), a marker gene for antibiotics (such as the nptII gene conferring resistance to kanamycin and related antibiotics, the bar gene conferring resistance to the herbicide phosphinothricin, the hph gene conferring resistance to the antibiotic hygromycin, and the dhfr gene conferring resistance to methotrexate, the EPSPS gene conferring resistance to glyphosate) or a marker gene for anti-chemical reagents, etc. (such as an anti-herbicide gene), a mannose-6-phosphate isomerase gene providing the ability to metabolize mannose. Considering the safety of transgenic plants, no selective marker gene can be added, and the transformed plants can be directly screened under stress conditions.
[0070] In the above application, the vector can be a plasmid, cosmid, phage or viral vector. Specifically, the plasmid can be a pBI121 vector or a pCAMBIA2300 vector.
[0071] E9) and F9), the recombinant vector may be a recombinant vector prepared using the CRISPR / Cas9 system that can reduce the content of PDRP1 peptide / PDRP2 peptide. The recombinant vector may express an sgRNA targeting the nucleic acid molecule described in E1) and F1). The target sequences of the sgRNA may be target 1 (ATTGAAGTACTTGAAAATGG) and target 2 (GTCCTGACCCAATCCACAAC) in the PDRP1 gene, and target 1 (GCATTTCTTCTTATATGTAT) and target 2 (GATCAGATCCAATCCACAAT) in the PDRP2 gene.
[0072] In the above application, the microorganism may be yeast, bacteria, algae or fungi. Among them, the bacteria may be Agrobacterium, such as Agrobacterium rhizogenes AGL1.
[0073] In the above application, the transgenic plant cell line, transgenic plant tissue and transgenic plant organ do not include propagation materials.
[0074] In the above application, the plant may be M1) or M2) or M3) or M4) or M5):
[0075] M1) Dicotyledonous plants or monocotyledonous plants;
[0076] M2) Solanales plants;
[0077] M3) Solanaceae plants;
[0078] M4) Solanum plants;
[0079] M5) Tomato.
[0080] The present invention also provides any of the following methods:
[0081] X1) A method for cultivating a plant with reduced pollen fertility, comprising: reducing the content or activity of the PDRP1 peptide and the PDRP2 peptide in a recipient plant, or knocking out the coding genes of the PDRP1 peptide and the PDRP2 peptide, to obtain a target plant with reduced pollen fertility;
[0082] X2) A method for cultivating a plant with reduced pistil and / or stamen length, comprising: reducing the content or activity of the PDRP1 peptide and the PDRP2 peptide in a recipient plant, or knocking out the coding genes of the PDRP1 peptide and the PDRP2 peptide, to obtain a target plant with reduced pistil and / or stamen length;
[0083] X3) Method for cultivating plants with reduced seed yield, comprising: reducing the content or activity of the PDRP1 small peptide and the PDRP2 small peptide in a recipient plant, or knocking out the encoding genes of the PDRP1 small peptide and the PDRP2 small peptide, to obtain a target plant with reduced seed yield;
[0084] X4) Method for cultivating plants with reduced fruit yield, comprising: reducing the content or activity of the PDRP1 small peptide and the PDRP2 small peptide in a recipient plant, or knocking out the encoding genes of the PDRP1 small peptide and the PDRP2 small peptide, to obtain a target plant with reduced fruit yield.
[0085] The methods of X1)-X4) can be carried out using the CRISPR / Cas9 system. Specifically, the recombinant vectors described in E9) and F9) can be introduced into the recipient plant, and the target plant can be screened and obtained.
[0086] In one embodiment of the present invention, in the genomic DNA of the target plant, the PDRP1 gene lacks positions 2281-2288 of SEQ ID No. 1, and the PDRP2 gene lacks positions 2231-2238 of SEQ ID No. 4.
[0087] The recombinant vector can be introduced into plant cells by conventional biotechnological methods such as using Ti plasmids, plant virus vectors, direct DNA transformation, microinjection, electroporation, etc. (Weissbach, 1998, Method for Plant Molecular Biology VIII, Academy Press, New York, pp. 411-463; Geiserson and Corey, 1998, Plant Molecular Biology (2nd Edition).)
[0088] The target plant is understood to include not only the first-generation plant in which the PDRP1 small peptide / PDRP2 small peptide or its encoding gene is altered, but also its progeny. For the target plant, this gene can be propagated in this species, or transferred into other varieties of the same species, especially including commercial varieties, by conventional breeding techniques. The target plant includes seeds, callus, whole plants, and cells.
[0089] In the above methods, the plant can be M1) or M2) or M3) or M4) or M5):
[0090] M1) Dicotyledonous plants or monocotyledonous plants;
[0091] M2) Plants of the Solanales order;
[0092] M3) Plants of the Solanaceae family;
[0093] M4) Solanum plants;
[0094] M5) Tomatoes.
[0095] The PDRP1 peptide / PDRP2 peptide also belongs to the protection scope of the present invention.
[0096] The substance for regulating the protein content or activity also belongs to the protection scope of the present invention.
[0097] The present invention finds that the deletion of PDRP1 and PDRP2 genes will lead to the deletion of the intine structure of pollen, thereby significantly reducing the pollen fertility of tomatoes. In addition, the flower organs of the homozygous mutants of the two genes become smaller, the fruit weight decreases, and the seed yield decreases, indicating that the PDRP1 and PDRP2 genes play an important regulatory role in tomato fertility and fruit development. Therefore, the present invention can provide a theoretical basis for cultivating tomato sterile lines and tomato fruit development in the future, and has an important role in future tomato breeding.
[0098] The following further describes the present invention in detail in combination with specific embodiments. The given embodiments are only for clarifying the present invention, rather than limiting the scope of the present invention. The following provided embodiments can be used as a guide for those of ordinary skill in the art to make further improvements, and do not constitute any limitation to the present invention in any way. Description of the Drawings
[0099] Figure 1 It is the statistical result of plant phenotypes.
[0100] a. Schematic diagram of the target sites for editing PDRP1 and PDRP2 genes by CRISPR / Cas9 and the identification results of mutant genotypes. Both PDRP1 and PDRP2 have an 8-bp base deletion, resulting in the loss of the functions of the two genes.
[0101] b. Phenotypes of M82 plants and pdrp1 / 2 homozygous double mutant plants during the flowering period. The inflorescence scale = 2 cm, and the plant scale = 10 cm.
[0102] f. Statistical results of the flowering time of the first inflorescence of M82 plants and pdrp1 / 2 double mutant plants. The statistical data was tested by two-tailed T-test.
[0103] c. Flower structure diagrams of M82 plants and pdrp1 / 2 double mutant plants. The flower structure scale = 1 mm.
[0104] j. Statistical results of the stamen lengths of M82 plants and pdrp1 / 2 double mutant plants. The statistical data was tested by two-tailed T-test.
[0105] Statistics on the stamen lengths of k.M82 plants and pdrp1 / 2 double mutant plants. The statistical data was subjected to a two-tailed T-test.
[0106] Fruit setting of d.M82 plants and pdrp1 / 2 double mutant plants. Plant scale bar = 10 cm.
[0107] Statistics on the fruit setting rates of g.M82 plants and pdrp1 / 2 double mutant plants. The statistical data was subjected to a two-tailed T-test.
[0108] Fruit morphology and phenotype of the number of seeds per individual fruit of e.M82 plants and pdrp1 / 2 double mutant plants. Fruit and seed scale bar = 2 cm.
[0109] Statistical results of the weight of 100 seeds of h.M82 plants and pdrp1 / 2 double mutant plants. The statistical data was subjected to a two-tailed T-test.
[0110] Statistics on the number of seeds in every 10 fruits after self-pollination of i.M82 plants and pdrp1 / 2 double mutant plants. The statistical data was subjected to a two-tailed T-test.
[0111] Figure 2 Results of pollen detection.
[0112] a. Pollen results of M82 and pdrp1 / 2 double mutant plants stained with Alexander. Scale bar = 25 μm.
[0113] b. Pollen results of M82 and pdrp1 / 2 double mutant plants stained with Calcofluor. Scale bar = 25 μm.
[0114] c. Observation results of pollen of M82 and pdrp1 / 2 double mutant plants under scanning electron microscope. Scale bar for multiple pollen = 20 μm, scale bar for single pollen = 2 μm, scale bar for pollen fine structure = 1 μm.
[0115] d. Pollen germination of M82 and pdrp1 / 2 double mutant plants under normal temperature environment. Scale bar = 100 cm.
[0116] e. Statistics on the viability of Alexander-stained pollen of M82 and pdrp1 / 2 double mutants. The statistical data was subjected to a two-tailed T-test.
[0117] f. Statistics on the pollen germination rates of M82 and pdrp1 / 2 double mutants. The statistical data was subjected to a two-tailed T-test.
[0118] g. Phenotype of semi-thin sections of anthers of M82 and pdrp1 / 2 double mutant plants from stage 7 to stage 12. Detailed implementation methods
[0119] In the experimental methods of the following examples, unless otherwise specified, they are all conventional methods, and are carried out according to the techniques or conditions described in the literature in this field or according to the product instructions. The materials, reagents, instruments, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels. In the following examples, for quantitative tests, at least three repeated experiments are set, and the results are averaged. In the following examples, unless otherwise specified, the first position of each nucleotide sequence in the sequence listing is the 5'-terminal nucleotide of the corresponding DNA / RNA, and the last position is the 3'-terminal nucleotide of the corresponding DNA / RNA.
[0120] Example 1: PDRP1 and PDRP2 can regulate pollen development in tomatoes
[0121] In this example, it was found that the PDRP1 gene (Solyc05g006610) and PDRP2 gene (Solyc05g007650) of tomatoes can regulate their pollen fertility. In tomato M82, the genomic sequence of PDRP1 is as shown in SEQ ID No.1 in the sequence listing, its CDS sequence is as shown in SEQ ID No.2, and it encodes the PDRP1 peptide shown in SEQ ID No.3; the genomic sequence of PDRP2 is as shown in SEQ ID No.4 in the sequence listing, its CDS sequence is as shown in SEQ ID No.5, and it encodes the PDRP2 peptide shown in SEQ ID No.6.
[0122] I. Preparation of gene editing target vector for two genes PDRP1 and PDRP2 in tomatoes
[0123] The CRISPR-Cas9 system was used to edit the PDRP1 gene and PDRP2 gene. There are two target sequences for the PDRP1 gene, namely target 1 (ATTGAAGTACTTGAAAATGG) and target 2 (GTCCTGACCCAATCCACAAC); there are two target sequences for the PDRP2 gene, namely target 1 (GCATTTCTTCTTATATGTAT) and target 2 (GATCAGATCCAATCCACAAT).
[0124] The target vector pDIRECT-22C expression system was selected, the promoter system was selected as CmYLCV, the restriction endonuclease BsaI was selected, and the cleavage system was selected as Csy4. The pDIRECT-22C vector digested with BanI enzyme was used as a template to clone the promoter, and the remaining fragments were cloned using the original pDIRECT-22C vector. The correctly sequenced recombinant vector obtained was designated as pDIRECT-22C-PDRP1-PDRP2. The specific steps are as follows:
[0125] Using the pDIRECT-22C vector digested with BanI as a template, PCR amplification was performed using 22C-PDRP1 F1 and 22C-PDRP1 R1 to obtain a PCR fragment, which is the vector promoter fragment and the first 12 nucleotide sequences of the first target of PDRP1.
[0126] Using the pDIRECT-22C vector as a template, PCR amplification was performed using 22C-PDRP1 F2 and 22C-PDRP1 R2 to obtain a PCR fragment, which is the last 12 nucleotide sequences of the first target of the PDRP1 gene and the first 12 nucleotide sequences of the second target.
[0127] Using the pDIRECT-22C vector as a template, PCR amplification was performed using 22C-PDRP1 F3 and 22C-PDRP2 R3 to obtain a PCR fragment, which is the last 12 nucleotide sequences of the second target of the PDRP1 gene and the first 12 nucleotide sequences of the first target of the PDRP2 gene.
[0128] Using the pDIRECT-22C vector as a template, PCR amplification was performed using 22C-PDRP2 F4 and 22C-PDRP2R4 to obtain a PCR fragment, which is the last 12 nucleotide sequences of the first target of the PDRP2 gene and the first 12 nucleotide sequences of the second target of the PDRP2 gene.
[0129] Using the pDIRECT-22C vector as a template, PCR amplification was performed using 22C-PDRP2 F5 and 22C-PDRP2R5 to obtain a PCR fragment, which is the last 12 nucleotide sequences of the second target of the PDRP2 gene.
[0130] The vector pDIRECT-22C was diluted to 50 ng, and the obtained PCR fragments were mixed in equal amounts and then diluted to 5 - 7 ng. SapI, BanI, T4 ligase, and 10×T4 ligase buffer were added, and water was added to make up to 20 μL for GoldenGate ligation reaction while cutting. The program was 37°C for 5 min, 16°C for 10 min, 15 cycles, 50°C for 5 min, and 80°C for 3 min.
[0131] The ligated fragments were transformed into DH5α Escherichia coli competent cells, and recombinant resistant bacteria were screened on kanamycin medium. Colony identification primers F / R were used to screen correct positive clone plaques, and the correctness of the vector fragment was determined by plasmid extraction and sequencing. Then the correct plasmid (i.e., recombinant vector pDIRECT-22C-PDRP1-PDRP2) was transformed into AGL1 Agrobacterium competent cells.
[0132] The primers used are as follows:
[0133] 22C-PDRP1 F1: TGCTCTTCGCGCTGGCAGACATACTGTCCCAC;
[0134] 22C-PDRP1 R1: TGGTCTCC AAGTACTTCAAT CTGCCTATACGGCAGTGAAC ;
[0135] 22C-PDRP1 F2: TGGTCTCA ACTTGAAAATGG GTTTTAGAGCTAGAAATAGC ;
[0136] 22C-PDRP1 R2: TGGTCTCC TTGGGTCAGGAC CTGCCTATACGGCAGTGAAC ;
[0137] 22C-PDRP1 F3: TGGTCTCA CCAATCCACAAC GTTTTAGAGCTAGAAATAGC ;
[0138] 22C-PDRP2 R3: TGGTCTCC AAGAAGAAATGC CTGCCTATACGGCAGTGAAC ;
[0139] 22C-PDRP2 F4: TGGTCTCA TCTTATATGTAT GTTTTAGAGCTAGAAATAGC ;
[0140] 22C-PDRP2 R4: TGGTCTCC TTGGATCTGATC CTGCCTATACGGCAGTGAAC ;
[0141] 22C-PDRP2 F5: TGGTCTCA CCAATCCACAAT GTTTTAGAGCTAGAAATAGC ;
[0142] 22C-PDRP2 R5: TGCTCTTCTGACCTGCCTATACGGCAGTGAAC.
[0143] II. Genetic transformation of tomato
[0144] After introducing the recombinant vector pDIRECT-22C-PDRP1-PDRP2 obtained in Step 1 into Agrobacterium tumefaciens AGL, the obtained recombinant Agrobacterium was used to perform genetic transformation of tomato by the leaf disc method. The specific steps are as follows:
[0145] (1) Sow tomato M82 seeds one week in advance. First, soak the seeds in sterile water for 30 min, disinfect the surface of the seeds with 70% ethanol for 2 min, disinfect with 10% sodium hypochlorite for 10 min, and rinse with sterile water 3 - 4 times. Then place the seeds on 1 / 2 MS medium (add 2.2 g of MS + 30% sucrose + 0.7% agar powder to 1 L of medium). Conduct dark treatment for 2 days, and then transfer the medium to the light condition.
[0146] (2) Cut the leaves of tomato seeds that have grown for one week into pieces of 0.5 cm × 0.5 cm, and place them on the surface of MSO solid medium (add 4.5 g of MS + 3% sucrose + 0.7% agar powder + 0.2 mg / L 2,4 - D + 0.1 mg / L KT to 1 L of medium) with a layer of filter paper. Place the abaxial end of the explant downward and culture in the dark at 19 °C for 2 days.
[0147] (3) Inoculate the recombinant Agrobacterium into 3 mL of LB liquid medium containing kanamycin and rifampicin resistance and culture overnight. The next day, inoculate at a ratio of 1:100 and shake until OD 600 reaches 0.6 - 0.8. Centrifuge at 5000 g for 10 min to collect the bacterial cells, and resuspend them with MSO liquid medium (add 4.5 g of MS + 3% sucrose + 0.2 mg / L 2,4 - D + 0.1 mg / L KT + 200 μM acetosyringone to 1 L of medium) to obtain the MSO resuspension.
[0148] (4) Transfer the leaves on the medium in (2) into the MSO resuspension in (3), and gently shake the resuspension at a constant speed to infect the leaves for 10 - 15 min.
[0149] (5) After the infection, pour out the bacterial liquid, and place the infected leaves on the surface of D1 medium (add 4.5 g of MS + 3% sucrose + 0.7% agar powder + 0.2 mg / L 2,4 - D + 0.1 mg / L KT + 2 mg / L zeatin + 200 μM acetosyringone to 1 L of medium) with filter paper. Place the abaxial end of the explant downward and culture in the dark at 19 °C for 2 days.
[0150] (6) Transfer the leaves to 2Z medium (add 4.5 g of MS + 3% sucrose + 0.7% agar powder + 2 mg / L zeatin + 200 mg / L ticarcillin + 75 mg / L kanamycin + 500 μM ascorbic acid to 1 L of medium) to induce resistant callus. Change the medium every two weeks. After the resistant tissue differentiates into buds, transfer the callus to 1Z medium (add 4.5 g of MS + 3% sucrose + 0.7% agar powder + 1 mg / L zeatin + 200 mg / L ticarcillin + 75 mg / L kanamycin + 500 μM ascorbic acid to 1 L of medium). When the resistant buds grow to about 2 cm, excise all the explants and callus outside the buds, and transfer the resistant buds to MSSV rooting medium (add 4.5 g of MS + 3% sucrose + 0.7% agar powder + 0.1 mg / L IAA + 2 mg / L ticarcillin + 50 mg / L kanamycin + 500 μM ascorbic acid to 1 L of medium) until the plants take root.
[0151] (7) When the rooted seedlings grow to 5 cm, extract the leaf DNA for gene editing identification, and transplant the identified positive seedlings. The primers used are as follows:
[0152] pDIRECT-22C vector Cas9 PCR identification primer F: GGAGAACCAGCTGTTGTTCCACAT;
[0153] pDIRECT-22C vector Cas9 PCR identification primer R: TCTGGTAGCCTCAGCAGTTTCACCA.
[0154] Among the offspring of the positive seedlings, a pdrp1 / 2 double mutant was identified. This mutant is a homozygous mutation of the PDRP1 gene and the PDRP2 gene. In this mutant, the 2281-2288th positions of SEQ ID No. 1 are deleted in the PDRP1 gene, and the 2231-2238th positions of SEQ ID No. 4 are deleted in the PDRP2 gene, resulting in a frameshift mutation in the encoded protein. Figure 1 in a.
[0155] III. Plant phenotype statistics and detection
[0156] Test plants: Tomato M82, the pdrp1 / 2 double mutant obtained in step II.
[0157] (1) Flowering period statistics: Count the number of true leaves below the first inflorescence when it grows.
[0158] The results show that compared with M82 plants, the pdrp1 / 2 double mutant plants have normal vegetative growth and can flower at the normal time. Figure 1 in b, f.
[0159] (2) Statistics of stamen and pistil lengths: Select the flowers that bloom on the same day, strip the flower structures, transfer them to a stereomicroscope for photographing and recording, and use ImageJ software to measure and record the lengths of stamens and pistils.
[0160] The results showed that compared with M82 plants, the pistil length of the pdrp1 / 2 double mutant plants was significantly shorter than that of M82 plants, and the stamen length was also significantly shorter than that of M82 plants. Figure 1 In c, j, k.
[0161] (3) Statistics of fruit set rate: After four inflorescences of each plant are completely set with fruits from bottom to top, the fruit set rates of these four inflorescences are counted, and the average value is taken as the fruit set rate of this plant material.
[0162] The results showed that compared with M82 plants, the fruit set rate of the pdrp1 / 2 double mutant plants was significantly lower than that of M82 plants. Figure 1 In d, g, e.
[0163] (4) Statistics of fruit weight and seed number. Weigh and count all the red-ripe fruits of the background material and mutant material. Take every ten fruits as a group and count the number of all seeds in each group of fruits. Weigh and count the weight of every 100 seeds of the background material and mutant material.
[0164] The results showed that compared with M82 plants, the weight of 100 seeds of the pdrp1 / 2 double mutant plants was significantly lower than that of M82 plants; compared with M82 plants, the number of seeds in every ten fruits of the pdrp1 / 2 double mutant plants was significantly less than that of M82 plants. Figure 1 In d, h, i.
[0165] (5) Pollen Alexander staining: 1) Select the flowers that bloom on the same day, remove the pistils, petals and sepals, make three small cuts on the stamens with a blade, put them into a centrifuge tube and add an appropriate amount of sterile water, and shake well; 2) Centrifuge at 8000g at room temperature for 1 min, and discard the supernatant; 3) Add 100 μL of Alexander staining solution (Solarbio, product number G3050) to the centrifuge tube, mix well, and stain at room temperature for 30 min; 4) Take 40 μL of the stained and well-mixed pollen, drop it on a glass slide, slowly cover it with a coverslip, suck off the excess liquid, place it under a microscope, randomly select 8 fields of view, and observe and count the pollen germination. The active pollen shows purple-red after staining, and the cytoplasm and inactive pollen are blue-green.
[0166] The results showed that compared with M82 pollen, the pollen activity of the pdrp1 / 2 double mutant plants was significantly lower. Figure 2 In a, e.
[0167] (6) Pollen Calcofluor staining:
[0168] 1) Take the flowers that bloom on the same day, remove the pistils, petals and sepals, make three small incisions on the stamens with a blade, put them into a centrifuge tube and add an appropriate amount of sterile water, then shake well; 2) Centrifuge at 8000g at room temperature for 1 minute, and discard the supernatant; 3) Add 100 μL of Calcofluor staining solution (Coolaber, product number SL7204) and an equal volume of 10% potassium hydroxide into the centrifuge tube, mix well, and stain at room temperature for 10 minutes; 4) Take 40 μL of the stained and well-mixed pollen, drop it on a glass slide, slowly cover it with a cover slip, suck off the excess liquid and place it under a microscope. Use the spectral range of 300 - 440 nm as the emission spectrum, with an excitation wavelength of 355 nm, and observe the fluorescence of the pollen.
[0169] The results showed that almost all the pollen of M82 had fluorescence, while about 60% of the pollen of the pdrp1 / 2 double mutant plants had no fluorescence, indicating that the inactivity of the pdrp1 / 2 double mutant pollen was due to the absence of the intine. Figure 2 In b.
[0170] (7) Pollen germination experiment:
[0171] 1) Prepare the pollen germination medium: 0.01% (mass percentage) boric acid, 5 mM potassium chloride, 1 mM magnesium sulfate, 5 mM calcium chloride, adjust the pH of the solution to 7.5 - 8.0 with NaOH, 18% (mass percentage) sucrose, 1% (mass percentage) low melting point agarose, and the balance is water.
[0172] 2) Take the flowers that bloom on the same day, remove the pistils, petals and sepals, make three small incisions on the stamens with a blade, put them into a centrifuge tube and add an appropriate amount of sterile water, then shake well. Centrifuge at 8000g at room temperature for 1 minute, and discard the supernatant; then add 50 μL of sterile water, transfer the pollen to the pollen germination medium, seal the culture dish with a sealing film, and culture it in the dark at 25°C for 4 - 6 hours. Randomly select 8 fields of view, and observe and count the pollen germination situation.
[0173] The results showed that compared with the M82 plants, the pollen germination rate of the pdrp1 / 2 double mutant plants was significantly lower than that of the M82 pollen due to the absence of the intine in the pdrp1 / 2 double mutant plants. Figure 2 In d, f.
[0174] (8) Pollen scanning electron microscopy:
[0175] 1) Take the flowers that are open on the same day, remove the pistils, petals and sepals, make three small cuts on the stamens with a blade, put them into a centrifuge tube, and add an appropriate amount of sterile water and shake well; 2) Centrifuge at 8000 g at room temperature for 1 min, and discard the supernatant; 3) Add 1 mL of absolute ethanol to soak the pollen, and then change the absolute ethanol twice; 4) Wrap the pollen tightly with filter paper, and then transfer it to a Laica critical point dryer for drying for 2 hours; 5) Lay the conductive tape on the sample stage of the scanning electron microscope, transfer the dried pollen to the sample stage, and spray it on the surface of the pollen sample with a sputter coater; 6) Transfer different sample stages to the scanning electron microscope, evacuate in the instrument, and observe the samples.
[0176] The results showed that the reduction of pollen viability in pdrp1 / 2 double mutant plants was not due to defects in the pollen exine and pollen coat. Figure 2 Medium c.
[0177] (9) Semi-thin section of anthers:
[0178] 1) Put the tomato inflorescences into small round-bottomed bottles containing 70% FAA fixative (70% ethanol, 5% glacial acetic acid and 3.7% formaldehyde), keep the vacuum pump pressure at 0.8 Kpa, evacuate twice, 30 min each time, and change the FAA fixative to fix the inflorescence material overnight; 2) Gradient dehydrate the fixed inflorescence materials in 50% ethanol aqueous solution, 60% ethanol aqueous solution, 70% ethanol aqueous solution, 80% ethanol aqueous solution, 95% ethanol aqueous solution, absolute ethanol and absolute ethanol for 1 hour each; 3) Add a mixture of absolute ethanol / Technovit 7100 (Technovit 7100 embedding resin) (1:1) and replace it on a shaker for 2 hours; 4) Weigh 1 g of Hardener Ⅰ and dissolve it thoroughly in 100 mL of Technovit 7100, replace the liquid in each small bottle with an appropriate amount of the mixed infiltration solution, and mix at room temperature overnight; 5) Prepare the embedding solution according to the ratio of infiltration solution:Hardener Ⅱ = 15:1. Place the embedding plate flat on the drying oven, add 200 μL of the embedding solution to each embedding hole, add a single flower bud to the embedding hole and adjust the position of the inflorescence. After all the inflorescences are embedded, turn on the drying oven to 42 °C, and place the samples in an oven at 65 °C overnight after 4 hours; 6) Trim the embedded resin materials, cut off the excess resin materials, and cut the embedded materials with a Laica semi-thin microtome, with a thickness of 2 - 2.5 μm; 7) Spread the cut materials flat on the glass slide, stain the sections with 0.5% toluidine blue for 30 s, and observe the anther structure at different stages under the microscope.
[0179] The results showed that the number of viable pollen in the 12th stage of anthers of pdrp1 / 2 double mutant plants was significantly less than that in M82 anthers. Figure 2 Medium g.
[0180] The present invention has been described in detail above. For those skilled in the art, without departing from the spirit and scope of the present invention and without unnecessary experiments, the present invention can be implemented within a relatively wide range under equivalent parameters, concentrations and conditions. Although specific embodiments of the present invention are given, it should be understood that the present invention can be further improved. In short, according to the principle of the present invention, this application is intended to cover any modifications, uses or improvements of the present invention, including changes made using conventional techniques known in the art that depart from the scope disclosed in this application.
Claims
1. Use of a protein or a substance that regulates the content or activity of said protein, in any of the following aspects: D1) Regulating plant fertility; D2) Regulating the length of pistils and / or stamens of plants; D3) Regulating plant seed yield; D4) Regulating plant fruit yield; D5) Preparing a product for regulating plant fertility; D6) Preparing a product for regulating the length of pistils and / or stamens of plants; D7) Preparing a product for regulating plant seed yield; D8) Preparing a product for regulating plant fruit yield; Said protein is PDRP1 peptide and / or PDRP2 peptide, and said PDRP1 peptide is any of the following A1), A2) or A3): A1) A protein with an amino acid sequence of SEQ ID No. 3; A2) A protein with the amino acid sequence shown in SEQ ID No. 3 in the sequence listing, having undergone substitution and / or deletion and / or addition of one or several amino acid residues and having the same function; A3) A fusion protein obtained by linking a tag to the N-terminus and / or C-terminus of A1) or A2); Said PDRP2 peptide is any of the following B1), B2) or B3): B1) A protein with an amino acid sequence of SEQ ID No. 6; B2) A protein with the amino acid sequence shown in SEQ ID No. 6 in the sequence listing, having undergone substitution and / or deletion and / or addition of one or several amino acid residues and having the same function; B3) A fusion protein obtained by linking a tag to the N-terminus and / or C-terminus of B1) or B2).
2. The application according to claim 1, wherein: Said plant fertility is plant pollen fertility; Said seed yield is reflected in seed weight and / or quantity; Said fruit yield is reflected in fruit quantity.
3. The application according to claim 1 or 2, characterized in that: Said substance that regulates the content or activity of said protein is a substance that reduces the content or activity of said protein, said regulation of plant fertility is to reduce plant fertility, said regulation of the length of pistils and / or stamens of plants is to reduce the length of pistils and / or stamens of plants, said regulation of plant seed yield is to reduce plant seed yield, and said regulation of plant fruit yield is to reduce plant fruit yield.
4. The application according to any one of claims 1-3, characterized in that: Said substance that regulates the content or activity of said protein is a substance that regulates the content or activity of said PDRP1 peptide and / or a substance that regulates the content or activity of said PDRP2 peptide, and said substance that regulates the content or activity of said PDRP1 peptide is any one of the following E1) to E9): E1) A nucleic acid molecule encoding said PDRP1 peptide; E2) An expression cassette containing the nucleic acid molecule of E1); E3) A recombinant vector containing the nucleic acid molecule of E1), or a recombinant vector containing the expression cassette of E2); E4) A recombinant microorganism containing the nucleic acid molecule of E1), or a recombinant microorganism containing the expression cassette of E2), or a recombinant microorganism containing the recombinant vector of E3); E5) A transgenic plant cell line containing the nucleic acid molecule of E1), or a transgenic plant cell line containing the expression cassette of E2); E6) A transgenic plant tissue containing the nucleic acid molecule of E1), or a transgenic plant tissue containing the expression cassette of E2); E7) A transgenic plant organ containing the nucleic acid molecule of E1), or a transgenic plant organ containing the expression cassette of E2); Nucleic acid molecules that reduce the content of the PDRP1 peptide; E9) Expression cassettes, recombinant vectors, recombinant microorganisms, transgenic plant cell lines, transgenic plant tissues, or transgenic plant organs containing the nucleic acid molecules described in E8); The substance that regulates the content or activity of the PDRP2 peptide is any one of the following F1) to F9): F1) Nucleic acid molecules encoding the PDRP2 peptide; F2) Expression cassettes containing the nucleic acid molecules described in F1); F3) Recombinant vectors containing the nucleic acid molecules described in F1), or recombinant vectors containing the expression cassettes described in F2); F4) Recombinant microorganisms containing the nucleic acid molecules described in F1), or recombinant microorganisms containing the expression cassettes described in F2), or recombinant microorganisms containing the recombinant vectors described in F3); F5) Transgenic plant cell lines containing the nucleic acid molecules described in F1), or transgenic plant cell lines containing the expression cassettes described in F2); F6) Transgenic plant tissues containing the nucleic acid molecules described in F1), or transgenic plant tissues containing the expression cassettes described in F2); F7) Transgenic plant organs containing the nucleic acid molecules described in F1), or transgenic plant organs containing the expression cassettes described in F2); F8) Nucleic acid molecules that reduce the content of the PDRP2 peptide; F9) Expression cassettes, recombinant vectors, recombinant microorganisms, transgenic plant cell lines, transgenic plant tissues, or transgenic plant organs containing the nucleic acid molecules described in F8).
5. The application according to claim 4, characterized in that: E1) The nucleic acid molecule is any of the following e11) or e12) or e13) or e14) or e15): e11) A DNA molecule whose coding sequence is the DNA molecule of SEQ ID No. 2 in the sequence listing; e12) The DNA molecule shown in SEQ ID No. 2 in the sequence listing; e13) The DNA molecule shown in SEQ ID No. 1 in the sequence listing; e14) A DNA molecule that has 75% or more identity with the nucleotide sequence defined by e11) or e12) or e13) and encodes the PDRP1 peptide; e15) A DNA molecule that hybridizes with the nucleotide sequence defined by e11) or e12) or e13) or e14) under stringent conditions and encodes the PDRP1 peptide; F1) The nucleic acid molecule is any of the following f11) or f12) or f13) or f14) or f15): f11) A DNA molecule whose coding sequence is the DNA molecule of SEQ ID No. 5 in the sequence listing; f12) The DNA molecule shown in SEQ ID No. 5 in the sequence listing; f13) The DNA molecule shown in SEQ ID No. 4 in the sequence listing; f14) A DNA molecule that has 75% or more identity with the nucleotide sequence defined by f11) or f12) or f13) and encodes the PDRP2 peptide; f15) A DNA molecule that hybridizes with the nucleotide sequence defined by f11) or f12) or f13) or f14) under stringent conditions and encodes the PDRP2 peptide.
6. The application according to any one of claims 1-5, characterized in that: The plant is M1) or M2) or M3) or M4) or M5): M1) Dicotyledonous plants or monocotyledonous plants; M2) Plants of the Solanales order; M3) Plants of the Solanaceae family; M4) Solanum plants; M5) Tomato.
7. Any of the following methods: X1) A method for cultivating plants with reduced pollen fertility, comprising: Reducing the content or activity of the PDRP1 peptide and the PDRP2 peptide described in claim 1 in a recipient plant, or knocking out the coding genes of the PDRP1 peptide and the PDRP2 peptide described in claim 1, to obtain a target plant with reduced pollen fertility; X2) A method for cultivating a plant with reduced pistil and / or stamen length, comprising: reducing the content or activity of the PDRP1 peptide and the PDRP2 peptide described in claim 1 in a recipient plant, or knocking out the coding genes of the PDRP1 peptide and the PDRP2 peptide described in claim 1, to obtain a target plant with reduced pistil and / or stamen length; X3) A method for cultivating a plant with reduced seed yield, comprising: reducing the content or activity of the PDRP1 peptide and the PDRP2 peptide described in claim 1 in a recipient plant, or knocking out the coding genes of the PDRP1 peptide and the PDRP2 peptide described in claim 1, to obtain a target plant with reduced seed yield; X4) A method for cultivating a plant with reduced fruit yield, comprising: reducing the content or activity of the PDRP1 peptide and the PDRP2 peptide described in claim 1 in a recipient plant, or knocking out the coding genes of the PDRP1 peptide and the PDRP2 peptide described in claim 1, to obtain a target plant with reduced fruit yield.
8. The method according to claim 7, wherein: The plant is M1) or M2) or M3) or M4) or M5): M1) Dicotyledonous plants or monocotyledonous plants; M2) Solanales plants; M3) Solanaceae plants; M4) Solanum plants; M5) Tomato.
9. The protein described in claim 1.
10. The substance for regulating the content or activity of the protein according to any one of claims 1-5.
Citation Information
Patent Citations
Seed specificity highly effective promoter and its application
CN101063139A
Seed specific highly effective promoter and its application
CN101063139B
Recombinant DNA: transformed microorganisms, plant cells and plants: a process for introducing an inducible property in plants, and a process for producing a polypeptide or protein by means of plants or plant cells
US5057422A
Plant proteins, promoters, coding sequences and use
US5187267A