Method for constructing azoospermia mouse model by knocking out germ cell Sno1 gene and application

Abstract

The invention discloses a method for constructing an azoospermia mouse model by knocking out a germ cell Sno1 gene and application of the azoospermia mouse model, the construction method is to knock out the Sno1 gene on a mouse germ cell genome, and the knockout is carried out by using a Cre-LoxP system. The azoospermia mouse model constructed by the invention can be used for research on non-obstructive azoospermia and corresponding drug research and development. The model mouse shows that the testis weight and volume are reduced, spermatogenic epithelium atrophy occurs, spermatogonium cells do not enter meiosis, germ cells are massively deleted, and the number of sperms is reduced.

Description

Technical Field

[0001] The present invention belongs to the technical field of animal models, and particularly relates to a method for constructing an azoospermia mouse model by knocking out the germ cell Sbno1 gene and its application. Background Art

[0002] Infertility is a common disease that seriously affects human health, and its incidence has been increasing year by year in recent years. Infertility refers to a situation where a couple has normal sexual life and has not been able to conceive for one year or more without taking any contraceptive measures. According to statistics from the World Health Organization (WHO), infertile couples around the world account for about 15% of married couples, and male infertility is the main or partial cause of 20 - 70% of infertile couples. In 2010, there were approximately 48.5 million infertile couples worldwide suffering from primary infertility, and WHO estimates that the actual figure may be 2.5 times higher, and there are approximately 30 million infertile men globally.

[0003] The causes of male infertility are extremely complex, involving the anatomical structure and function of the reproductive system, infection, endocrinology, genetic factors, etc. Azoospermia is an important pathogenic factor for male infertility, and its patients account for 10% - 15% of male infertility patients. Azoospermia is defined as the situation where no sperm is found after centrifuging semen and observing the sediment under a microscope three times. Clinically, it is generally classified into two types: obstructive azoospermia (OA) and non-obstructive azoospermia (NOA) according to whether there is obstruction in the vas deferens of the patient. Among them, non-obstructive azoospermia is mostly caused by testicular spermatogenic dysfunction, resulting in reduced or absent sperm production, which leads to male infertility. In recent years, the development of some assisted reproductive technologies has enabled some OA patients to achieve fertility, while NOA patients are difficult to benefit due to the lack of sperm. Therefore, it is imperative to study the pathogenic factors of NOA, and further study the molecular biological basis of sperm production disorders in NOA patients, reveal the regulatory network of sperm production, and clarify the causes of idiopathic male infertility has great clinical application value.

[0004] Sbno1 (Strawberry Notch homolog 1) is a gene with important functions in the nervous system. The protein it encodes belongs to the helicase family and is involved in DNA repair and maintenance of genomic stability. During neurodevelopment, Sbno1 is widely expressed in the postnatal brain tissue, especially showing significant activity in motor neurons, the fifth layer neurons of the cerebral cortex, and the magnocellular part of the red nucleus. It may affect neuronal morphogenesis by regulating neurite growth, axon extension, and synapse formation. Studies have shown that knockout mice of the Sbno1 gene exhibit a paralyzed phenotype, further verifying its core role in motor function. In addition, the expression level of Sbno1 is regulated by neuronal activity, similar to immediate early genes (such as c-Fos), suggesting that it may be involved in the regulation of neural plasticity. In the field of mental diseases, Sbno1 has been found to be related to the genetic risk of schizophrenia and the efficacy of antipsychotics, and its genetic-epigenetic interaction affects the function of the central nervous system and brain structural abnormalities (such as changes in cortical thickness). Based on its neural repair potential, Sbno1 has also been explored for gene therapy, such as promoting endogenous repair in neural stem cells through adeno-associated virus vectors (AAV-SBNO1), providing new therapies for diseases such as ischemic stroke. Summary of the Invention

[0005] The purpose of the present invention is to provide a method for constructing an azoospermia mouse model by knocking out the Sbno1 gene in germ cells and its application. The present invention first reveals the important role of the Sbno1 gene in the spermatogenesis process of mice. Male mice with knockout of the Sbno1 gene in germ cells show testicular dysplasia and azoospermia. The mechanism by which the Sbno1 gene regulates testicular development is expected to provide new ideas for the study of the mechanism of male infertility.

[0006] To achieve the above purpose, the present application adopts the following technical solutions:

[0007] In the first aspect, the present invention provides a method for constructing an azoospermia mouse model, and the construction method is to knock out the Sbno1 gene on the genome of mouse germ cells, and the knockout is carried out using the Cre-LoxP system.

[0008] The Cre-loxP system is a gene editing tool based on bacteriophage P1, which consists of Cre recombinase and loxP sites: Cre enzyme can specifically recognize and cut the 34bp loxP site, and achieve deletion, inversion, or translocation of DNA fragments through the recombination mechanism. Among them, STRA8-Cre is a tool designed based on the characteristics of the STRA8 gene, a key regulator of germ cell meiosis: the Cre recombinase gene is placed under the regulation of the STRA8 promoter, so that it is specifically expressed only before germ cells enter meiosis.

[0009] In the above technical solution, the GeneID of the Sbno1 gene is: 19647.

[0010] In the above technical solution, the specific method of knockout is as follows: In mouse embryonic stem cells, floxed Sbno1 alleles are generated by homologous recombination to obtain flox / + heterozygous mice. After the flox / + heterozygous mice are mated with each other to obtain flox / flox homozygous mice, they are then mated with STRA8-Cre tool mice. The Cre recombinase is used to target and excise the exon between the two loxP sites, resulting in the loss of the function of the Sbno1 gene in mouse germ cells, thereby achieving conditional knockout of Sbno1 in germ cells.

[0011] In the second aspect, the present invention provides the application of the azoospermia mouse model constructed by the above construction method in the study of non-obstructive azoospermia.

[0012] The beneficial effects of the present invention are as follows: The present invention uses the Cre-LoxP system to knockout the Sbno1 gene on the genome of germ cells of C57BL / 6J mice to construct an azoospermia mouse model, which can be used for the study of non-obstructive azoospermia and the development of corresponding drugs. The model mice show reduced testicular weight and volume, atrophy of the seminiferous epithelium, failure of spermatogonia to enter meiosis, a large number of missing germ cells, and a decrease in sperm count. Description of the Drawings

[0013] Figure 1 : Expression of Sbno1 in various tissues and its expression pattern in testicular tissue; where A: Expression level of Sbno1 gene in various organs of 56-day-old mice; B: Expression level of Sbno1 in the testes of wild-type mice aged 0-8 weeks, with higher expression levels at P0 and P7; C: Detection of the expression level of Sbno1 in testicular sections of 56-day-old wild male mice by immunofluorescence method, and Sbno1 is expressed in both germ cells and Sertoli cells.

[0014] Figure 2 : Schematic diagram of the targeting strategy for generating floxed Sbno1 alleles by homologous recombination in mouse embryonic stem cells.

[0015] Figure 3 : Map of the mouse genotype identification results.

[0016] Figure 4 : Appearance photo of P56 mice.

[0017] Figure 5 : Appearance of the testes and epididymides of successfully constructed Sbno1 conditional knockout mice A, adult wild-type and conditional knockout mice. The testes and epididymides of the conditional knockout mice are significantly smaller; B: Detection of the expression level of Sbno1 in the testes of wild-type and conditional knockout mice. The expression level of Sbno1 in the conditional knockout mice is low; C: Fertility test of wild-type and conditional knockout mice; D: Testis-body ratio (mg / g) of wild-type and conditional knockout mice.

[0018] Figure 6 : A, HE sections of testes from adult wild-type and conditional knockout mice. The conditional knockout mice showed no complete spermatogenesis process and lacked sperm. B, HE sections of epididymides from adult wild-type and conditional knockout mice. There were no sperm in the epididymides of the conditional knockout mice, while the epididymides of wild-type mice were filled with sperm.

[0019] Figure 7 : A, Tunnel staining was used to detect apoptotic cells in the testes of adult wild-type and conditional knockout mice. The apoptotic signal was significantly increased in the testes of the conditional knockout mice. B, Proliferation signal PCNA was detected in sections of testes from adult wild-type and conditional knockout mice. The PCNA signal was significantly decreased in the conditional knockout mice. C, Germ cell signal MVH was detected in sections of testes from adult wild-type and conditional knockout mice. Obvious germ cell loss was visible in the testis sections of the conditional knockout mice.

[0020] Figure 8 : Statistical chart of the detection of marker molecules during testicular meiosis.

[0021] Figure 9 : Detection result diagram of the formation of synaptonemal complex in the prophase of the first meiosis.

[0022] Figure 10 : Detection result diagram of γ-H2AX signal in the prophase of the first meiosis.

[0023] Figure 11 : PCR program. Detailed implementation manners

[0024] To better illustrate the purpose, technical solution and advantages of the present invention, the present invention will be further described below in conjunction with specific embodiments. The present invention can be implemented in many different forms and should not be construed as limited to the embodiments set forth herein. On the contrary, these embodiments are provided so that this disclosure will be thorough and complete, and will fully convey the concept of the present invention to those skilled in the art. The present invention will only be defined by the claims.

[0025] Example 1 Expression of Sbno1 in various tissues and its expression pattern in testes

[0026] Heart, brain, liver, spleen, lung, kidney, bladder, testis, and ovary of 56-day-old littermate wild-type C57BL / 6J mice were taken, and RNA was extracted respectively for qPCR detection of the expression level of Sbno1 gene. Figure 1 A The results showed that Sbno1 was highly expressed in the testes. Testis tissues of wild-type mice at P0, P7, P14, P21, P28, P35, P42, and P56 were obtained, and RNA was extracted for qPCR detection of the expression level of Sbno1 gene. Figure 1B The results show that Sbno1 is highly expressed in the testes of P7 and P14 mice. Immunofluorescence staining of Sbno1 was performed using paraffin sections of the testes of 56-day-old wild-type mice. Figure 1 C The results showed that Sbno1 was expressed in spermatogonia, pachytene spermatocytes, leptotene spermatocytes and supporting cells.

[0027] Example 2: Construction of Sbno1 (flox / +) heterozygous mouse model (C57BL / 6).

[0028] In order to further clarify the role of Sbno1 in testicular development, we commissioned Saiye (Suzhou) Biological Co., Ltd. to generate the floxed Sbno1 allele in mouse embryonic stem cells by homologous recombination to obtain (flox / +) heterozygous mice. Figure 2 As shown, the same LoxP sites were inserted at both ends of the exon to obtain (flox / +) heterozygous mice. After mating with STRA8-Cre tool mice, the exon between the two loxP sites was targeted and excised using Cre recombinase, thereby conditionally knocking out the Sbno1 gene in mouse germ cells.

[0029] Example 3 Mouse genotype identification

[0030] Primers were designed to identify the mouse genotype obtained in Example 2. The primer design sites were as follows: Figure 2 , the primer sequences are shown in Table 1. Genotyping of 10-day-old newborn mice: Obtain a small amount of mouse tail tissue, extract DNA using lysis solution (40mM NaOH+0.2mM EDTA), and stop lysis with an equal amount of neutralization solution (40mM Tris-Hcl). Perform PCR using the HotStart enzyme PCR reaction system, which is shown in Table 2. Prepare 2.5% agarose gel for DNA electrophoresis, Figure 3 This is the electrophoresis diagram for mouse genotype identification. Figure 3 It can be seen that the mice with only 229bp band are wild-type mice, the mice with only 292bp band are homozygous mice, and the mice with both 229bp and 292bp bands are heterozygous mice. The mice with 443bp are STRA8-Cre tool mice, and the mice with 751bp target gene knocked out are.

[0031] Table 1

[0032] Primer Name Primer Sequence (5’-3’) Sbno1-loxp-F TCTTATGGTAGATGAGACTGGTGGT Sbno1-loxp-R ACACTAACTACTCACTTCCAGCTTCT Sbno1-delete-F TCCTGTTCTAGGATTGCCGTC Sbno1-delete-R CTACTAGCAGGCACTCTCCAGATA STRA8-Cre-F GATGGATTTCCGTCTCTGGTGTAG STRA8-Cre-R CCCATTTAATCTCCTCCTTCTCCG

[0033] Table 2

[0034] Material Volume Premixed Taq Polymerase 10μL Primer-F 1μL Primer-R 1μL DNA Template 2μL ddH2O 6μL

[0035] PCR reaction procedure Figure 11 shown.

[0036] Example 4 Mouse Phenotype Identification

[0037] (1) There was no difference in the body weight of P56 mice (the day of mouse birth is recorded as P0 day) ( Figure 4 ). There was a significant difference in the testis size between wild-type mice and knockout mice at P56 days ( Figure 5 A). Testes of wild-type mice and knockout mice at 56 days old were taken to extract RNA, and qPCR was performed to detect the expression level of the Sbno1 gene. The results showed that the expression level of the Sbno1 gene in knockout mice was significantly decreased ( Figure 5 B). Male wild-type mice and knockout mice at 56 days old were respectively paired with fertile female mice to observe fertility. After 6 months of fertility testing, the results showed that knockout mice were completely infertile ( Figure 5 C). Male wild-type mice and knockout mice at P7, P14, P35, P56, and P120 were taken, weighed and then sacrificed, and their testes were weighed. The testis-body ratio (mg / g) was calculated. The results showed that the testis-body ratio of knockout mice decreased compared with that of wild-type mice starting from P7 ( Figure 5 D). HE sections of testes of wild-type mice at P56 days showed that sperm appeared in the spermatogenic epithelium of control mice, while sperm generation was not observed in the spermatogenic epithelium of knockout mice, and there were no secondary meiotic cells such as round spermatids, suggesting that the testes of knockout mice failed to enter the second meiosis successfully. Apoptotic cells could be observed in the testes of knockout mice ( Figure 6 A).

[0038] Further examination of the epididymis, the site of sperm maturation, found that the epididymis of wild-type mice was filled with sperm, while no sperm was observed in the epididymis of knockout mice, suggesting that knockout mice are azoospermic mice ( Figure 6 B).

[0039] (2) Since a large number of cells were missing in the degenerated seminiferous tubules in the HE sections of the testes of knockout mice, proliferation and apoptosis were further detected. Tunnel chromosome indicated that a large number of apoptotic signals appeared in the testis sections of knockout mice ( Figure 7 A), and PCNA (proliferating cell nuclear antigen) immunofluorescence detection indicated that the proliferation signal in the testis sections of knockout mice was significantly decreased compared with that of wild-type mice ( Figure 7 B); MVH is a marker molecule of germ cells, and its immunofluorescence detection indicated that a large number of germ cells were missing in the testes of knockout mice ( Figure 7 C). Therefore, it is suggested that the apoptosis of germ cells in the testes of knockout mice leads to a large number of germ cell losses, which also explains why the testis weight of knockout mice is lower than that of wild-type mice.

[0040] (3) To clarify the reason for azoospermia in the knockout mice, qPCR was used to further detect the marker molecules at various stages of meiosis, such as Stra8 (differentiated spermatogonia), Sycp3 (spermatocytes in the first meiotic division), Dkkl1 (spermatocytes in the pachytene stage of the first meiotic division), and Tnp1 (spermatids). The results showed that the marker molecule Stra8 of differentiated spermatogonia in the knockout mice was significantly upregulated, the marker molecule Sycp3 of the first meiotic division was significantly decreased, and the marker molecules Dkkl1 of spermatocytes in the pachytene stage of the first meiotic division and Tnp1 of spermatids were not detected ( Figure 8 ). It is suggested that the germ cells of the knockout mice can enter the first meiotic division but cannot enter the second meiotic division, that is, the meiosis of testicular germ cells in the knockout mice is blocked at the first meiotic division stage ( Figure 8 ).

[0041] (4) To further clarify the reason for the failure of meiosis in the knockout mice, we obtained the testes of 21-day-old mice and performed a chromosome spreading experiment to detect the formation of the synaptonemal complex (SC) in the prophase of the first meiotic division, with Sycp3 and Sycp1 as the marker molecules of SC. Meiosis has a series of special and orderly chromosomal behaviors. According to the chronological order, the chromosomal behaviors in the first meiotic division include: the formation of the lateral axes of the synaptonemal complex and the cohesion between sister chromatids, the pairing, synapsis, recombination, and separation of homologous chromosomes, etc. According to the morphology of the synaptonemal complex, the prophase of the first meiotic division is divided into leptotene, zygotene, pachytene, diplotene, and diakinesis. The results showed that no SC formation was seen in the knockout mice, suggesting that the germ cells of the knockout mice could not complete the first meiotic division ( Figure 9 ).

[0042] (5) To clarify the reason for the failure of the knockout mice to enter the pachytene stage, we next detected the signal of γ-H2AX. During the first meiotic division, under the action of the SPO11 molecule, DNA double-strand breaks (DSBs) occur on the chromosomes. The formation of DSBs induces the formation of γ-H2AX signals. By the pachytene stage, the γ-H2AX signals are only present in the sex vesicle region, and the γ-H2AX signals on the autosomes disappear with the repair of DSBs. The results showed that the γ-H2AX signals disappeared in the knockout mice, suggesting that the germ cells of the knockout mice could not complete the first meiotic division ( Figure 10 ).

[0043] Obviously, the above embodiments are merely examples for clear illustration and not limitations on the implementation manners. For those of ordinary skill in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to list all implementation manners here. And the obvious changes or modifications derived therefrom still fall within the protection scope of the present invention.

Claims

1. A method for constructing an azoospermia mouse model, characterized in that: The construction method is to knockout the Sbno1 gene in the genome of mouse germ cells, and the knockout is carried out using the Cre-LoxP system.

2. The construction method according to claim 1, wherein: The GeneID of the Sbno1 gene: 19647.

3. The construction method according to claim 1, wherein: The specific method of the knockout is as follows: generate floxed Sbno1 alleles by homologous recombination in mouse embryonic stem cells, obtain flox / + heterozygous mice, after the flox / + heterozygous mice are mated with each other to obtain flox / flox homozygous mice, then mate with STRA8-Cre tool mice, and use Cre recombinase to target and excise the exon between the two loxP sites, resulting in the loss of the function of the Sbno1 gene in mouse germ cells, thereby realizing the conditional knockout of Sbno1 in germ cells.

4. Application of the non-obstructive azoospermia mouse model constructed by the construction method described in any one of claims 1-3 in the study of non-obstructive azoospermia.

Images