Application of strawberry FvPR10.14 gene or protein coded by strawberry FvPR10.14 gene in strawberry powdery mildew resistance
By cloning the strawberry FvPR10.14 gene and building stable genetically modified strawberries, the chemical pollution prevention and control of strawberry powdery mildew was solved, and the environmentally friendly anti-powdery breeding goal was achieved.
Patent Information
- Application Number
- CN202510793186.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-13
- Publication Date
- 2025-07-25
AI Technical Summary
There is no application of PR10 family members in the prior art in resistant to strawberry powdery mildew. Chemical prevention and control is polluted to the environment. Screening of high-powdery strawberry varieties and beneficial microbial prevention and control is not yet mature.
The strawberry FvPR10.14 gene was cloned and induced by phlegmella to construct stable transgenic strawberries, verifying their anti-phlegmella mechanism, and providing theoretical support for strawberry anti-phlegmella breeding.
By overexpressing the FvPR10.14 gene, the resistance of strawberries to powdery mildew is significantly enhanced, the use of chemical agents is reduced, and environmentally friendly prevention and treatment plans are provided.
Smart Images

Figure CN120366374A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of plant genetic engineering, and in particular to application of a strawberry FvPR10.14 gene or a protein encoded by it in resisting strawberry powdery mildew. Background Art
[0002] Strawberry powdery mildew is a major disease of greenhouse-grown strawberries. It is caused by Podosphaera aphanis (Wallr.) U. Braun & S. Takam, formerly known as Sphaerotheca aphanis (Wallr.) Braun, of the genus Sphaerotheca in the family Erysipheales in the subdivision Ascomycota. This pathogen is a strictly obligate, living parasitic fungus. The disease occurs throughout the strawberry's growth period, primarily infecting leaves, petioles, buds, pedicels, fruit, and even runners. It is characterized by low temperatures, recurring symptoms, high frequency, rapid infection, and a short incubation period. Currently, chemical control is still the primary method for the prevention and control of strawberry powdery mildew, with sterols, benzimidazoles, pyrimidines, and triazoles as the main chemical agents, which inhibit the growth and development of spores or appressoria. With the gradual deepening of green prevention and control awareness, screening strawberry varieties with high resistance to powdery mildew and using beneficial microorganisms to control strawberry powdery mildew in order to reduce environmental pollution and protect the physical and mental health of consumers has become the current top priority.
[0003] Plant pathogenesis-related proteins 10 (PR10s) are a class of proteins consisting of 151 to 163 amino acids found in monocotyledons and dicotyledons. Most PR10 proteins possess nuclease activity, and "P-LOOP" is a domain commonly found in phosphorylating kinases and nucleic acid-binding proteins. Due to their unique protein structure, PR10 proteins possess DNase, RNase, and antibacterial activities. Studies have shown that recombinant VpPR10.2 protein exhibits nuclease activity and can inhibit tobacco brown spot disease. Overexpression of VpPR10.2 in susceptible grape varieties enhances resistance to downy mildew. Silencing PR10.5D1 in cotton increases susceptibility to Verticillium dahliae, while overexpression increases tolerance (Guo et al., 2022). However, there are currently no reports on the mechanisms by which PR10 family members contribute to resistance to powdery mildew in strawberry.
[0004] In view of the above-mentioned defects, the inventors of the present invention finally obtained the present invention after a long period of research and practice. Summary of the Invention
[0005] The purpose of the present invention is to solve the problem of how to apply PR10 family members to resistance to strawberry powdery mildew, and provide the application of strawberry FvPR10.14 gene or the protein encoded by it in resistance to strawberry powdery mildew.
[0006] To achieve the above objectives, the present invention discloses the use of the strawberry FvPR10.14 gene or the protein encoded by it in resisting strawberry powdery mildew. The nucleotide sequence of the strawberry FvPR10.14 gene is shown in SEQ ID NO.1.
[0007] The specific sequence is as follows:
[0008] ATGGGTGTGTTCACATATGAAACCGAGTTCACCTCTGTCATTCCACCACCAAGACTC
[0009] TACAAGGCCTTTGTCCTTGATGCTGATAACCTCATCCCAAAGATTGCCCCACAGGCTGTG
[0010] AAGAGTGCCGAGATCGTTCAAGGTGATGGAGGTGTCGGAACCATCAAGAAGATCCACC
[0011] TTGGTGAAGGGAGCGAATACAGCTACGTGAAACACCAGATTGATGGACTTGACAAAGA
[0012] CAACTTTGTTTACAACTACAGTATCATTGAAGGTGATGCTATCGGAGACAAGGTAGAGA
[0013] AAATCTCTTACGAGATCAAGTTGGTGGCGTCTCCAAGTGGAGGCTCCATCATCAAGAGC
[0014] ACCAGCCACTACCATTGCAAAGGAGAGGTTGAGATCAAGGAAGAGCATGTCAAGGCCG
[0015] GAAAAGAAAAAAGCCGCTGGTCTGTTCAAGATCATTGAGAACCACCTTTTGGCCAACCCT
[0016] GAGGCCTACAACTAA.
[0017] The amino acid sequence of the protein encoded by the strawberry FvPR10.14 gene is shown in SEQ ID NO.2.
[0018] The specific sequence is as follows:
[0019] 1 MGVFTYETEF TSVIPPPRLY
[0020] 21 KAFVLDADNL IPKIAPQAVK
[0021] 41 SAEIVQGDGG VGTIKKIHLG
[0022] 61 EGSEYSYVKH QIDGLDKDNF
[0023] 81 VYNYSIIEGD AIGDKVEKIS
[0024] 101 YEIKLVASPS GGSIIKSTSH
[0025] 121 YHCKGEVEIK EEHVKAGKEK
[0026] 141 AAGLFKIIEN HLLANPEAYN
[0027] 161 *
[0028] Compared with the prior art, the present invention has the following beneficial effects: the present invention uses the strawberry genome to successfully clone the PR10.14 gene, and through powdery mildew induction, uses stable transgenic strawberries to verify the powdery mildew resistance mechanism of this gene, providing theoretical support for the long-term goal of strawberry powdery mildew resistance breeding. BRIEF DESCRIPTION OF THE DRAWINGS
[0029] Figure 1 For PCR amplification of FvPR10.14 gene;
[0030] Figure 2 Analysis of the expression of FvPR10.14 in different tissues and organs of strawberry;
[0031] Figure 3 This is the expression analysis of FvPR10.14 at different developmental stages of strawberry;
[0032] Figure 4 is the expression pattern of PR10.14 after inoculation with powdery mildew;
[0033] Figure 5 Screening of positive strawberry lines for PCR identification;
[0034] Figure 6 is the expression level of FvPR10.14 in transgenic plants;
[0035] Figure 7Phenotype of FvPR10.14 transgenic strawberry 7 days after inoculation with powdery mildew;
[0036] Figure 8 Conidia counts for FvPR10.14 overexpressing strawberry 7 days after inoculation with powdery mildew;
[0037] Figure 9 The FvPR10.14 transgenic cells were stained with trypan blue and DAB after inoculation with powdery mildew. DETAILED DESCRIPTION
[0038] The above and other technical features and advantages of the present invention are described in more detail below with reference to the accompanying drawings.
[0039] First, based on the GDR genome database and NCBI database information, the full-length CDS sequence and promoter sequence of the gene were searched and specific primers were designed. The primer sequences were (fw: CTTGTGTCATTTCCCAACTCA, rv: ATGGTTTCAGCACCCTTGAC). The FvPR10.14 gene was amplified using the cDNA of the leaves of forest strawberry 'Ruegen' as a template.
[0040] The fluorescence quantitative PCR instrument model is BioRad CFX96M. HieffTM qPCR was used. Real-time quantitative PCR (RT-qPCR) was performed using the Green MasterMix (Yeasen, Shanghai, China) kit for roots, stems, leaves, flowers, and fruits at different developmental stages (fw: ATGGGTGTCTTCACTTATG, rv: TTAGCAGTATTCATTAGGATTGG). The interspacer 26S-18S RNA gene was used as an internal control for relative quantification. The program was set to a thermal cycle condition of 95°C for 5 min, followed by 45 cycles of 95°C for 10 sec, 60°C annealing for 10 sec, and 72°C extension for 10 sec, followed by a melting temperature cycle, and fluorescence data were continuously collected from 65°C to 95°C. Each reaction was performed in triplicate using 2 -△△CT Methods The data were analyzed.
[0041] Specific primers (fw: CTTGTGTCATTTCCCAACTCA, rv: ATGGTTTCAGCACCCTTGAC) were designed and PCR amplified using cDNA from diploid forest strawberry leaves as template. Agarose gel electrophoresis analysis revealed a 483 bp full-length fragment of the FvPR10.14 sequence encoding 161 amino acids. Figure 1 shown.
[0042] Powdery mildew inoculation treatment:
[0043] The powdery mildew-infected strawberry plants were inoculated with powdery mildew fungi from 6-month-old strawberry seedlings whose 10th leaf was fully expanded using the shaking-off method. The temperature and humidity were controlled at around 22°C / 85%, with 8 hours of light and 16 hours of darkness.
[0044] 2. Construction of pCAMBIA1302-GFP fusion expression vector
[0045] The vector used was pCAMBIA1302, which carries a GFP fluorescent protein tag and uses restriction enzyme sites Bgl II and Spe I. To ensure proper expression of the gene in fusion with the GFP protein, the upstream primer needed to account for codon shifts by adding a C before the start codon ATG. The downstream primer also needed to remove the stop codons TAA / TAG / TGA (fw:ACTCTTGACCATGGTAGATCTCATGGGTGTCTTCACTTATGAAACTG, rv:AAGTTCTTCTCCTTTACTAGTTTAGCAGTATTCATTAGGATTGGCC). PCR amplification was performed using the upstream and downstream primers with protected bases and restriction enzyme sites, using a plasmid containing the simplified cloning vector pMD19-T as a template. The amplified products were then recovered by gel analysis.
[0046] The pCAMBIA1302 plasmid was extracted using the aforementioned plasmid DNA extraction method. The pCAMBIA1302 plasmid was double-digested with BglII and SpeI restriction enzymes at 37°C for 90 minutes. The gene and pCAMBIA1302 vector fragments were recovered and ligated using seamless cloning ligase at 50°C for 20 minutes. E. coli was transformed, and colonies expressing the pCAMBIA1302 fusion protein were screened by colony PCR and cell culture sequencing. The cells were then stored at -80°C until further use.
[0047] 3. Agrobacterium-mediated infection of recombinant plasmids into strawberries to obtain transgenic plants:
[0048] (1) Diploid strawberry seeds were sterilized with 75% ethanol and sown on growth medium, vernalized at 4°C for 3 days, and cultured in a light incubator at 24°C until they germinated.
[0049] (2) Activate 50 μL of Agrobacterium in 50 mL of LB liquid medium at 250 rpm, 28°C, for 16-24 hours. Centrifuge at room temperature for 6 minutes and discard the supernatant. Resuspend the cells in MS infection medium to an OD600 of ≈1.5.
[0050] (3) Place the pre-germinated seeds in MS infection solution with an adjusted OD value and incubate in a 28°C constant temperature shaker in the dark for 24 hours. Then place the seeds in growth medium and incubate in a 25°C constant temperature incubator in the dark for three days.
[0051] (4) Place the seeds from (3) on selective medium (5 mg / L Hyg B) and continue culturing under light conditions.
[0052] (5) After 2 weeks, the seedlings were transplanted into quartz sand, covered with plastic wrap for three days to prevent water loss, and watered with nutrient solution supplemented with 2 mg / L hygromycin B to allow them to grow under appropriate selection pressure.
[0053] (6) DNA and RNA were extracted from the leaves of rooted seedlings and identified using PCR and RT-qPCR techniques (primers: fw: CCTCATCCCAAAGATTGCCC, rv: AATGGTAGTGGCTGGTGCTC).
[0054] 4. Pathogen biomass statistics:
[0055] The infected leaves were cut and weighed using a balance. 2 mg of leaves were immersed in a 5 mL centrifuge tube containing 2 mL of sterile 10% glycerol solution and vortexed for 5 minutes. The suspension was pipetted with a pipette and dropped into the counting area of a hemocytometer. The conidia were then counted using a microscope. Each sample was repeated three times.
[0056] 5. DAB and trypan blue staining test:
[0057] Trypan blue staining: Add 5 mL each of sterile water, phenol, lactic acid, and glycerol, and 30 mL of anhydrous ethanol to a beaker, then weigh and add 0.04 g of trypan blue powder, mix well, and store in a brown glass bottle.
[0058] DAB staining: Use a graduated cylinder to weigh 50 mL of deionized water and add it to a beaker. Titrate to pH 3.8 with concentrated hydrochloric acid. Finally, add and dissolve DAB powder to a final concentration of 1 mg / mL. Store in a brown glass bottle.
[0059] Trypan blue solution was used to detect cell death. Samples were immersed in the solution at different time points after infection and then boiled for staining. Strawberries were boiled for 5 minutes, and the leaves were destained with chloral hydrate after staining. DAB staining was used to visualize H₂O₂ levels. The leaves were immersed in DAB and stained for 8 hours, followed by destaining three times in 95% ethanol.
[0060] like Figure 2As shown in the figure, the expression pattern of FvPR10.14 was analyzed by RT-qPCR in different tissues and organs of forest strawberry (roots, stems, young leaves, functional leaves, mature leaves, flowers, and fruits) and in different developmental stages of strawberry fruits (small green, large green, green-white, ginkgo, color change, mature, and overripe). The results showed that among the vegetative organs, FvPR10.14 expression was lowest in young leaves. RT-qPCR detection of FvPR10.14 expression levels revealed that FvPR10.14 expression was relatively high in roots and mature leaves, with the lowest expression in young leaves.
[0061] like Figure 3 As shown in the figure, in the different developmental stages of the fruit (reproductive organs), including small green (SG), large green (LG), green and white (GW), white fruit (W), color change (RT), maturity (R), and overripe (OR), the expression level of FvPR10.14 gradually increased with the maturity of the fruit and reached a peak in the overripe stage.
[0062] After inoculation of strawberry powdery mildew, leaves were collected at 0, 4, 8, 12, 24, 48, 72, and 120 hours, and RT-qPCR was used to detect whether FvPR10.14 was induced by powdery mildew. Figure 4 It can be seen that the FvPR10.14 gene was significantly upregulated in response to powdery mildew.
[0063] The FvPR10.14-pCAMBIA1302-GFP fusion expression vector was constructed and then infected into diploid strawberry. Twenty strawberry plants were identified by PCR and RT-qPCR. It was found that the expression levels of the three transgenic strawberry lines OX4, OX15 and OX16 were significantly increased compared with the wild type (WT). Therefore, these three lines were selected for subsequent experiments.
[0064] To further verify the resistance of FvPR10.14 transgenic plants to powdery mildew, three transgenic lines, OX4, OX15, and OX16, as well as wild-type strawberry, were inoculated with powdery mildew. The disease incidence was evaluated and analyzed 7 days after powdery mildew inoculation. Figure 7 It can be seen that the infected parts of transgenic and wild-type strawberries are the young leaflets close to the base of the stem. Compared with the wild type, the leaves of the three overexpression strains are significantly less sensitive to powdery mildew, and only a small amount of dot-like powdery spots appear on the leaves.
[0065] At the same time, use a blood cell counting plate to count under a microscope, such as Figure 8 As shown, the amount of conidia on infected leaves of the transgenic strawberry lines was found to be approximately 1 / 4 of that of the wild type.
[0066] The wild-type strain and the overexpression strain were stained with trypan blue and DAB 10 days after inoculation. Figure 9Trypan blue staining revealed that 10 days after inoculation, the number of powdery mildew spores germinated on the leaf surfaces of wild-type plants was significantly greater than that of the overexpressing transgenic plants. Furthermore, as the secondary hyphae grew and further elongated, they intersected and formed a network structure. New conidia were also produced, marking the beginning of a new round of infection. However, the overexpressing strain had significantly slower hyphae growth, and fewer secondary hyphae and conidia. DAB staining revealed that the overexpressing FvPR10.14 transgenic strain produced more yellow-brown deposits than the wild type 10 days after inoculation, indicating greater accumulation of H2O2. This suggests that FvPR10.14 may be involved in the powdery mildew-induced allergic response to inhibit the reproduction of living parasitic fungi.
[0067] The above description is merely a preferred embodiment of the present invention and is intended to be illustrative rather than restrictive of the present invention. Those skilled in the art will appreciate that many changes, modifications, and even equivalents may be made to the present invention within the spirit and scope of the claims, all of which fall within the scope of protection of the present invention.
Claims
1. Use of strawberry FvPR10.14 gene or protein encoded thereby in resistance to strawberry powdery mildew, characterized in that, The nucleotide sequence of the strawberry FvPR10.14 gene is shown in SEQ ID NO.
1.
2. The strawberry FvPR as described in claim 1 Use of a gene or a protein encoded thereby in resisting strawberry powdery mildew, characterized in that, The amino acid sequence of the protein encoded by the strawberry FvPR10.14 gene is shown in SEQ ID NO.2.