Construction and evaluation of non-specific cytotoxic cell transgenic zebrafish

Abstract

The invention belongs to the technical field of gene engineering, and particularly relates to construction and evaluation of non-specific cytotoxic cell transgenic zebrafish. According to the application, the recombinant plasmid containing the NCCRP1 gene and transposase mRNA are jointly introduced into the wild type zebra fish, the transgenic zebra fish with non-specific cytotoxic cells with a natural killer cell-like function is successfully constructed, and in-vivo observation of development of zebra fish NCC in time and space is realized for the first time. In addition, the establishment of the NCC transgenic zebrafish involved in the invention has important practical significance for researching subgroup classification and biological functions of the zebrafish.

Description

Technical Field

[0001] This application belongs to the field of genetic engineering technology, and specifically relates to the construction and evaluation of a non-specific cytotoxic cell transgenic zebrafish. Background Art

[0002] Nonspecific Cytotoxic Cells (NCC) are a group of cytotoxic cells found in the innate immune system of teleost fish. They are evolutionarily considered to be the precursors of mammalian natural killer cells (NK cells). NCC mainly originate from blood and lymphoid organs and play a crucial role in immune defense. Research shows that NCC, as an important part of the non-specific immune system of fish, is the first line of defense against the invasion of bacteria, viruses, parasitic protozoa, etc. They provide rapid immune protection for the body by directly killing invading pathogens. Through the study of NCC, the innate immune mechanism of fish and its evolutionary process can be better understood. The cytotoxic effect of teleost NCC mainly depends on the Non-Specific Cytotoxic Cell Receptor Protein 1 (NCCRP1), which is a marker protein that mediates the recognition and binding of antigens on target cells by fish NCC.

[0003] Currently, the research on the mechanism of how fish NCC play innate immune defense is relatively scarce. Currently, the research on NCC mainly focuses on economic fish, such as the spatial tissue distribution of each cell subset of tilapia NCC and the role of NCC in assisting the host to resist pathogenic bacteria.

[0004] As an important lower vertebrate, zebrafish has a genome highly similar to that of humans, and has advantages such as small size, short sexual maturity cycle, large single spawning amount, and transparent embryos, making it an ideal animal model for studying NCC. Currently, the research on zebrafish NCC mainly uses in situ hybridization technology to label the spatio-temporal expression of such cells, and this technology has the following disadvantages:

[0005] 1. The experimental materials mainly come from dissected tissues or fixed embryos, which may interfere with the expression of such cells during the experimental treatment process, and the obtained research data is not accurate and comprehensive enough; 2. It is impossible to observe the spatio-temporal distribution of such cells in living fish.

[0006] In view of this, this application is specifically proposed. Summary of the Invention

[0007] Based on this, an embodiment of this application provides a construction method and application of a non-specific cytotoxic cell transgenic zebrafish.

[0008] On the one hand, the present application provides a method for constructing a transgenic zebrafish model of non-specific cytotoxic cells, including:

[0009] Co-introducing a recombinant plasmid containing the NCCRP1 gene and transposase mRNA into fertilized eggs of wild-type zebrafish, raising them to maturity to obtain F0 generation zebrafish, and then mating the F0 generation zebrafish with wild-type zebrafish; and,

[0010] Screening out positive offspring to prepare non-specific cytotoxic cell transgenic zebrafish.

[0011] In some embodiments, the method further includes mating the screened positive offspring with wild-type zebrafish again to obtain non-specific cytotoxic cell transgenic zebrafish with stable inheritance.

[0012] In some embodiments, the preparation process of the recombinant plasmid containing the NCCRP1 gene includes:

[0013] Obtaining the NCCRP1 gene promoter through PCR reaction, and ligating the NCCRP1 gene promoter and the vector by enzymatic digestion to construct a recombinant plasmid.

[0014] In some embodiments, the primers for the PCR reaction are as shown in SEQ ID NO.1-SEQ ID NO.2.

[0015] In some embodiments, the vector includes Tol2-EGFP.

[0016] In some embodiments, the nucleotide sequence of the NCCRP1 gene promoter is as shown in SEQ ID NO.3.

[0017] In some embodiments, the transposase mRNA is obtained by in vitro transcription after single enzymatic digestion of the PCS2+transposase plasmid.

[0018] In some embodiments, the enzymatic digestion system includes one or more of the PCS2+transposase plasmid, 0.08 w / v%-0.12 w / v% BSA, and NotI restriction endonuclease.

[0019] In some embodiments, the conditions of the enzymatic digestion system include incubating at 36.5℃-37.5℃ for 1.4h-1.6h.

[0020] In some embodiments, the conditions of the enzymatic digestion system include determining the positive band by nucleic acid electrophoresis, digesting the template with DNaseI, and purifying and measuring the concentration of the product.

[0021] In some embodiments, the conditions of the enzymatic digestion system include storing at -82℃-78℃ for later use.

[0022] In some of these embodiments, the mass ratio of the Tol2 recombinant plasmid containing the NCCRP1 gene to the transposase mRNA is 1:(4 - 6).

[0023] In some of these embodiments, the introduction method includes microinjection.

[0024] On the other hand, provided by this application are cells or embryos of a non-specific cytotoxic cell transgenic zebrafish model constructed by the construction method of the non-specific cytotoxic cell transgenic zebrafish model described above.

[0025] This application co-introduced a recombinant plasmid containing the NCCRP1 gene and transposase mRNA into wild-type zebrafish, successfully constructed a transgenic zebrafish with non-specific cytotoxic cells (NCCs) having natural killer (NK)-cell-like functions, and for the first time achieved in vivo observation of the development of NCCs in teleost fish (zebrafish) in terms of time and space. The establishment of the NCC transgenic zebrafish involved in this application has important practical significance for studying its subgroup classification and biological functions. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] In order to more clearly illustrate the technical solutions in the embodiments of this application and more comprehensively understand this application and its beneficial effects, the following will briefly introduce the drawings required for the description of the embodiments. Obviously, the following-described drawings are only some embodiments of this application, and those skilled in the art can obtain other drawings based on these drawings without creative efforts.

[0027] Figure 1 It is a schematic diagram of the Tol2-NCCRP1-eGFP vector structure;

[0028] Figure 2 It is a result diagram of in situ hybridization for detecting the expression pattern of the NCCRP1 gene in early zebrafish;

[0029] Figure 3 It is the spatio-temporal expression pattern of NCCRP1-eGFP transgenic zebrafish;

[0030] Figure 4 It is the response of zebrafish non-specific cytotoxic cells to the damaged area of the caudal fin of larvae. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0031] The present application will be further described in detail below in conjunction with the embodiments and examples. It should be understood that these embodiments and examples are only used to illustrate the present application and not to limit the scope of the present application. The purpose of providing these embodiments and examples is to make the understanding of the disclosed content of the present application more thorough and comprehensive. It should also be understood that the present application can be implemented in many different forms and is not limited to the embodiments and examples described herein. Those skilled in the art can make various changes or modifications without departing from the connotation of the present application, and the equivalent forms obtained also fall within the protection scope of the present application. In addition, in the following description, a large number of specific details are given to provide a more thorough understanding of the present application. It should be understood that the present application can be implemented without one or more of these details.

[0032] Unless otherwise defined, all technical and scientific terms used in the present application have the same meaning as commonly understood by those skilled in the technical field to which the present application belongs.

[0033] The term

[0034] Unless otherwise stated or there is a contradiction, the terms or phrases used herein have the following meanings:

[0035] The selection scope of the terms "and / or", "or / and", and "and / or" used herein includes any one of two or more related listed items, and also includes any and all combinations of the related listed items. The said any and all combinations include combinations of any two related listed items, any more related listed items, or all related listed items. It should be noted that when at least three items are connected by at least two conjunctions selected from "and / or", "or / and", and "and / or", it should be understood that in the present application, this technical solution undoubtedly includes the technical solution connected by "logical AND", and also undoubtedly includes the technical solution connected by "logical OR". For example, "A and / or B" includes three parallel solutions: A, B, and A + B. Another example is the technical solution of "A, and / or, B, and / or, C, and / or, D", which includes any one of A, B, C, and D (that is, the technical solution connected by "logical OR"), and also includes any and all combinations of A, B, C, and D, that is, it includes combinations of any two or any three of A, B, C, and D, and also includes the combination of the four items A, B, C, and D (that is, the technical solution connected by "logical AND").

[0036] In the present application, the terms "multiple", "diverse", "multiple times", "multiple elements", etc., unless otherwise specified, refer to a quantity greater than 2 or equal to 2. For example, "one or more" means one or greater than or equal to two.

[0037] As used herein, "its combination", "any combination thereof", "any combination mode thereof", etc. include all suitable combination modes of any two or more of the listed items.

[0038] In this application, the "suitable" in "suitable combination mode", "suitable mode", "any suitable mode", etc. is subject to being able to implement the technical solution of this application, solve the technical problems of this application, and achieve the expected technical effects of this application.

[0039] In this application, "further", "even further", "especially", etc. are used for descriptive purposes, indicating differences in content, but should not be construed as limiting the protection scope of this application.

[0040] In this application, "optionally", "optional", "option", mean having or not having, that is, referring to any one of the two parallel options of "having" or "not having". If "optional" appears multiple times in a technical solution, without special instructions and without contradictions or mutual constraints, each "optional" is independent.

[0041] In this application, for the technical features described in an open-ended manner, it includes a closed technical solution composed of the listed features, and also includes an open technical solution containing the listed features.

[0042] In this application, regarding numerical intervals (i.e., numerical ranges), without special instructions, the optional numerical values are considered continuous within the above numerical intervals, and include the two numerical endpoints (i.e., the minimum value and the maximum value) of this numerical range, as well as each numerical value between these two numerical endpoints. Without special instructions, when the numerical interval only refers to the integers within this numerical interval, it includes the two endpoint integers of this numerical range, as well as each integer between the two endpoints. In this article, it is equivalent to directly listing each integer. For example, t is an integer selected from 1 - 10, indicating that t is any integer selected from the integer group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10. In addition, when providing multiple ranges to describe features or characteristics, these ranges can be combined. In other words, unless otherwise specified, the ranges disclosed herein should be understood to include any and all sub-ranges subsumed therein.

[0043] The temperature parameter in this application, without special limitations, allows both constant temperature treatment and fluctuations within a certain temperature range. It should be understood that the so-called constant temperature treatment allows the temperature to fluctuate within the accuracy range controlled by the instrument. Fluctuations within ranges such as ±5°C, ±4°C, ±3°C, ±2°C, ±1°C are allowed.

[0044] In this application, both %(w / w) and wt% represent weight percentages, %(v / v) refers to volume percentages, and %(w / v) refers to mass-volume percentages.

[0045] All documents mentioned in this application are cited herein as references as if each document were individually cited as a reference. Unless it conflicts with the inventive purpose and / or technical solution of this application, the cited documents related to this application are cited in their entirety and for all purposes. When this application refers to cited documents, the definitions of relevant technical features, terms, nouns, phrases, etc. in the cited documents are also cited. When this application refers to cited documents, examples and preferred methods of the relevant technical features cited can also be incorporated as references into this application, provided that this application can be implemented. It should be understood that when the cited content conflicts with the description in this application, this application shall prevail or be amended adaptively according to the description of this application.

[0046] Term: "hpf" The term "hpf" stands for hour post fertilization, which is the time unit after zebrafish fertilization and is commonly used to describe the stages of embryonic development.

[0047] Term: "AB wild-type zebrafish" AB wild-type zebrafish (AB / WT) is a commonly used zebrafish strain in the laboratory, obtained by the early pressure method from haploid cells. It is one of the main strains used in the zebrafish genome project.

[0048] Term "promoter" A promoter is a segment of DNA sequence that RNA polymerase recognizes, binds to, and starts transcription. It contains conserved sequences required for specific binding of RNA polymerase and transcription initiation, and most are located upstream of the transcription start point of the structural gene. The promoter itself is not transcribed. The main function of the promoter is to control the starting time of transcription and the degree of expression. It can recruit transcription factors and RNA polymerase, thus initiating the transcription process of genes. The promoter contains a core promoter region and a regulatory region, where the core promoter region mainly serves as the site for RNA polymerase to bind and initiate transcription, while the regulatory region changes the transcription efficiency by binding to transcription factors.

[0049] On the one hand, this application provides a method for constructing a transgenic zebrafish model of non-specific cytotoxic cells, including:

[0050] Co-introducing a recombinant plasmid containing the NCCRP1 gene and transposase mRNA into wild-type zebrafish, raising them to maturity to obtain F0 generation zebrafish, and then mating the F0 generation zebrafish with wild-type zebrafish; and,

[0051] Screening out positive offspring to prepare transgenic zebrafish of non-specific cytotoxic cells.

[0052] In some of these embodiments, the method further includes mating the screened offspring expressing the fluorescent protein with wild-type zebrafish to obtain non-specific cytotoxic cell transgenic zebrafish with stable inheritance.

[0053] In some of these embodiments, the preparation process of the recombinant plasmid containing the NCCRP1 gene includes:

[0054] Obtaining the NCCRP1 gene promoter through PCR reaction, and ligating the NCCRP1 gene promoter with Tol2-EGFP to construct a recombinant plasmid.

[0055] Tol2 transposase is a transposon with autonomous transposition activity found in the genome of Japanese medaka (Oryzias latipes) and belongs to the hAT transposon family. Its structural composition includes: transposase gene: The Tol2 transposon contains a gene encoding transposase, which contains 4 exons, and the encoded protein contains 649 amino acid residues; terminal repeat sequences: Both ends of the Tol2 transposon have inverted terminal repeat sequences (ITRs), with the 5'-end being 200 bp and the 3'-end being 150 bp. These ITR sequences are the key sites recognized by transposase and are crucial for the transposition reaction.

[0056] In some of these embodiments, the primers for the PCR reaction are as shown in SEQ ID NO.1 - SEQ ID NO.2.

[0057] Forward primer: 5’-(SphI) ACATGCATGCAGACGCGATATGATCGACTGTATCG -3’ (SEQ IDNO.1)

[0058] Reverse primer: 5’- (SalI) ACGCGTCGACGGTTTTGCAGTAGGTTGCGCTC -3’ (SEQ ID NO.2)

[0059] In some of these embodiments, the nucleotide sequence of the NCCRP1 gene promoter is as shown in SEQ ID NO.3.

[0060] In some of these embodiments, the transposase mRNA is obtained by in vitro transcription after single enzyme digestion of the PCS2+transposase plasmid.

[0061] In some of these embodiments, the enzyme digestion system includes one or more of the PCS2+transposase plasmid, 0.08 w / v%-0.12 w / v% BSA, and NotI restriction endonuclease.

[0062] (1) The digestion system is as follows: PCS2 + transposase plasmid: ≤ 1 μg, 0.1% BSA: 2 μL, 10×H buffer: 2 μL, NotI: 1 μL, and ddH2O: up to 20 μL.

[0063] Among them, the H buffer includes: 500 mM Tris-HCl, pH 7.5; 100 mM MgCl2; 10 mM Dithiothreitol; 1,000 mM NaCl. This system can be prepared by oneself or a commercialized system can be purchased (for example, takara, product number 1166A).

[0064] After the above system is mixed evenly, it is incubated at 37 °C for 1.5 h. After determining the positive band by nucleic acid electrophoresis, the template is digested with DNaseI. After the product is purified, the concentration is measured and stored at -80 °C for later use.

[0065] In some of these embodiments, the mass ratio of the recombinant plasmid containing the NCCRP1 gene to Tol2 transposase mRNA is 1:(4 - 6). For example, 1:4, 1:5, or 1:6 and any value in between.

[0066] In some of these embodiments, the introduction method includes microinjection.

[0067] Microinjection is a method of operating cells or early embryos by using a micromanipulator (a mechanical device that controls the movement of a microinjection needle within the microscope field of view) under a high-power inverted microscope. The use of a glass needle (a fine glass micropipette) based on intracellular microinjection and microperfusion techniques has become a very common operating method in more and more experimental biology research fields, such as in vitro fertilization, transgenesis, etc. The most appropriate term to describe these techniques should be micromanipulation because these operations are performed on individual cells through single or multiple tubular glass micropipettes, precise positioning devices (micromanipulators), and microinjectors or microperfusion devices.

[0068] On the other hand, this application provides the cells of the non-specific cytotoxic cell transgenic zebrafish model constructed by the construction method of the above non-specific cytotoxic cell transgenic zebrafish model.

[0069] It can be understood that the cells of the non-specific cytotoxic cell transgenic zebrafish model are somatic cells.

[0070] On the other hand, the present application provides an embryo of a transgenic zebrafish model of the above-mentioned non-specific cytotoxic cells constructed by the construction method of the transgenic zebrafish model of non-specific cytotoxic cells.

[0071] On the other hand, the present application provides an NCCRP1 gene promoter, the nucleotide sequence of which is shown in SEQ ID NO.3.

[0072] On the other hand, the present application provides a kit for constructing a transgenic zebrafish model of non-specific cytotoxic cells, and the kit includes the above-mentioned NCCRP1 gene promoter.

[0073] Next, the embodiments of the present application will be described in detail in conjunction with the examples. It should be understood that these examples are only used to illustrate the present application and not to limit the scope of the present application. For the experimental methods without specific conditions noted in the following examples, the guidance given in the present application should be preferentially referred to, and it can also be carried out according to the experimental manuals or conventional conditions in the art, or according to the conditions recommended by the manufacturers, or referring to the experimental methods known in the art.

[0074] In the following specific embodiments, regarding the measurement parameters of the raw material components, if there is no special description, there may be slight deviations within the weighing accuracy range. Regarding the temperature and time parameters, acceptable deviations caused by the instrument test accuracy or operation accuracy are allowed.

[0075] It should be understood that in various embodiments of the present application, the magnitudes of the serial numbers of the above processes do not mean the sequence of execution. The execution sequence of each process should be determined according to its function and internal logic, and should not constitute any limitation to the implementation process of the embodiments of the present application.

[0076] Example 1

[0077] This example provides a method for constructing a transgenic zebrafish model of non-specific cytotoxic cells, including the following steps:

[0078] 1. Prediction of the NCCRP1-1 promoter: Through prediction websites such as TSSW, TSSP, TSSG, and FPROM, predict the possible promoter sites of NCCRP1-1.

[0079] 2. Design primers to amplify the promoter sequence

[0080] According to the database on NCBI, obtain the open reading frame (ORF) base sequence of the NCCRP1 gene, design forward and reverse primers for NCCRP1, and amplify the NCCRP1 promoter sequence.

[0081] Forward primer: 5’- (SphI) ACATGCATGCAGACGCGATATGATCGACTGTATCG -3’ (SEQ ID NO.1)

[0082] Reverse primer: 5’- (SalI) ACGCGTCGACGGTTTTGCAGTAGGTTGCGCTC -3’ (SEQ ID NO.2)

[0083] 3. PCR amplification of the target fragment

[0084] The reaction system for PCR amplification is shown in Table 1 below:

[0085] Table 1

[0086]

[0087] The PCR reaction program is shown in Table 2 below:

[0088] Table 2

[0089]

[0090] The promoter sequence is shown in SEQ ID NO.3:

[0091]

[0092] 3. Ligation: Ligate the target promoter with Tol2-EGFP;

[0093] (1)Treatment of vector and inserted fragment: Double digestion process: Tol2-EGFP vector: SphI + SalI, 37 °C for 3 h. Take a small part for nucleic acid electrophoresis detection. After confirming successful double digestion, purify it using a PCR product purification kit (Axygen, AP-PCR-250).

[0094] (2)Promoter fragment: Digest with SphI / SalI to ensure end matching.

[0095] (3)Ligation reaction:

[0096] 10 μL system: Linearized vector (50 ng): Inserted fragment (molar ratio 3:1), 1 μL of T4 DNA ligase, 1 μL of 10xT4 ligation buffer, add ddH2O to 10 μL. After mixing evenly, incubate overnight in a metal bath at 16 °C.

[0097] 4. Transformation: Transform the ligation product into DH5α for amplification;

[0098] (1)Preparation of competent cells: Use DH5α competent cells (or purchase commercial products), thaw on ice.

[0099] (2)Transformation by heat shock method: Mix the ligation product with DH5α, incubate on ice for 30 min, heat shock at 42 °C for 45 s, incubate on ice for 2 min, and add antibiotic-free LB medium for recovery (37 °C, 220 rpm, 1 h).

[0100] (3)Plate screening: Take 100 μL of the bacterial solution and spread it on an Amp-resistant plate, incubate upside down at 37 °C for 16 h.

[0101] 5. Sequencing of recombinant plasmid: Send the suspected positive clone strains preliminarily identified by PCR to Sangon Biotech (Shanghai) Co., Ltd. for sequencing to determine the positive strains;

[0102] 6. Extraction of recombinant plasmid: Expand the culture of the positive clone strains to obtain a bacterial suspension and extract the plasmid according to the plasmid extraction kit, and measure the purity and concentration;

[0103] (1)Culture conditions: Inoculate the positive bacteria into 200 mL of LB (Amp+), shake the bacteria at 37 °C until OD600 = 0.6 - 0.8.

[0104] (2)Kit operation: Use Qiagen Plasmid Plus Midi Kit, lyse, neutralize, and purify with a centrifugal column according to the instructions.

[0105] (3)Plasmid detection: Measure A260 / A280 (1.8 - 2.0) with a spectrophotometer and verify the supercoiling ratio by electrophoresis.

[0106] 7. Microinjection: At the 1-cell stage of AB zebrafish embryos, inject 50 pg of Tol2-NCCRP1-eGFP recombinant plasmid and 200 pg of transposase mRNA into each embryo; among them, the structural schematic diagram of the Tol2-NCCRP1-eGFP recombinant vector is as Figure 1 shown.

[0107] (1)Configuration of the injection system Mix the plasmid and mRNA:

[0108] Tol2-NCCRP1-eGFP plasmid: 50 pg / embryo (concentration 1 ng / μL).

[0109] Transposase mRNA: 200 pg / embryo (purified after in vitro transcription, concentration 4 ng / μL).

[0110] Injection buffer: 0.1 M KCl + 0.05% phenol red (to track the injection volume).

[0111] (2)Injection operation Use a microinjector (such as Narishige IM-300), adjust the pressure (20 - 30 psi) and pulse time (50 ms), and inject into the cytoplasm of the animal pole of the embryo to avoid damaging the cell nucleus.

[0112] 8. Observe the expression of eGFP, pick positive embryos and raise them to sexual maturity (F0), and cross them with AB outcross to screen for the next generation with stable inheritance (F1).

[0113] (1)Fluorescence detection

[0114] Time points: Observe at 24 hpf (gastrula stage) and 48 hpf (somite formation stage) after injection.

[0115] Microscope settings: Excitation wavelength 488 nm, emission wavelength 507 nm, use GFP filter.

[0116] Positive standard: ≥50% of the embryos show stable fluorescence in the expected tissues (such as liver, intestine).

[0117] (2)Raising of F0 generation

[0118] Culture positive embryos separately (28.5°C), and cross them with AB wild-type zebrafish after sexual maturity.

[0119] 9. Collect images of the F1 generation embryos at different developmental stages.

[0120] Confocal microscope (Zeiss LSM 880), 20× objective lens, Z-stack layer scanning (interval 2 μm).

[0121] Example 2 Detection of the expression pattern of NCCRP1 in early zebrafish by in situ hybridization

[0122] I. The preparation steps of the NCCRP1 probe are as follows:

[0123] 1. According to the database on NCBI, obtain the open reading frame (ORF) base sequence of the NCCRP1 gene, design forward and reverse primers for NCCRP1, use zebrafish cDNA as a template, amplify to obtain a partial gene product of nccrp1, and purify it

[0124] 2. Connect the purified product with the pGM-T vector, transform it into DH5α competent cells, coat it on an LB plate containing ampicillin, and culture it overnight at 37°C.

[0125] 3. Pick several monoclonal colonies for PCR identification. The strains of PCR-positive clones are further sent to Sangon Biotech for sequencing to obtain the NCCRP1 positive strain with correct sequencing, and determine the direction of the gene sequence inserted into the vector. Expand the culture of this strain to obtain the recombinant plasmid of pGM-T-NCCRP1.

[0126] 4. According to the direction of the sequence inserted into the vector, select an appropriate restriction endonuclease to digest the recombinant plasmid to obtain a linearized pGM-T-NCCRP1 vector. Using this vector as a template, select T7 or SP6 RNA polymerase for in vitro transcription, identify by electrophoresis, purify to obtain a digoxigenin-labeled antisense RNA probe, measure the concentration, and store it at -80°C.

[0127] 5. Collect zebrafish embryos from 24 hpf to 96 hpf in sequence, fix them with 4% PFA overnight, dehydrate the fixed embryos with different methanol concentration gradients after fixation, and finally soak them in 100% methanol, and store them temporarily at -20°C.

[0128] II. The main steps of in situ hybridization are as follows:

[0129] 1. Rehydrate the embryos with different ratios of methanol gradients, digest them moderately with protease, and then fix them;

[0130] 2. Pre-hybridization: Place the embryos in the pre-hybridization solution and pre-hybridize at 65°C for 1 hour;

[0131] 3. Hybridization: Place the embryos in the hybridization solution containing the NCCRP1 probe and hybridize overnight at 65°C;

[0132] 4. Rinsing: Recover the probes and store them at -20°C. Perform gradient rinsing using HM / SSC mixture, 2×SSC, and 0.2×SSC.

[0133] The formula of the HM / SSC mixture is as follows: Hybridization Mix (HM), 50% Formamide, 5×SSC, 0.1 w / v % Tween 20, Citric acid to adjust HM to pH 6.0 (460 µL of 1M Citric acid for 50 ml of mix), 50 µg / mL Heparin, and 500 µg / mL tRNA.

[0134] 5. Blocking: Add 1 mL of blocking solution to the embryos and react at low speed on a shaker at room temperature for 3 - 4 hours.

[0135] Blocking solution: Add 2% goat serum and 2 mg / mL BSA to PBT.

[0136] 6. Incubating antibodies: Add Anti-Dig-AP antibody (Roche, 11093274910) to the blocking solution at a ratio of 1:5000. After dilution, add it to the embryos and react at low speed on a shaker at 4°C overnight.

[0137] 7. Discard the antibody reaction solution and quickly rinse once with PBT 6 times × 15 minutes at room temperature.

[0138] 8. Color development: Add NBT-BCIP (Roche, 1681451) color development solution and develop color at room temperature until signals appear.

[0139] 9. Terminating color development: After successful color development, promptly aspirate the excess color development solution and add 1 mL of stop solution (PBS pH 5.5, 1 mM EDTA) to terminate the reaction. The formula of the stop solution is as follows: 0.05M phosphate buffer pH 5.8, 1 mM EDTA, and 0.1% w / v Tween.

[0140] 10. Clearing and image acquisition: Transfer the embryos into 100% glycerol in a 6-well plate, taking care to minimize the introduction of the stop solution. Balance overnight at low speed in the dark on a shaker at room temperature to increase the light permeability of the embryos. Take pictures with a stereomicroscope. The results are as Figure 2 shown.

[0141] Result verification:

[0142] I. Detecting the expression pattern of NCCRP1 in early zebrafish by in situ hybridization

[0143] As Figure 2 shown, in situ hybridization results showed that NCCRP1 was highly expressed near the pectoral fins, in the tail hematopoietic tissue, and near the anus of zebrafish at 24 hpf and 48 hpf, while the expression decreased at 72 hpf and 96 hpf (possibly because it was difficult for the probe to enter the zebrafish at this stage).

[0144] II. Early expression pattern of NCCRP1-eGFP transgenic zebrafish

[0145] According to the existing literature, NCC in teleosts is mainly expressed in the liver, head, kidneys (head kidney, trunk kidney), spleen, intestine, brain, gills, heart, and skin. Photographs of F1 transgenic zebrafish at different developmental stages were taken and observed. It was found that NCC cells had pseudopodia (observation of eGFP-positive cells around the tail trunk), and NCC was mainly distributed in the trunk kidney, head kidney, pectoral fins, hucho taimen, notochord, brain, skin, etc. of early zebrafish (as Figure 3 shown). These expression sites were highly consistent with our previous in situ hybridization results and literature reports, indicating that the transgenic zebrafish was successfully constructed.

[0146] The above results indicate that this application has established a stably heritable and visual NCC transgenic zebrafish.

[0147] III. Verification of the tropism of zebrafish NCC to the damaged site

[0148] By damaging the caudal fin of NCCRP1-eGFP transgenic zebrafish at 72 hpf (as shown by the white dotted line), the response of zebrafish NCC to the damaged site 2 hours after injury was observed. The results showed that compared with the uninjured zebrafish (Ctrl), NCC in the injured zebrafish (Lesion1 and Lesion2) was significantly activated (the number of eGFP-positive cells increased), and the density of NCC around the damaged site also increased significantly, indicating that NCC, like other innate immune cells, has a tropism for the damaged site, suggesting that it may participate in the body's injury repair process. The results are as Figure 4 shown.

[0149] The above-described embodiments merely represent several implementation manners of the present application, facilitating a specific and detailed understanding of the technical solutions of the present application. However, it should not be construed as a limitation to the scope of patent protection of the application. It should be noted that for those of ordinary skill in the art, without departing from the concept of the present application, several variations and improvements can be made, and these all fall within the protection scope of the present application. In addition, it should be understood that after reading the above teachings of the present application, those skilled in the art can make various changes or modifications to the present application, and the equivalent forms obtained also fall within the protection scope of the present application. It should also be understood that the technical solutions obtained by those skilled in the art through logical analysis, reasoning, or limited experiments based on the technical solutions provided by the present application are all within the protection scope of the appended claims of the present application. Therefore, the protection scope of the patent of the present application shall be subject to the content of the appended claims, and the specification can be used to interpret the content of the claims.

Claims

1. A method for constructing a transgenic zebrafish model of non-specific cytotoxic cells, characterized in that, Comprising: A recombinant plasmid containing the NCCRP1 gene and transposase mRNA are co-introduced into fertilized eggs of wild-type zebrafish, reared to maturity to obtain F0 generation zebrafish, and then the F0 generation zebrafish are mated with wild-type zebrafish; and, Positive offspring are screened out to prepare transgenic zebrafish with non-specific cytotoxic cells.

2. The method for constructing a transgenic zebrafish model of non-specific cytotoxic cells according to claim 1, characterized in that The method further includes mating the screened positive offspring with wild-type zebrafish to obtain transgenic zebrafish with non-specific cytotoxic cells with stable inheritance.

3. The method for constructing a transgenic zebrafish model of non-specific cytotoxic cells according to claim 1, characterized in that, The preparation process of the recombinant plasmid containing the NCCRP1 gene includes: Obtaining the NCCRP1 gene promoter through PCR reaction, and ligating the NCCRP1 gene promoter and the vector by enzymatic digestion to construct a recombinant plasmid; Optionally, the primers for the PCR reaction are as shown in SEQ ID NO.1-SEQ ID NO.2; Optionally, the vector includes Tol2-EGFP.

4. The method for constructing a transgenic zebrafish model of non-specific cytotoxic cells according to claim 3, wherein, The nucleotide sequence of the NCCRP1 gene promoter is as shown in SEQ ID NO.

3.

5. The method for constructing a transgenic zebrafish model of non-specific cytotoxic cells according to any one of claims 1 to 4, characterized in that, The transposase mRNA is obtained by in vitro transcription after single enzymatic digestion of the PCS2+transposase plasmid.

6. The method for constructing a transgenic zebrafish model of non-specific cytotoxic cells according to claim 5, wherein The enzymatic digestion system includes: one or more of the PCS2+transposase plasmid, 0.08 w / v%-0.12 w / v% BSA, and NotI restriction endonuclease.

7. The method for constructing a transgenic zebrafish model of non-specific cytotoxic cells according to claim 5, wherein The reaction of the enzymatic digestion system satisfies one or more of the following conditions: (1) Incubate at 36.5°C - 37.5°C for 1.4 h - 1.6 h; (2) After determining the positive band by nucleic acid electrophoresis, digest the template with DNaseI, and measure the concentration of the product after purification; and (3) Store at -82°C - 78°C for later use.

8. The method for constructing a transgenic zebrafish model of non-specific cytotoxic cells according to any one of claims 1 to 4, characterized in that, The mass ratio of the Tol2 recombinant plasmid containing the NCCRP1 gene to the transposase mRNA is 1:(4 - 6).

9. The method for constructing a transgenic zebrafish model of non-specific cytotoxic cells according to any one of claims 1 to 4, characterized in that, The introduction method includes microinjection.

10. Cells or embryos of a transgenic zebrafish model of non-specific cytotoxic cells constructed by the method for constructing a transgenic zebrafish model of non-specific cytotoxic cells according to any one of claims 1 to 9.

Images