Mouse model construction method of type I classical dendritic cell specific expression Cre recombinase

Abstract

The invention relates to a method for constructing a mouse model of type I classical dendritic cell specific expression Cre recombinase, and belongs to the technical field of genetic engineering and genetic modification. The construction method disclosed by the invention comprises the following steps: inserting a Cre-P2A-GFP-P2A element into a mouse Xcr1 gene locus at a fixed point by virtue of a CRISPR / Cas9 genome editing technology, so as to obtain a mouse model of the type I classical dendritic cell specific expression Cre recombinase, wherein the sequences of sgRNA of the Xcr1 gene locus are shown as SEQ ID NO.1 and SEQ ID NO.2. The invention also discloses a construction method of the Cre recombinase in the type I classical dendritic cell specific expression Cre recombinase and a mouse model of the type I classical dendritic cell specific expression Cre recombinase in the type I classical dendritic cell specific expression Cre recombinase. Experiments prove that the expression specificity of the Cre recombinase in the constructed mouse model of the type I classical dendritic cell specific expression Cre recombinase is obviously superior to that of the currently reported similar models, and the constructed mouse model can be used for the research work of the type I classical dendritic cell.

Description

Technical Field

[0001] The present invention relates to a method for constructing a mouse model specifically expressing Cre recombinase in type I classical dendritic cells, belonging to the technical fields of genetic engineering and genetic modification. Background Art

[0002] Dendritic cells (also known as DC cells) are the most powerful antigen-presenting cells (APCs) in the body, capable of capturing, processing, and presenting antigens, activating T cells, and thus triggering specific immune responses. The unique functions of dendritic cells make them play a central role in various immune processes such as immune surveillance, infection defense, immune tolerance, and autoimmune diseases. Moreover, subsets of dendritic cells have different developmental characteristics and are specialized in initiating different types of effector T cells, thereby adjusting the outcome of immune responses. Initially, dendritic cells were divided into lymphoid and myeloid types, but this nomenclature does not accurately reflect the developmental origin of each dendritic cell subset. According to the source and differentiation pathway, dendritic cells can be divided into conventional dendritic cells (cDCs), plasmacytoid dendritic cells (pDCs, also known as plasmacytoid dendritic cells), and Langerhans cells (LCs). Among them, conventional dendritic cells are further divided into type I classical dendritic cells (cDC1) and type II classical dendritic cells (cDC2).

[0003] cDC1s originate from CD34+ hematopoietic stem cells, and their differentiation process is regulated by a combination of transcription factors including interferon regulatory factor 8 (IRF8). They are commonly known as cross-presenting DCs, which have the ability to cross-present antigens and can induce tumor immune responses. cDC2s are the main dendritic cell population present in different tissues and organs of the human body. They express a series of TLRs and can respond to various danger signals ranging from nucleotides to polysaccharides. Compared with other steady-state dendritic cell subsets, they also express high levels of NLRPs and other inflammation-related signaling molecules, indicating their function of sensing different danger signals. pDCs respond to many RNA and DNA viruses, including VSVG, HCV, LCMV, dengue virus, etc. Among them, although cDC1 is only a subtype of dendritic cells, with the continuous in-depth scientific research in recent years, cDC1 has gradually leaped from an unknown "supporting role" to a core role determining the efficacy in the field of cancer immunotherapy because it is the "commander" for activating anti-tumor CD8+ T cells. To more deeply study what functions cDC1 plays and how it plays functions in anti-tumor, anti-viral, autoimmune responses and inflammation, as well as vaccine immune responses, it is very necessary to construct a mouse model with type I classical dendritic cells specifically expressing Cre recombinase.

[0004] There are many existing tool mice for the study of classical type I dendritic cells, including CD11c-Cre mice, Flt3-Cre mice, and Clec9a-Cre mice. However, the specificity of these mice is relatively poor. For example, CD11c-Cre in CD11c-Cre mice is expressed in dendritic cells, some macrophages, and other antigen-presenting cells (Manouchehri, N., et al., JNeuroimmunol, 2020.); Flt3-Cre in Flt3-Cre mice is expressed in hematopoietic stem cells, dendritic cells, myeloid progenitor cells, and lymphoid progenitor cells (Fanti AK, et al. Cell Stem Cell. 2023); Clec9a-Cre in Clec9a-Cre mice is mainly expressed in cDC1 cells, but also has low expression in some myeloid cells, macrophages, and precursor dendritic cells (Brioschi S, et al. Immunity. 2023). There are 2 types of Xcr1-Cre mouse models reported in the current literature. Among them, Tomokazu Ohta et al. published the first Xcr1-Cre mouse model in 2016 (DOI: 10.1038 / srep23505). However, when knocking in Cre, it completely replaced the coding region of the Xcr1 gene, disrupting the expression of the Xcr1 gene, which may have unknown effects on the mouse immune system; moreover, further experimental results showed that Cre recombinase also had activity in the cDC2 cell subset, with poor specificity. In 2020, the Bernard Malissen team published the latest research results in the journal Science Immunology (DOI: 10.1126 / sciimmunol.aba1896), creating an improved Xcr1-Cre mouse model Xcr1 Cre-mTFP1 , and its strategy was to insert the IRES-iCre-GSG-2A-mTFP1 expression element into the 3’UTR region behind the stop codon of the Xcr1 gene, achieving the expression of Cre recombinase driven by the Xcr1 promoter without disrupting the expression of the Xcr1 gene, but when mating the Xcr1 Cre-mTFP1 mice with Rosa26 LSL-tdRFP reporter mice to detect the expression specificity of Cre recombinase, the experimental results showed that red fluorescence expression could be detected in CD4+ T cells, indicating non-specific expression of Cre recombinase; further, when self-crossing the offspring of the Xcr1 Cre-mTFP1 mice with Rosa26 LSL-tdRFP reporter mice or backcrossing them with Xcr1 Cre-mTFP1 mice and detecting the expression of RFP fluorescence again in their offspring, it was found that in some mice, RFP was expressed in all tissues, indicating that in Xcr1Cre-mTFP1 There is leakage of Cre recombinase expression in the germ cells of mice.

[0005] Based on the experimental conditions of the tool mice currently used for the study of classical type I dendritic cells, it can be seen that there is leakage of Cre recombinase expression in all of them, with poor specificity, which affects the in-depth study of the function of classical type I dendritic cells. Summary of the Invention

[0006] The purpose of the present invention is to provide a method for constructing a mouse model with specific expression of Cre recombinase in classical type I dendritic cells, so as to solve the problems of leakage of Cre recombinase expression and poor specificity in the tool mice used for the study of classical type I dendritic cells in the prior art.

[0007] In order to achieve the above purpose, the technical solution of a method for constructing a mouse model with specific expression of Cre recombinase in classical type I dendritic cells of the present invention is as follows:

[0008] A method for constructing a mouse model with specific expression of Cre recombinase in classical type I dendritic cells, comprising the following steps: By using the CRISPR / Cas9 genome editing technology, the Cre-P2A-GFP-P2A element is inserted into the mouse Xcr1 gene locus at a specific point to obtain a mouse model with specific expression of Cre recombinase in classical type I dendritic cells: The sequences of the sgRNAs of the Xcr1 gene locus are shown in SEQ ID NO.1 and SEQ ID NO.2.

[0009] The beneficial effects of the above technical solutions are as follows: The method for constructing a mouse model with specific expression of Cre recombinase in type I classical dendritic cells of the present invention is an improved invention. Based on in-depth research and systematic analysis of the prior art, the present invention innovatively uses the P2A ligation element to replace the traditional IRES sequence, and precisely inserts the Cre-P2A-GFP-P2A element upstream of the start codon ATG of the Xcr1 gene. Compared with IRES, P2A has significant advantages: 1) The efficiency of co-expression of multiple proteins mediated by P2A is higher, which can ensure equimolar expression of Cre recombinase and GFP-labeled proteins; 2) The P2A sequence is shorter (only about 57bp), which is easier for vector construction and homologous recombination compared with IRES (about 600bp); 3) The "self-cleavage" mechanism mediated by P2A can produce independent functional proteins, avoiding problems such as uneven translation efficiency that may be caused by IRES. Through the CRISPR / Cas9 genome editing technology, a mouse model with specific expression of GFP-labeled Cre recombinase in type I classical dendritic cells was successfully constructed, providing a more efficient and reliable tool mouse for related research. Moreover, the present invention proves through experiments that only type I classical dendritic cells are GFP-positive, while T, B, NK, neutrophils, plasmacytoid dendritic cells and type II classical dendritic cells are all GFP-negative. Further hybridization with the Rosa26 LSL-tdRFP After hybridization with the reporter gene tool mouse, flow cytometry shows that all type I classical dendritic cells are RFP-positive, while T, B, NK, neutrophils, plasmacytoid dendritic cells and type II classical dendritic cells are all RFP-negative; hybridization with Rosa26 LSL-DTA After hybridization with the mouse, the flow cytometry results show that type I classical dendritic cells are completely cleared. This shows that the specificity of Cre recombinase expression in the mouse model with specific expression of Cre recombinase in type I classical dendritic cells constructed by the construction method of the present invention is significantly better than the similar models reported so far, and the mouse model obtained by the construction method can be used for the research work of type I classical dendritic cells.

[0010] As a further improvement, the Cre-P2A-GFP-P2A element includes a 5' homologous arm sequence and a 3' homologous arm sequence.

[0011] As a further improvement, the nucleotide sequence of the Cre-P2A-GFP-P2A element is shown in SEQ ID NO.3.

[0012] As a further improvement, the site-directed insertion includes the following steps: Mix Cas9 mRNA, sgRNA and Cre-P2A-GFP-P2A element DNA and inject them into mouse fertilized eggs, and then transplant the surviving fertilized egg cells into the oviduct of pseudopregnant mice to obtain Founder mice.

[0013] As a further improvement, the final concentration of the Cas9 mRNA is 50 - 60 ng / μL, the final concentration of the sgRNA is 50 - 60 ng / μL, and the final concentration of the Cre-P2A-GFP-P2A element DNA is 10 - 15 ng / μL.

[0014] As a further improvement, the construction method includes genotyping Founder mice to obtain a mouse model with type I classical dendritic cells specifically expressing Cre recombinase.

[0015] As a further improvement, the genotyping includes initially screening mouse individuals with the Cre-P2A-GFP-P2A element sequence inserted into the genome by PCR detection, and screening mouse individuals with correct insertion sites by PCR amplification combined with gene sequencing.

[0016] As a further improvement, the primer sequences for the PCR detection are shown in SEQ ID NO.4 - 6.

[0017] As a further improvement, the primer sequences for the PCR amplification are shown in SEQ ID NO.7 and SEQ ID NO.8. Brief Description of the Drawings

[0018] Figure 1 For the Xcr1 in Example 1 of the present invention Cre-GFP Gene knock-in (KI) mouse construction strategy and genotyping (where A is the Xcr1 Cre-GFP gene knock-in mouse construction strategy; B is gene detection of F0 mice using specific primers for Cre-GFP);

[0019] Figure 2 For Example 1 of the present invention, sequencing analysis confirmed that the Cre-P2A-EGFP-P2A unit was precisely inserted into the Xcr1 locus of F0 mice;

[0020] Figure 3 For Example 2 of the present invention, flow cytometry analysis of the specificity of GFP expression in different cells of the spleen of Xcr1 Cre-GFP gene knock-in mice and C57BL / 6 wild-type (WT) mice;

[0021] Figure 4 For Example 3 of the present invention, flow cytometry analysis of the specificity of RFP expression in different cells of the spleen of Xcr1 Cre-GFP Rosa26 LSL-tdRFP mice and C57BL / 6 wild-type (WT) mice;

[0022] Figure 5Flow cytometry analysis of Xcr1 in Example 4 of the present invention Cre-GFP Rosa26 LSL-DTA Changes in the proportions of pDC, cDC1, and cDC2 subsets in the lymph nodes of Rosa26 mice and C57BL / 6 wild-type (WT) mice Detailed implementation manners

[0023] With the development of technology and the progress of research, the research on classical type I dendritic cells covers multiple fields such as autoimmune diseases, infection immunity, tumors, immunotherapy, and vaccine development. Further research on their functions is crucial for revealing their roles. Currently, the tool mice used for the research on classical type I dendritic cells all have problems such as Cre recombinase leakage and low specificity. The present invention provides a method for constructing a mouse model with specific expression of Cre recombinase in classical type I dendritic cells by selecting appropriate knock-in sites and insertion elements. The construction method of the present invention can specifically express Cre recombinase in classical type I dendritic cells of mice, has strong operability and high specificity, and there is no leakage in T, B, NK, neutrophils, plasmacytoid dendritic cells, and classical type II dendritic cells.

[0024] The present invention will be further described below in conjunction with specific implementation manners, but the protection scope of the present invention is not limited thereto; however, these examples are only examples and do not constitute any limitation to the scope of the present invention. Modifications or substitutions can be made to the details and forms of the present invention without departing from the spirit and scope of the present invention, but these modifications and substitutions all fall within the protection scope of the present invention. The experimental methods in the following examples are all conventional methods unless otherwise specified, such as referring to the Molecular Cloning: A Laboratory Manual edited by Sambrook et al. (Sambrook J & Russell DW. Molecular cloning: a laboratory manual. 2001), or the instructions provided by the product manufacturer. The experimental materials used in the following examples are all obtained from conventional biochemical reagent manufacturers unless otherwise specified.

[0025] Specific example of a method for constructing a mouse model with specific expression of Cre recombinase in classical type I dendritic cells of the present invention:

[0026] Example 1 Xcr1 Cre-GFP Construction of a gene knock-in mouse model

[0027] This example provides a method for obtaining a gene knock-in mouse model with Cre-P2A-GFP-P2A site-directed insertion by gene editing of the Xcr1 gene locus, which specifically includes the following steps:

[0028] 1. Determine the targeting sequence

[0029] To insert the Cre-P2A-GFP-P2A sequence into the Xcr1 gene locus to maximize the co-expression of Cre-GFP and Xcr1, target sites were designed near the start codon of the Xcr1 gene. The genomic DNA sequence of approximately 1000 base pairs near the start codon of the Xcr1 gene (ID MGI:1346338) was pasted into the online design website CRISPOR (http: / / crispor.tefor.net / ). After submission, many candidate target sites could be obtained. According to the following criteria: close to the start codon and high specificity score, 2 sgRNAs were finally selected, and the sequences were as follows:

[0030] Xcr1-sgRNA1: 5’-TAGAGGACTCCATCTGGACGCGG-3’ (shown in SEQ ID NO.1);

[0031] Xcr1-sgRNA2: 5’-AGGCTGTAGAGGACTCCATCTGG-3’ (shown in SEQ ID NO.2).

[0032] 2. Obtaining Cas9 mRNA and sgRNA1 / 2

[0033] Xcr1-sgRNA1 / 2 was obtained using the in vitro transcription kit T7 Quick High Yield RNA Synthesis Kit (NEB, E2050S). Cas9 mRNA was obtained by in vitro transcription using the mMESSAGE mMACHINE TM T7 ULTRA Transcription Kit (ThermoFisher Scientific, AM1345). The detailed operation steps refer to the kit instruction manual.

[0034] 3. Obtaining recombinant template DNA

[0035] The recombinant template DNA sequence was designed to contain the following elements: a 0.623 kb 5’ homology arm (Homology arm, HA), a codon-optimized Cre gene sequence, a P2A linker sequence, enhanced GFP, and a 0.68 kb 3’ homology arm (such as Figure 1As shown in A). The nucleotide sequence of the recombinant template DNA is shown in SEQ ID NO.3. Among them, the 1-623rd positions from the 5' end are the 5' homologous arm sequences; the 624-1676th positions from the 5' end are the Cre sequences; the 1677-1743rd positions from the 5' end are the P2A linker sequences; the 1744-2460th positions from the 5' end are the EGFP sequences; the 2461-2526th positions from the 5' end are the P2A linker sequences; the 2527-3193rd positions from the 5' end are the 3' homologous arm sequences. It is provided by GenScript Biotech Corporation.

[0036] 4. Xcr1 Cre-GFP Obtaining of gene knock-in Founder mice

[0037] Mix Cas9 mRNA, Xcr1-sgRNA1 / 2 and the recombinant template DNA to make their final concentrations: sgRNA (50 ng / μL), Cas9 mRNA (50 ng / μL), template DNA (10 ng / μL); then inject them into mouse fertilized egg cells through a microinjection operating system (Eppendorf), and further transplant the surviving fertilized egg cells into the oviducts of pseudopregnant ICR female mice. Founder mice can be obtained after 20 days.

[0038] The specific principle of gene knock-in is as follows: Under the guidance of specific sgRNA, Cas9 will cleave the DNA double strand at the targeting site. When there is template DNA (left homologous arm - Cre - P2A - GFP - P2A - right homologous arm), the body will undergo homology directed repair (HDR), thereby precisely inserting the foreign DNA sequence (Cre - P2A - GFP - P2A) into the target site to achieve gene knock-in (KI) (as Figure 1 shown in A).

[0039] 5. Xcr1 Cre-GFP Genotype detection of gene knock-in mice

[0040] A. Obtain the genomic DNA of the Founder mice in step 4, and the steps are as follows:

[0041] Respectively cut about 5 mm of mouse tail tissue and place it in 500 μL of tissue lysate. Shake it at 56 °C for 2 hours to fully lyse. Centrifuge at 10000 rpm for 5 min, aspirate 350 μL of the supernatant, add 2 volumes of absolute ethanol, and white flocculent precipitate can be seen. Centrifuge at 10000 rpm for 15 min, discard the supernatant, retain the precipitate at the bottom of the tube, add 500 μL of 75% ethanol, centrifuge and discard the supernatant. Wait for the precipitate at the bottom of the tube to dry, add 100 μL of deionized water to fully dissolve it, which is the genomic DNA solution.

[0042] B. Using the obtained genomic DNA as a template, perform PCR amplification with Cre-GFP specific primers, and detect the amplification products by agarose gel electrophoresis to preliminarily screen out the mice with the target sequence inserted in the genome. Specifically:

[0043] First, use three primers (oGE059: GAGAAATGGGGCTTGGGACA (shown in SEQ ID NO.4), oGE060: ACAGGACAATGGTAGAGATGGTG (shown in SEQ ID NO.5), oGE061: AAGGGCATCGACTTCAAGGAG (shown in SEQ ID NO.6)). PCR amplification shows that the band size of the wild type is 367bp, and PCR amplification shows that the band size of the gene knock-in is 505bp) for preliminary screening to determine the presence of the inserted sequence in the genome. The PCR system is as follows: 0.3 μL of each of the three primers, 7.5 μL of 2×Taq Master Mix (Vazyme P112-01), 2 μL of genomic DNA, and add H2O to a total volume of 15 μL; PCR reaction program: pre-denaturation at 94 °C for 5 min; denaturation at 94 °C for 30 sec, annealing at 60 °C for 30 sec, extension at 72 °C for 40 sec, 35 cycles; final extension and termination at 72 °C for 10 min. Perform gel electrophoresis detection on the PCR products. The detection results are as Figure 1 shown in B below. For the mouse samples with Cre-GFP sequence inserted from 1 to 20, there are target amplification bands of 505bp, indicating that the insertion site of the Cre-GFP sequence is correct, while the wild type control sample has no amplification band, only the wild 367bp band.

[0044] Then, use primers for the left homologous arm and the right homologous arm (F: TGTAGTAGCCCAATTCTCAATCTTGT (shown in SEQ ID NO.7), R: AGAGAGTACAGGACAATGGTAGAGA (shown in SEQ ID NO.8), amplification size is 2182bp) to perform PCR amplification on the samples preliminarily screened as positive (PCR system is as follows: 0.2 μL of each of the F and R primers, 5 μL of 2×Taq Master Mix, 1 μL of genomic DNA, and add H2O to a total volume of 10 μL; PCR reaction program: pre-denaturation at 95 °C for 5 min; denaturation at 94 °C for 30 sec, annealing at 60 °C for 30 sec, extension at 72 °C for 90 sec, 35 cycles; termination reaction at 72 °C for 10 min), and sequence the PCR products (Wuhan Kingcare Bioengineering Co., Ltd.). Select the individuals with the correct inserted target sequence, which are the Xcr1 Cre-GFP gene knock-in model mice. The sequencing results are as Figure 2As shown, the target insertion sequence in the positive mice is correct, and the insertion site is exactly the same as the designed site, indicating that the above method successfully constructs the Xcr1 Cre-GFP gene knock-in mouse model.

[0045] Example 2 Xcr1 Cre-GFP Cre-specific identification of the gene knock-in mouse model

[0046] In this example, flow cytometry was used to detect whether GFP exists in different cells in the spleen of Xcr1 Cre-GFP gene knock-in mice. The specific implementation is as follows:

[0047] After taking the mouse spleen, place it in a C-Tube containing 5 mL of digestive enzyme suspension (RPMI solution containing 10% fetal bovine serum, 0.1 mg / mL DNase I, and 0.2 mg / mL collagenase IV), invert it and place it on the gentleMACS TM for grinding and digestion. Then quickly filter the sample through a 150-mesh filter membrane into a 15-mL centrifuge tube, centrifuge at 1500 rpm at 4°C for 5 min, discard the supernatant, add 5 mL of FACSBuffer, pipette and mix well to obtain a single-cell suspension. Then take 10 μL of the cells into a flow tube, add 390 μL of sytoxblue, and use an Attune NxT flow cytometer for counting.

[0048] According to the counting results, take 1×10 6Transfer the cells to a flow tube, add 2 mL of 1×PBS, then centrifuge at 1400 rpm for 5 min at 4°C, and discard the supernatant; resuspend the cells in 100 μL of 1×PBS, then add 1.5 μL of live dead blue, resuspend the cells, incubate at 4°C for 30 min, add 2.0 mL of 1×PBS to resuspend the cells, centrifuge at 1400 rpm for 5 min at 4°C, and discard the supernatant; add 50 μL of 24G2, incubate at 4°C for 15 min, then directly add 50 μL of Ab Mix, add 5 μL of Super Bright Complete Staining Buffer (ThermoFisher Scientific, SB-4401-42), then resuspend and mix well, incubate at 4°C for 20 min; add 2 mL of FACS Buffer, then centrifuge at 1400 rpm for 5 min at 4°C, and discard the supernatant, add 100 μL of SAV-BV785, then incubate at 4°C for 20 min; add 2 mL of FACS Buffer, then centrifuge at 1400 rpm for 5 min at 4°C, and discard the supernatant, add 500 μL of FACS Buffer, resuspend the cells, and analyze them on a BD-Symphony A5 flow cytometer (antibodies include: anti-CD172a APC, anti-CD172a Alexa700, anti-XCR1 Apc-cy7, anti-MHCII eFlour450, anti-CD11b eFlour506, anti-B220 SuperBright600, anti-CD11c BV650, anti-CD19 / CD5 / NK1.1 / LY6G BV785, anti-CD45 BV805, anti-CD8a PE-Cy5.5, anti-F4 / 80 PE-Cy7). And further complete the data analysis through Flowjo 10.0 software.

[0049] The results are as Figure 3 shown, where Lin represents T, B, NK, and neutrophils, CD45 + Lin - CD317 + represents plasmacytoid dendritic cells (pDC), CD45 + Lin - CD317 - CD11c + MHCII + CD11b - Xcr1 + represents classical dendritic cells type 1 (cDC1), CD45 + Lin -CD317 - CD11c + MHCII + CD11b + Xcr1 - are type II classical dendritic cells (cDC2); The results showed that all cells in wild-type control mice were GFP-negative, and all cDC1-positive cells in Xcr1 Cre-GFP mice were GFP-positive, while T cells, B cells, NK cells, neutrophils, pDCs, and cDC2 cells were all GFP-negative.

[0050] Example 3 Identification of Xcr1 Cre-GFP Rosa26 LSL-tdRFP mouse model for the specificity of Xcr1 Cre expression

[0051] In this example, by crossing Xcr1 Cre-GFP mice with Rosa26 LSL-tdRFP reporter gene tool mice ( https: / / www.jax.org / strain / 038164 , JAX stock#038164), Xcr1 Cre-GFP Rosa26 LSL-tdRFP mice were obtained, and then flow cytometry was used to detect whether there was leakage in T, B, NK, and Neutrophils cells in their spleens, and then the specificity of Xcr1 Cre was determined. The specific steps were the same as those in Example 2.

[0052] The results were as Figure 4 shown. All cells in wild-type control mice were RFP-negative, and all cDC1-positive cells in Xcr1 Cre-GFP Rosa26 LSL -tdRFP mice were RFP-positive, while T, B, NK, Neutrophils, pDCs, and cDC2 cells were all RFP-negative, indicating that Xcr1 Cre had strong specificity and there was no leakage.

[0053] Example 4 Identification of the clearance efficiency of Xcr1 Cre-GFP Rosa26 LSL-DTA mouse model for Xcr1 Cre clearance efficiency

[0054] In this example, by crossing Xcr1 Cre-GFP mice with Rosa26 LSL-DTA ( https: / / www.jax.org / strain / 009669, Xcr1 was obtained by crossing JAX mice (stock #009669). Cre-GFP Rosa26 LSL-DTA mice, and then the clearance efficiency of Xcr1 was determined by detecting whether cDC1-positive cells still existed in their lymph node cells through flow cytometry. The specific implementation operations are as follows: Cre After removing the lymph nodes of the mice, place them in a C-Tube containing 5 mL of digestive enzyme suspension (RPMI solution containing 10% fetal bovine serum, DNase I, and collagenase IV), invert and place it on a gentleMACS

[0055] for grinding and digestion. Then quickly filter the sample through a 150-mesh filter membrane into a 15-mL centrifuge tube, centrifuge at 4°C and 1500 rpm for 5 min, discard the supernatant, add 5 mL of Facs Buffer, pipette and mix well to obtain a single-cell suspension. Then take out 10 μL of the cells into a flow tube, add 390 μL of sytox blue, and use an Attune NxT flow cytometer for counting. According to the counting results, take 1×10 TM cells and add 100 μL of antibodies (the antibodies include: anti-MHCII eFlour450, anti-CD11b SuperBright600, anti-CD19 / CD3e / LY6G PE-Cy5.5, anti-CD317 APC, anti-CD11c Alexa700, anti-XCR1 APC-eflour780, anti-CD45PE-Cy7), incubate at 4°C in the dark for 30 min, add 1 mL of Facs Buffer for washing once, and finally add 400 μL of SytoxBlue, and analyze using an Attune NxT flow cytometer. 6 The results are as

[0056] shown. In Xcr1 Figure 5 Rosa26 Cre-GFP mice, there were no obvious changes in pDC and cDC2 cells, and almost all cDC1-positive cells were cleared, indicating that the clearance efficiency of cDC1-positive cells in the Xcr1 LSL-DTA Rosa26 Cre-GFP mouse model was as high as 100%, and it had no effect on pDC and cDC2. This result further indicates that the Xcr1 LSL-DTA gene knock-in mouse model constructed in the present invention has very good Cre recombinase expression specificity. Cre-GFP

[0057] ​Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those of ordinary skill in the art should understand that they can still modify the technical solutions described in the foregoing embodiments, or perform equivalent replacements on some or all of the technical features; and these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A method for constructing a mouse model with Cre recombinase specifically expressed in type I classical dendritic cells, characterized in that: Comprising the following steps: By using the CRISPR / Cas9 genome editing technology, the Cre-P2A-GFP-P2A element is inserted into the mouse Xcr1 gene locus at a specific site to obtain a mouse model in which Cre recombinase is specifically expressed in type I classical dendritic cells: the sequences of the sgRNAs of the Xcr1 gene locus are as shown in SEQ ID NO.1 and SEQ ID NO.

2.

2. The method for constructing a mouse model with type I classical dendritic cells specifically expressing Cre recombinase according to claim 1, characterized in that: The Cre-P2A-GFP-P2A element comprises a 5' homologous arm sequence and a 3' homologous arm sequence.

3. The method for constructing a mouse model with type I classical dendritic cells specifically expressing Cre recombinase according to claim 1 or 2, characterized in that: The nucleotide sequence of the Cre-P2A-GFP-P2A element is as shown in SEQ ID NO.

3.

4. The method for constructing a mouse model with type I classical dendritic cells specifically expressing Cre recombinase according to claim 3, characterized in that: The specific site insertion comprises the following steps: Cas9 mRNA, sgRNA and Cre-P2A-GFP-P2A element DNA are mixed and injected into mouse fertilized eggs, and then the surviving fertilized egg cells are transplanted into the oviducts of pseudopregnant mice to obtain Founder mice.

5. The method for constructing a mouse model with type I classical dendritic cells specifically expressing Cre recombinase according to claim 4, characterized in that: The final concentration of the Cas9 mRNA is 50-60 ng / μL, the final concentration of the sgRNA is 50-60 ng / μL, and the final concentration of the Cre-P2A-GFP-P2A element DNA is 10-15 ng / μL.

6. The method for constructing a mouse model with type I classical dendritic cells specifically expressing Cre recombinase according to claim 5, characterized in that: The construction method comprises genotyping the Founder mice to obtain a mouse model in which Cre recombinase is specifically expressed in type I classical dendritic cells.

7. The method for constructing a mouse model with specific expression of Cre recombinase in type I classical dendritic cells according to claim 6, wherein: The genotyping includes PCR detection to preliminarily screen out mouse individuals with the Cre-P2A-GFP-P2A element sequence inserted into the genome, and PCR amplification combined with gene sequencing to screen out mouse individuals with the correct insertion site.

8. The method for constructing a mouse model with type I classical dendritic cells specifically expressing Cre recombinase according to claim 7, characterized in that: The primer sequences for the PCR detection are as shown in SEQ ID NO.4-6.

9. The method for constructing a mouse model with type I classical dendritic cells specifically expressing Cre recombinase according to claim 7, characterized in that: The primer sequences for the PCR amplification are as shown in SEQ ID NO.7 and SEQ ID NO.8.

Images