Application of StGAD1 gene in regulation and control of low-temperature resistance of potatoes

Abstract

The invention discloses application of an StGAD1 gene in regulation and control of low-temperature resistance of potatoes, and belongs to the technical field of biology. The StGAD1 gene of potato glutamate decarboxylase is obtained from the potatoes for the first time, the StGAD1 gene is knocked out from the potatoes through an agrobacterium tumefaciens-mediated method for functional verification, and the StGAD1 gene is applied to regulation and control of low-temperature resistance of the potatoes. The result shows that the potato plant is more sensitive to cold stress due to StGAD1 gene deletion, which shows that the StGAD1 gene plays an important role in responding to low-temperature stress, and opens up a new way for crop stress resistance breeding.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and particularly relates to StGAD1 the application of a gene in regulating the cold resistance of potatoes. Background Art

[0002] Low-temperature stress, as a key bottleneck restricting the development of protected agriculture, seriously threatens the yield formation and quality maintenance of horticultural crops such as potatoes. Based on new gene editing technologies such as CRISPR / Cas9, this study focuses on the precise editing of key genes in potato cold response. By systematically analyzing the physiological and biochemical response rules of gene-edited lines under low-temperature treatment, a differentiated cold-resistant germplasm innovation strategy is established: overexpression technology is used for functional compensation of gene-edited lines sensitive to low temperature, while excellent lines with significantly improved low-temperature tolerance are directly applied to molecular breeding practice. This technical system innovatively combines reverse genetics and forward genetics, providing a theoretical basis and technical support for creating new varieties of vegetables specialized for protected cultivation with wide adaptability. It is of great significance for breaking through the environmental limiting factors in protected vegetable production, ensuring the year-round balanced supply of vegetables, and enhancing the industrial economic benefits, meeting the major needs of the high-quality development of modern agriculture in China.

[0003] Potato ( Solanum tuberosum ), as the fourth largest food crop in the world, is vulnerable to environmental stresses during its growth and development, and low-temperature stress is one of the main factors leading to yield loss. In recent years, the breakthrough of gene editing technology has accelerated the identification and functional analysis of key genes in potato response to adversity (such as low temperature, drought, and disease). Glutamate Decarboxylase 1 (GAD1) is a key rate-limiting enzyme that catalyzes the decarboxylation of glutamate to produce γ-aminobutyric acid (GABA). This enzyme depends on pyridoxal phosphate (PLP, the active form of vitamin B6) as a coenzyme and plays a core role in plant stress response, nitrogen metabolism, and signal transduction by regulating the biosynthesis of GABA. Research shows that when plants are exposed to drought, low temperature, or salt stress, the increase in cytoplasmic calcium ion (Ca²⁺) concentration can activate GAD1, thereby promoting GABA accumulation. This Ca²⁺-GAD1-GABA signaling pathway is recognized as an important mechanism for enhancing plant environmental adaptability. Although the function of GAD1 in model plants has been preliminarily elucidated, its specific regulatory network and breeding application value in potato low-temperature stress response have not been systematically revealed. Summary of the Invention

[0004] The purpose of the present invention is to provide an StGAD1 application of a gene in regulating the cold resistance of potatoes.

[0005] To achieve the above object, the technical solution of the present invention is as follows: The present invention has found a potato glutamate decarboxylase StGAD1 gene (LOC102578660), the NCBI reference sequence is: XM_006352326.2, its CDS sequence is shown in SEQ ID NO.1, containing 1509 bases, encoding 502 amino acids, and its amino acid sequence is shown in SEQ ID NO.2.

[0006] The present invention also includes the following proteins: (1) A protein having the amino acid sequence shown in SEQ ID NO.2; (2) Derived proteins formed by substitution, deletion or addition of 1 to 30 (preferably 1 to 20, more preferably 1 to 10, such as 5 or 3) amino acid residues on the basis of the amino acid sequence shown in SEQ ID NO.2, and retaining the function of the SEQ ID NO.2 protein; (3) Derived proteins having at least 80% (preferably more than 90%, such as 95%, 98%, 99% or higher) homology with the amino acid sequence shown in SEQ ID NO.2, and retaining the function of the SEQ ID NO.2 protein.

[0007] Correspondingly, the gene function protected by the present invention not only covers the potato glutamate decarboxylase StGAD1 gene (SEQ ID NO.1), but also covers homologous genes having a high homology with SEQ ID NO.1 (such as higher than 80%; particularly preferably higher than 90%; most preferably higher than 95% or 98% or more) and encoding proteins with the same function.

[0008] The main object of the present invention is to clone and identify the function of the potato glutamate decarboxylase StGAD1 gene in regulating the cold resistance of potatoes at the molecular level, providing a theoretical basis for analyzing the molecular mechanism of potato response to cold stress and growth and development regulation.

[0009] Among them, the regulation of potato cold resistance is specifically manifested as: compared with the wild-type control, StGAD1 the gene knockout line is more sensitive to low temperature treatment. And StGAD1 the ion permeability value of the gene knockout line is larger.

[0010] Therefore, by knocking out the StGAD1 gene, plants with a cold stress-sensitive phenotype can be obtained. Among them, the identification of the cold stress phenotype includes: * Observation of the sensitivity of plants to -4°C treatment; * Measure the ion leakage rate of plants after low-temperature treatment.

[0011] As an implementation manner of the present invention, a polynucleotide sequence targeting the StGAD1 gene is constructed into a CRISPR vector to form a recombinant vector. The recombinant vector is introduced into target plant cells by a conventional transformation method (such as Agrobacterium-mediated transformation), so that the expression of StGAD1 protein in the plant cells is absent or its function is lost. By regenerating the transformed plant cells into complete plants, mutant plants lacking the StGAD1 gene can be obtained. Since experiments have proved that after inhibiting the expression of the StGAD1 gene by gene editing technology, the plants are more sensitive under low-temperature treatment, that is, their cold tolerance is reduced. It can be known that the StGAD1 gene itself has the effect of enhancing the cold tolerance of plants.

[0012] Therefore, in practical applications, according to this characteristic, cold-tolerant plants can be obtained by transgenic means. Specifically, the StGAD1 gene can be introduced into the target plant to obtain a transgenic plant, and the cold tolerance of this plant is higher than that of the target plant.

[0013] More specifically, the StGAD1 gene can be introduced into the target plant through a recombinant expression vector. The recombinant expression vector can transform plant cells or tissues by conventional biological methods, including but not limited to: Ti plasmid; plant virus vector; direct DNA transformation method; microinjection method; electroporation method; Agrobacterium-mediated transformation method (preferred). By regenerating the transformed plant tissue into a complete plant, a genetically modified plant can be obtained.

[0014] To improve plant traits, the present invention protects a breeding method, including any of the following technical paths: (1) Enhance the activity of StGAD1 protein in the target plant to obtain plants with improved low-temperature resistance; (2) Promote the expression of the StGAD1 gene in the target plant to obtain plants with improved low-temperature resistance; (3) Inhibit the expression of the StGAD1 gene in the target plant to obtain plants with a low-temperature sensitive phenotype.

[0015] The implementation manner of "promoting gene expression" can be: (i) Introduce the StGAD1 gene into the target plant (such as constructing an overexpression vector); (ii) Introduce a strong promoter or enhancer to regulate this gene; (iii) Other conventional expression enhancement technologies in the art.

[0016] Ways to "inhibit gene expression": Preferably, knockout of the gene is achieved through gene editing techniques (such as CRISPR / Cas9). StGAD1 Gene

[0017] The scope of use of the present invention includes but is not limited to the following: Core species: potato ( Solanum tuberosum , Solanaceae); Extended scope: applicable to any plant containing StGAD1 or its functionally homologous gene (e.g., tomato in Solanaceae, apple tree in Rosaceae, cherry tree, etc.).

[0018] Plant types: cover the whole plant, its parents and offspring, and all parts of the plant, including: (1) Organs: roots (including tubers), stems, leaves, flowers, fruits, seeds, buds; (2) Tissues and cells: callus, meristem, embryo, gametophyte, sporophyte; (3) Reproductive units: pollen, microspores.

[0019] In addition, the following extensions are also protected: (1) Transgenic cells, tissues, organs and plants obtained by the said method; (2) Offspring plants with the same genotype / phenotype; (3) Harvestable parts of plants (such as seeds, fruits, leaves, tubers) and their processed products (such as oils, starches, protein powders, food additives).

[0020] Advantages of the present invention: Through the Agrobacterium-mediated StGAD1 gene knockout experiment, the present invention first clarifies the important function of this gene in the cold stress response of potato, providing a molecular target for potato cold tolerance breeding.

[0021] Experiments have confirmed that StGAD1 gene deletion leads to enhanced cold sensitivity, indicating that it plays a key role in plant development. Therefore, in practical applications, by transgenic overexpression of StGAD1 gene, plants with enhanced cold tolerance can be directly obtained, opening up a new way for crop stress resistance breeding. Description of the drawings

[0022] Figure 1 For StGAD1 Schematic diagram of gene knockout sites and mutant editing information.

[0023] Figure 2 For WT, stgad1 - 3 and stgad1 -[[]]4 Phenotypes under cold stress treatment; in the figure, WT is wild-type potato, stgad1 - 3 and stgad1 - 4 are mutant plants; on the left, before low-temperature treatment, WT, stgad1 - 3 and stgad1 - 4 plant phenotypes under normal conditions; on the right are WT, stgad1 - 3 and stgad1 - 4 plant phenotypes after treatment at -4°C for 2 h and then recovery for 2 d.

[0024] Figure 3 Comparison of ion leakage rates of potato seedlings after low-temperature treatment (-4°C for 2 h and then recovery for 2 d). Specific implementation manners

[0025] The present invention will be further described below in conjunction with specific embodiments, and the advantages and features of the present invention will become clearer as the description proceeds. However, the specific experimental methods involved in the following embodiments are all conventional methods or are carried out according to the conditions recommended in the manufacturer's instructions unless otherwise specified.

[0026] Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art. The test methods in the following embodiments are all conventional methods unless otherwise specified. Unless otherwise specified, the reagents and materials used can all be obtained commercially.

[0027] Unless otherwise defined, all professional and scientific terms used herein have the same meaning as those familiar to those skilled in the art. In addition, any methods and materials similar or equivalent to the described content can be applied to the present invention. The preferred implementation methods and materials described herein are for illustrative purposes only.

[0028] Unless otherwise stated, the implementation of the present invention will use conventional botanical techniques, microorganisms, tissue culture, molecular biology, chemistry, biochemistry, DNA recombination, and bioinformatics techniques that are obvious to those skilled in the art. These techniques have been fully explained in the published literature. In addition, for the methods such as DNA extraction, construction of phylogenetic trees, gene editing methods, construction of gene editing vectors, and obtaining gene editing plants used in the present invention, except for the methods used in the following embodiments, the methods disclosed in the existing literature can all be used to achieve the same.

[0029] As used herein, the terms "nucleic acid", "nucleic acid sequence", "nucleotide", "nucleic acid molecule" or "polynucleotide" mean DNA molecules (e.g., cDNA or genomic DNA), RNA molecules (e.g., messenger RNA), natural types, mutant types, synthetic DNA or RNA molecules, DNA or RNA molecules composed of nucleotide analogs, single-stranded or double-stranded structures. These nucleic acids or polynucleotides include gene coding sequences, antisense sequences and regulatory sequences in non-coding regions, but are not limited thereto. These terms include a gene. The term "gene" or "gene sequence" is widely used to refer to a functional DNA nucleic acid sequence. Thus, a gene may include introns and exons in a genomic sequence, and / or include coding sequences in cDNA, and / or include cDNA and its regulatory sequences. In a particular embodiment, for example, with respect to an isolated nucleic acid sequence, it is preferably assumed to be cDNA by default.

[0030] In addition, for a more intuitive understanding of the technical solutions of the present invention, some professional terms related to the present invention are explained as follows: "Gene editing" is a new gene function technology that precisely modifies specific target sequences in the genome of an organism.

[0031] "Gene knockout" is a technology that integrates an exogenous gene into a specific site on the genome of a target cell by homologous recombination to achieve the purpose of site-directed modification and transformation of a certain gene on the chromosome.

[0032] A "mutant" refers to an individual that has undergone a mutation and has a phenotype different from that of the wild type.

[0033] An "expression vector" refers to a vector that can express a target gene by adding expression elements (such as promoters, RBS, terminators, etc.) on the basis of the basic skeleton of a cloning vector.

[0034] The inventors obtained the gene sequence of potato glutamate decarboxylase on the basis of the potato genome through bioinformatics technology. StGAD1 In the present invention, it is ligated with a plant editing vector and then introduced into wild-type potato for phenotype identification.

[0035] Compared with traditional transgenic technologies, the CRISPR / Cas9 gene editing technology has many advantages. Traditional transgenic technologies introduce exogenous target genes into target organisms to change plant traits, and the insertion positions of the target genes in the receptor genome are random. In contrast, the CRISPR / Cas9 gene editing technology does not introduce exogenous genes and only modifies endogenous genes, making it safer and more efficient. Secondly, the CRISPR / Cas9 gene editing technology can simultaneously edit multiple sites and precisely regulate the mutation or insertion sites, which cannot be achieved by traditional transgenic technologies. Additionally, traditional transgenic technologies can only downregulate the expression of target genes at the RNA level, cannot completely inhibit their transcription, and have genetic instability, while the CRISPR / Cas9 gene editing technology can achieve mutations in target genes, making it more stable and reliable.

[0036] Example 1 StGAD1 Isolation of genes Extraction of total RNA from potato Bloody Banana seedlings: It was carried out according to the instructions of Trizol extraction reagent (Takara), and the first-strand cDNA synthesis was carried out according to the instructions of the reverse transcription kit PrimerScriptTM II 1st Strand cDNA Synthesis Kit (Takara). Using the cDNA of potato as a template, it was amplified with TOYOBO (Toyobo) high-fidelity enzyme KOD-plus-neo, and the annealing temperature was 56°C.

[0037] Using the following sequences as primers (StGAD1-F, StGAD1-R), the full-length sequence of the gene was obtained by PCR amplification StGAD1 The full-length sequence of the gene is shown as SEQ ID NO.1 in the sequence listing, with a total of 1509 bp, and the amino acid sequence of the encoded protein is shown as SEQ ID NO.2 in the sequence listing, with a total of 502. StGAD1 StGAD1-F: ATGGTTCTGTCCAAGATAGCGTCG;

[0038] StGAD1-R: TTAACAAACTCCCTTAGTCTTTTTC.

[0039] Example 2 Construction of recombinant vector StGAD1 In StGAD1Two knockout target sites were selected in the CDS region of the gene, namely sgRNA1: CCTGAAGCTCAGTGGTGACAGG and sgRNA2: GGCCAATCCAGCAAGCATAATGG. The sgRNA-StGAD1 fragment was amplified by PCR and purified and recovered, and the StGAD1-CRISPR recombinant plasmid was obtained by using enzymatic digestion and ligation methods. Finally, the genetic transformation of potatoes was mediated by the Agrobacterium tumefaciens transformation method to obtain transgenic seedlings with the StGAD1 gene knocked out.

[0040] Example 3 Screening and phenotypic analysis of transgenic positive plants 100 mg of leaves of resistant plants were taken, and total genomic DNA was extracted by the CTAB method. Specific primers were designed according to the target gene sequence, PCR amplification was carried out, and the samples were sent for sequencing.

[0041] The identification primer sequences were: F: GTGACAACATGGATGGAACC; R: GGACATTGGCACCAGTAAC.

[0042] After sequencing and identification, a total of 2 knockout lines with different editing types were obtained, such as StGAD1 - stgad1 - 3 (-4 bp) and stgad1 -4(-5 bp) ( Figure 1 ).

[0043] WT (wild type), stgad1 - 3 (-4 bp) and stgad1 -4(-5 bp) gene knockout plants were cold-treated at -4°C for 2 h. From the Figure 2 phenotypic observation diagram, it can be seen that under normal conditions (control), there was no obvious difference in the growth of WT (wild type) plants and StGAD1 the knockout lines. However, after being treated at -4°C for 2 h and then recovered for 2 days, compared with WT (wild type), StGAD1 the leaves of the knockout lines lost water severely, showing obvious wilting, and at the same time, obvious softening and waterlogging appeared in the leaves and stems. It can be seen that StGAD1 the knockout lines were more sensitive to low-temperature treatment. In addition, the ion permeability of potato seedlings after low-temperature treatment (-4°C treatment for 2 h) and then recovered for 2 days of WT (wild type), stgad1 - 3 (-4bp) and stgad1 -4(-5 bp) was measured. Compared with WT (wild type), stgad1 - 3(-4 bp) and stgad1 the ion permeability value of -4 (-5 bp) is larger ( Figure 3 ), which also shows that StGAD1 the knockout line is more sensitive to low temperature treatment.

[0044] Generally speaking, compared with WT (wild type) plants, StGAD1 the gene knockout line plants show obvious low temperature sensitivity.

[0045] The above-described embodiments are only preferred embodiments of the present invention, which are only used to explain the present invention and do not limit the scope of implementation of the present invention. For those skilled in the art of this technology, of course, other implementation manners can be easily made by means of substitution or change according to the technical content disclosed in this specification. Therefore, all changes and improvements made on the principle of the present invention should be included within the scope of the patent application of the present invention.

Claims

1. StGAD1 The application of a gene or a recombinant vector containing the StGAD1 gene in regulating the cold resistance of potatoes, characterized in that The StGAD1 CDS sequence of the gene is shown in SEQ ID NO.1, and its specific manifestation in regulating potato cold resistance is that, compared with the wild type, StGAD1 the gene knockout line is more sensitive to cold treatment.

2. The application according to claim 1, wherein The recombinant vector is a gene knockout recombinant vector.

3. The application according to claim 1, characterized in that, Compared with the wild-type control, StGAD1 the ion permeability value of the gene knockout line is greater.

4. The application according to claim 1, characterized in that RNAi technology or CRISPR / Cas9 technology is used for gene knockout.

5. A plant breeding method, characterized in that, The method is as follows: (1), (2), or (3): (1) By increasing the activity of StGAD1 protein in the target plant, a plant with stronger cold resistance than the target plant is obtained; (2) By promoting the expression of the StGAD1 gene in the target plant, a plant with stronger cold resistance than the target plant is obtained; (3) By suppressing the expression of the StGAD1 gene in the target plant, a plant showing sensitive symptoms to low-temperature treatment is obtained; The StGAD1 CDS sequence of the gene is shown in SEQ ID NO.1, the amino acid sequence of the StGAD1 protein is shown in SEQ ID NO.2, and the target plant is potato.

6. The plant breeding method according to claim 5, characterized in that, The method for promoting the expression of a StGAD1 gene in a target plant is overexpression or overexpression StGAD1 of the gene.

7. The plant breeding method according to claim 5, characterized in that, The expression pattern of the StGAD1 gene in the target plant to be inhibited is gene knockout of StGAD1 gene.

8. The breeding method according to claim 5, characterized in that, The specific method for obtaining a plant with sensitive symptoms under cold treatment is: (1) Construction of recombinant vector: In StGAD1 Two knockout target sites were selected in the CDS region of the gene, namely sgRNA1: CCTGAAGCTCAGTGGTGACAGG, sgRNA2: GGCCAATCCAGCAAGCATAATGG; The sgRNA-StGAD1 fragment was amplified by PCR and purified and recovered, and the StGAD1-CRISPR recombinant plasmid was obtained by using enzyme digestion and ligation methods; (2) Agrobacterium-mediated transformation: Use Agrobacterium-mediated transformation to mediate the genetic transformation of potatoes and obtain transformed seedlings with the StGAD1 gene knocked out; (3) Screening of positive plants: Specific primers are designed according to the target gene sequence, and positive plants are screened by PCR amplification or quantitative detection.

9. The breeding method according to claim 8, characterized in that, The specific primers are respectively: F: GTGACAACATGGATGGAACC; R: GGACATTGGCACCAGTAAC.

Images